ID: 1098571232

View in Genome Browser
Species Human (GRCh38)
Location 12:71989580-71989602
Sequence ACAGATGTGCAGATTTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098571230_1098571232 0 Left 1098571230 12:71989557-71989579 CCTAAAGAAATATGTTTTAAAAG 0: 1
1: 0
2: 16
3: 149
4: 1405
Right 1098571232 12:71989580-71989602 ACAGATGTGCAGATTTTGGATGG 0: 1
1: 0
2: 3
3: 15
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098571232 Original CRISPR ACAGATGTGCAGATTTTGGA TGG Intronic
902105051 1:14028110-14028132 AAAGCTGTGCAGAGTTTGGGGGG - Intergenic
906988161 1:50709206-50709228 AAAGCTGTGCAGTATTTGGAAGG - Intronic
908393591 1:63705143-63705165 ACAGATGGGGAGATCTTGAAGGG - Intergenic
908486934 1:64604245-64604267 GCAGATTTGCAGATTTAGGTTGG - Intronic
909393807 1:75146934-75146956 ACAGATTTGGGGATTTTGTAAGG - Intronic
910543395 1:88386931-88386953 ACAAATGGTCAGATTCTGGATGG + Intergenic
912547402 1:110460882-110460904 ACAGAAATGCAGATTTGGGGAGG - Intergenic
912779069 1:112527045-112527067 ACAGAGGTCCAGATTTTGGATGG - Intronic
915601748 1:156927014-156927036 ACAGATGTGCCCATTGTGAAGGG - Intronic
916101499 1:161397007-161397029 TCAGATTTTCAGATTTGGGATGG + Intergenic
916371831 1:164106154-164106176 ACATATATCCAGATTTTTGAAGG + Intergenic
917680709 1:177363957-177363979 ACTGATGTGCATATAGTGGAAGG - Intergenic
918063276 1:181080764-181080786 AGTGATGTGCAGAATTTGGGCGG + Intergenic
918686969 1:187429252-187429274 ACAGATGTGGACATTTGGGAGGG - Intergenic
920335219 1:205240768-205240790 CCAGATGGGAAGATTTGGGAAGG + Intronic
920676319 1:208040872-208040894 ACAGATCTGGGGATTTGGGAAGG + Intronic
920717611 1:208355448-208355470 ACAGAAGGGGAGATTTTGGCTGG + Intergenic
1064123231 10:12637610-12637632 AAAGATGTCCTGATTTTGGGAGG + Intronic
1066587517 10:36952740-36952762 ACAGATGTACAGAGTTTGTCCGG + Intergenic
1066599329 10:37087100-37087122 ACAATTGTGCATATTTTGGTGGG + Intergenic
1066792512 10:39081375-39081397 ATAGATTTTCAGATGTTGGATGG + Intergenic
1067518884 10:46979735-46979757 AGAGATGTGCTGATTTTCTAAGG - Intronic
1067643363 10:48072099-48072121 AGAGATGTGCTGATTTTCTAAGG + Intergenic
1067807855 10:49405689-49405711 ACAGATATGCAGATGTGGAAGGG - Intergenic
1068010321 10:51441084-51441106 ACAGAGGTTGAGAGTTTGGAAGG - Intronic
1069184108 10:65400860-65400882 TCATATGTGCAGATTTTACAGGG - Intergenic
1069406854 10:68109887-68109909 CCACATGTAAAGATTTTGGAGGG + Intronic
1069489788 10:68851535-68851557 ATAGATGTACATATTTTGGGGGG - Intronic
1071536419 10:86435604-86435626 ATAGAGATGCAGATTTTGGTGGG - Exonic
1074048616 10:109862262-109862284 ACAGGTCTGCAGTATTTGGAGGG - Intergenic
1075477153 10:122745844-122745866 ACAAATGTGCAGGTGTTGCATGG + Intergenic
1077899677 11:6478550-6478572 ACAGAGGTCCAGAAGTTGGAGGG - Intronic
1078265236 11:9750606-9750628 TCAGCTCTGCAGAGTTTGGAGGG + Exonic
1078309332 11:10223296-10223318 AGTTATGTGCAGATTTTTGACGG - Intronic
1079124647 11:17709838-17709860 AGGGATAAGCAGATTTTGGAGGG + Intergenic
1079132576 11:17756174-17756196 ACAACTGTGCAGAGGTTGGAAGG - Intronic
1079588093 11:22150289-22150311 AGAGCTGTGCAGATTTTCGGTGG - Intergenic
1079843897 11:25438863-25438885 ATAGATTTGCAGATTGAGGACGG - Intergenic
1080369598 11:31619632-31619654 ACAGAGGTGAAAATTTTGGGAGG - Intronic
1080894270 11:36436076-36436098 AAAGATGTGCAGATTTTGAAAGG - Intronic
1081828776 11:46087161-46087183 AAAGATGTGCATATTTTTTATGG - Intronic
1083096135 11:60253550-60253572 ACAAAGTTGCAGAGTTTGGAAGG + Intergenic
1083106335 11:60361756-60361778 ACAAAGTTGCAGAGTTTGGAAGG - Intronic
1083957396 11:65992395-65992417 ACAGAGGTACAGATTCTGAAGGG + Intergenic
1085890885 11:80577884-80577906 ACAATTGTGCATATTTTGGTGGG - Intergenic
1086737863 11:90329591-90329613 GCAGAAGTACAGATTTTGTAGGG - Intergenic
1086944473 11:92831534-92831556 ACAGCTTTGCAGACTTTTGAAGG - Intronic
1088673201 11:112164295-112164317 AAAGAGGTACAGGTTTTGGAAGG - Intronic
1090298590 11:125613172-125613194 CCAGAGGTGAAGATTTGGGAGGG + Exonic
1090949251 11:131458352-131458374 ACAGATGTGCACATTTGGAGGGG + Intronic
1092009445 12:5097338-5097360 ACAAATGTGCGGGTGTTGGAAGG - Intergenic
1096409966 12:51369796-51369818 GCAGATGTGCTGATTGTGGAAGG - Intronic
1098367961 12:69725408-69725430 ATGGACTTGCAGATTTTGGAAGG + Intergenic
1098485674 12:71018823-71018845 ACAGATGTGGAGATGCTTGAAGG + Intergenic
1098571232 12:71989580-71989602 ACAGATGTGCAGATTTTGGATGG + Intronic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1102713079 12:114945336-114945358 ATCGATGAGCAGACTTTGGAGGG + Intergenic
1103084219 12:118049746-118049768 AAATTTGTGCAGTTTTTGGAAGG - Intronic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108100648 13:46950861-46950883 AGAGATGTACAAGTTTTGGAAGG - Intergenic
1109494632 13:63152417-63152439 ACATATTTGCAGATTTTTGGGGG + Intergenic
1109516878 13:63455165-63455187 ATAGATGTACATATTTTGGGGGG - Intergenic
1109744433 13:66604532-66604554 AAAGATATGCTAATTTTGGATGG - Intronic
1109950490 13:69496785-69496807 ACAGACATGCAGATATTTGAAGG - Intergenic
1110620460 13:77588504-77588526 AATTATGTGCACATTTTGGATGG - Intronic
1111109098 13:83684306-83684328 ACAAATGTGCAGATTCTGCCAGG - Intergenic
1111125272 13:83906643-83906665 ACAGGTGAGCACATTCTGGAGGG + Intergenic
1112229110 13:97569878-97569900 ACAGCTGTGCAGTTTAAGGAAGG - Intergenic
1112665451 13:101566782-101566804 AAAGTTGAGCAGATTTTGAATGG - Intronic
1112806211 13:103166210-103166232 ACATATGTACACATTTTGGTGGG + Intergenic
1114935676 14:27533669-27533691 ACAGGTCTGCAGGTCTTGGAGGG + Intergenic
1114969595 14:28009195-28009217 ATAAATGTGGATATTTTGGAGGG - Intergenic
1115614421 14:35080188-35080210 ACAGATGTACAGATTTTGAAAGG - Intronic
1115794368 14:36916871-36916893 ACAGAGGAGCAGATTTAGGGTGG - Intronic
1118782766 14:69020584-69020606 ACATAGGTGCAGATTTCGTATGG + Intergenic
1120896021 14:89533365-89533387 TCAGATATGCAGATTCTGGCTGG + Intronic
1121274238 14:92657003-92657025 ACACATGGGCAGAGCTTGGAAGG - Intronic
1121480869 14:94271665-94271687 AAAGATATACTGATTTTGGAAGG + Intronic
1125260094 15:37813791-37813813 AAAGATGGGCAGATTTTGCCTGG - Intergenic
1126892768 15:53223728-53223750 ACTGATGTGCAAATTTTGGCAGG + Intergenic
1127890631 15:63247565-63247587 ATAGATTTGGAGCTTTTGGAAGG + Intronic
1129071150 15:72952671-72952693 ACAGATGTGCAGCTTCTCCAGGG - Intergenic
1131757617 15:95582617-95582639 ACACATTTGGAGATTTTTGAGGG + Intergenic
1136776112 16:32872754-32872776 AAAGGTGTGCAGAGTTGGGAAGG + Intergenic
1136894503 16:33988758-33988780 AAAGGTGTGCAGAGTTGGGAAGG - Intergenic
1137301479 16:47152487-47152509 GTAGATGGCCAGATTTTGGAGGG - Intergenic
1137517126 16:49156180-49156202 GCAGAGGTGGATATTTTGGAAGG + Intergenic
1138981883 16:62279715-62279737 AAAGATGAGCTGATTTTGGAAGG + Intergenic
1140398715 16:74651963-74651985 ACAGCTCTGCAGAGTATGGAGGG - Exonic
1140674781 16:77317143-77317165 GCAGATGTACAGATTGTGGTAGG - Intronic
1140963386 16:79939694-79939716 ACATATGTACACATTTTGGTAGG + Intergenic
1203078528 16_KI270728v1_random:1134863-1134885 AAAGGTGTGCAGAGTTGGGAAGG + Intergenic
1144512527 17:15889496-15889518 ACTGATGTTCTGATTTTTGATGG - Intergenic
1146256788 17:31396219-31396241 AAAGAAATGCAGATTTTTGAGGG + Intronic
1147686932 17:42291781-42291803 CCAGATATGAAGATCTTGGAGGG + Intronic
1149035933 17:52134697-52134719 GCAGATGTGCAGTTGTAGGAGGG - Intronic
1150841995 17:68617123-68617145 ACAGAAATGGACATTTTGGAAGG + Intergenic
1151196303 17:72433774-72433796 ACAAGTGTGCACTTTTTGGAAGG + Intergenic
1151243472 17:72776185-72776207 ACAGATGTTTAGATTCTGCAGGG + Intronic
1152396809 17:80038037-80038059 ACAGATGTGCAGAATTCAGGAGG + Intronic
1153344880 18:4014658-4014680 ACAGTTGTACATATTTTGGGGGG - Intronic
1155983016 18:32200253-32200275 AAAAATGTGCACAGTTTGGATGG - Intronic
1157094642 18:44676901-44676923 ACAGATGTACAGTTTAGGGATGG + Intergenic
1157344405 18:46811485-46811507 GCAGAAGAGCAGATTTTGGGAGG - Exonic
1159293415 18:66451147-66451169 ATAGATGTGCAGATTATGCATGG - Intergenic
1159817164 18:73089315-73089337 AAGGATGTGAAGAATTTGGATGG - Intergenic
1160017612 18:75156586-75156608 GCAGATGTGCAGGTTCGGGAGGG + Intergenic
1166079128 19:40432824-40432846 AGAGATGTGCAGCTTTGGGGAGG - Intergenic
1166600138 19:44086506-44086528 ACAAATGTGAAGAATGTGGAAGG + Exonic
1166878049 19:45909993-45910015 AGAGATGGTCAGATTTGGGATGG + Intergenic
928296811 2:30090835-30090857 ACTGATGTGCATCCTTTGGAAGG - Intergenic
928354875 2:30602576-30602598 AGAGAAGTGATGATTTTGGATGG - Intronic
928879164 2:36077748-36077770 ACAGATGGGCAGATTAGAGACGG - Intergenic
929335720 2:40742658-40742680 ACAGATGTGCTAATTTTCCATGG + Intergenic
929338613 2:40784120-40784142 ACAGATCTGAAGATATTTGAAGG + Intergenic
930357389 2:50338747-50338769 ACCGATGAGCACATTTTGAAGGG - Intronic
930855686 2:56015444-56015466 CCATGTGTGCAGATTTTGCAGGG + Intergenic
931544075 2:63361591-63361613 ACACATGTGCATAGTTTAGATGG - Intronic
932121000 2:69100112-69100134 ACAGCTGTACATATTTTGAAAGG + Intronic
932801451 2:74745834-74745856 ACAGGTGTGCATTTTATGGACGG + Intergenic
933147034 2:78866509-78866531 ATAGATGTTCAGATTTAGGTTGG + Intergenic
935181459 2:100694647-100694669 TCAGTTGGGCAGTTTTTGGATGG - Intergenic
937189906 2:120085331-120085353 ACAGACCTGCAGCTGTTGGAAGG - Intronic
937975078 2:127577495-127577517 GCAGAGGGGCAGATCTTGGAGGG - Intronic
938476980 2:131625325-131625347 ACAGATGTGTACAGTGTGGAAGG + Intergenic
940206427 2:151207476-151207498 ACAGATTTGCAGATTTTCAAAGG - Intergenic
940263965 2:151817088-151817110 ACATATGTGCAGCTTGTGTAGGG - Intronic
941416018 2:165222669-165222691 CCAGATGTGAAGAATCTGGAGGG - Intergenic
941675887 2:168343190-168343212 AAAGATGTGGACATTATGGAAGG + Intergenic
943335758 2:186611700-186611722 ACAGATGGGGAAATTGTGGATGG - Intronic
943916293 2:193637177-193637199 ATAGCAGTGCAGATTTAGGAAGG - Intergenic
944632885 2:201644307-201644329 TCGCATGTGCAAATTTTGGAGGG + Intergenic
945670746 2:212800179-212800201 CAAGAGGAGCAGATTTTGGAAGG - Intergenic
946660525 2:221994098-221994120 GCAGATGGGGAGAATTTGGATGG + Intergenic
947287054 2:228528693-228528715 ACAGATGTGAAGGTTGTGGGAGG + Intergenic
1169758379 20:9067277-9067299 AAAGATGTGGTGATTTTGGCTGG - Intergenic
1170519327 20:17167639-17167661 ACATATGTGCAGGTTTTTGTGGG + Intergenic
1173024095 20:39291890-39291912 ATAGATGTGCACATTTTGTCTGG + Intergenic
1173130279 20:40386491-40386513 ACAGATGTGGATATGTGGGAAGG + Intergenic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1176409087 21:6438041-6438063 ACAGGTGTGCAGGTTGTGAACGG + Intergenic
1176991347 21:15500498-15500520 ATAGCTGTGCAGAGATTGGATGG - Intergenic
1177495426 21:21884085-21884107 TCAGATGTGCAGATGCTTGAGGG - Intergenic
1178094902 21:29204122-29204144 ATGGATGAGCAGATTTTTGATGG + Intronic
1179684579 21:43046363-43046385 ACAGGTGTGCAGGTTGTGAACGG + Intergenic
1180061994 21:45390384-45390406 ACAGGTGGGCAGGGTTTGGAAGG - Intergenic
1182848592 22:33452018-33452040 ACAGATGAGCAGATTCGGGTTGG - Intronic
1184845417 22:47081194-47081216 TCACATGGGTAGATTTTGGAAGG - Intronic
950163237 3:10775308-10775330 AGAGAGGTGGAGAGTTTGGAGGG + Intergenic
950340835 3:12242842-12242864 ATGGATGGACAGATTTTGGATGG - Intergenic
950720236 3:14877329-14877351 CCAGACGTGCAGATTCTGGGTGG - Intronic
950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
955034660 3:55255363-55255385 ATAAATGTGCAGATTTTTAAAGG + Intergenic
955126462 3:56117011-56117033 ACAGTTGAGAAGGTTTTGGAAGG + Intronic
957554156 3:81744609-81744631 ACAGATAAGCCCATTTTGGAAGG - Intronic
959848959 3:111065956-111065978 ATAGATGTACATATTTTGGGGGG + Intergenic
959897949 3:111626589-111626611 ATAGATGTACTAATTTTGGAGGG - Intronic
960378401 3:116930903-116930925 ACAGCTGTGCTGATTTGGGGTGG - Intronic
961100894 3:124198137-124198159 AAAGAAGGGTAGATTTTGGATGG + Intronic
962158383 3:132973409-132973431 ACAGAATTACAGATTTTGGCTGG - Intergenic
965774180 3:172210649-172210671 ACAAAAGTGCAGATTTTGCCAGG - Intronic
965969985 3:174542966-174542988 ACAGATGGGGAGAATTTGGGTGG + Intronic
966043129 3:175516809-175516831 GTAGATGTCCAGGTTTTGGAGGG - Intronic
968630257 4:1646960-1646982 ACTGATGTGCATATTTTCAATGG + Intronic
968884569 4:3320811-3320833 ACAGGTCTGCAGAGTTTCGAAGG + Intronic
969262863 4:6044548-6044570 ACAGATAAGCATATTTTGGATGG + Intronic
969911474 4:10450781-10450803 ACAGATGTTGAGAGTTTGCACGG - Intronic
970415082 4:15848681-15848703 GCAGAGCTGAAGATTTTGGAGGG + Exonic
970914753 4:21320218-21320240 GCAGATAAGCAGAGTTTGGAGGG + Intronic
974671040 4:65030508-65030530 AGAGTTGTGCAGATTGTGGCAGG + Intergenic
975546276 4:75563320-75563342 TAAGATGTGCGGATTTTGGCCGG - Intronic
975867234 4:78736573-78736595 ATGGATGTGAAGATTTTGAAAGG - Intergenic
977182335 4:93891908-93891930 ACAGTTGTACAGATTTTTTACGG + Intergenic
977585178 4:98767862-98767884 ACAGATGTGGACATCTAGGAAGG + Intergenic
977682331 4:99810503-99810525 ACAAATGTTCAGTTTTTGGTAGG - Intergenic
977783830 4:101009632-101009654 ACAGAAGTGCAGAGGTTGAAGGG - Intergenic
977786936 4:101046883-101046905 TCAAAGGTGCTGATTTTGGATGG - Intronic
978142668 4:105335412-105335434 ACAGGTCTGCAGATCATGGAAGG + Intergenic
979549127 4:121970594-121970616 AGAGATGGGCAGATTTGTGAGGG - Intergenic
980203412 4:129685555-129685577 ACAGATGACCATATGTTGGAAGG - Intergenic
982607578 4:157534370-157534392 ACACATGTGCAGAGTTTTGAGGG - Intergenic
984890878 4:184491740-184491762 ATAGATGTACATATTTTGGGGGG - Intergenic
987325625 5:16809628-16809650 ACACATTTGCAGATTTGGGCTGG + Intronic
988529734 5:32017024-32017046 ACAGATGTGCAGATGGGGGATGG + Intronic
989304572 5:39938442-39938464 AAAAAAGTGCAGAATTTGGAAGG + Intergenic
990044054 5:51406895-51406917 AAAGATTTGAAGATTTTTGAGGG + Intergenic
990203656 5:53406023-53406045 ATAGATGTGGAGCCTTTGGAGGG + Intergenic
990227505 5:53671744-53671766 ACAGCTGTGGAAAATTTGGATGG + Intronic
990243462 5:53838588-53838610 TCCGAAGTGCAGACTTTGGAAGG + Intergenic
992386500 5:76289723-76289745 ACAAATGTCCAGAGTTAGGAGGG - Intronic
993042960 5:82836278-82836300 AGAGATGGGAAGAATTTGGAGGG - Intergenic
993183854 5:84590043-84590065 ACAGATGTTCTGATTCTGAAAGG - Intergenic
995915497 5:117240844-117240866 AGAGATTGGAAGATTTTGGAGGG + Intergenic
996366607 5:122708047-122708069 ACAGATGTGGAGCCTTTGTATGG + Intergenic
999195210 5:149777292-149777314 ACAGATGTGGAAACTTTAGAGGG + Intronic
999918511 5:156290458-156290480 CCAGCTGTGTAGATTTTGCAAGG + Intronic
1000403064 5:160853107-160853129 ACAGCGATGCAGATTTTAGATGG - Intergenic
1007405952 6:41636617-41636639 ACAGGTGTGCTCATTTTGTAAGG - Intergenic
1007708296 6:43804910-43804932 TCAGCTGAGCAGATTTTGGTGGG + Intergenic
1007889741 6:45276763-45276785 GCAGCTCTGCTGATTTTGGATGG - Intronic
1009542840 6:64985727-64985749 ACAGATGTCCAAATATTGCATGG - Intronic
1011124167 6:83988295-83988317 ACATTTGTAAAGATTTTGGATGG + Intergenic
1011158641 6:84363012-84363034 GCAGATGTTTAGTTTTTGGAAGG - Intergenic
1014350268 6:120333858-120333880 AAATATGTGCAAATTTTGTATGG - Intergenic
1015437227 6:133203218-133203240 GAGGATGTGCAGATTTTGTAGGG - Intergenic
1015945235 6:138493437-138493459 ACAGATGTTCAGTTTTTCAAGGG + Intronic
1016323266 6:142871302-142871324 AAAGATGTGCAAATATTGGAAGG + Intronic
1018459580 6:163985173-163985195 ACAGCTGTGCATGTGTTGGAGGG - Intergenic
1018995582 6:168707618-168707640 TCAAATGTGCAGATTTGAGATGG + Intergenic
1019345550 7:528367-528389 ACAGATGGGTAGATGATGGATGG + Intergenic
1019345573 7:528550-528572 ACAGATGGGTAGATGATGGATGG + Intergenic
1020518706 7:9158721-9158743 AAAGTTGTACATATTTTGGAGGG - Intergenic
1020978024 7:15032027-15032049 AGAGATGTGCAGGTTGTTGATGG + Intergenic
1021271828 7:18597933-18597955 ACATAAGTGAAGGTTTTGGAAGG + Intronic
1024981190 7:55158961-55158983 ACTGATGTTCAGGTGTTGGATGG - Intronic
1025859716 7:65315263-65315285 CCAGGTGTGCAGATTTTAGATGG - Intergenic
1026317137 7:69237208-69237230 TCAGATGTGTAGAATATGGAGGG + Intergenic
1026435129 7:70389960-70389982 ACAGACATGCATATTTTAGATGG + Intronic
1028001499 7:85502780-85502802 ACAGAGGTACAGATTTTGTTTGG + Intergenic
1028707549 7:93867929-93867951 ACAGATGTGAAGATATTCCAAGG - Intronic
1030389319 7:108906402-108906424 CCAGATATGAATATTTTGGAAGG + Intergenic
1035214433 7:157354633-157354655 ATAAATGTGCAGATATTGGCTGG - Intronic
1037536700 8:19831284-19831306 ACATATGTGACAATTTTGGAGGG + Intronic
1038555111 8:28505928-28505950 ATTGATGTGCACGTTTTGGAAGG - Intronic
1038622974 8:29162043-29162065 ACAGATGTTCATATATTGTATGG - Intronic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1039133574 8:34295037-34295059 AGAGATGTTTAGATCTTGGATGG + Intergenic
1039819921 8:41126320-41126342 ACAGTTGGCCAGGTTTTGGAAGG + Intergenic
1041138862 8:54791902-54791924 AAAGATGTGCAGCATTTGAATGG + Intergenic
1042222620 8:66488195-66488217 ACAGATGAAGAAATTTTGGAAGG + Intronic
1042255699 8:66801191-66801213 TCAGATTTTCAGATTTGGGATGG - Intronic
1043423209 8:80121620-80121642 ACAGATGTACAGAGTTTAGTGGG - Intronic
1043618351 8:82156260-82156282 CAAGATGTGGACATTTTGGAAGG + Intergenic
1044107189 8:88223980-88224002 AAAGATGCACAGATTATGGAAGG + Intronic
1044321949 8:90812077-90812099 ACAGATGTTCCTCTTTTGGAGGG + Intronic
1047060554 8:121220112-121220134 AGAGGTGTGAAGAGTTTGGAGGG - Intergenic
1048539638 8:135331079-135331101 ACAGATGGGCAGATCAGGGAAGG - Intergenic
1048844553 8:138594400-138594422 ACACATGTGCAGCATTTGTATGG + Intronic
1051415943 9:16840560-16840582 ACAGATGTGCGTATTTGGAAAGG - Intronic
1052374663 9:27705397-27705419 ACAGCTGTGCAGATAATAGAAGG - Intergenic
1052634581 9:31085784-31085806 ACAGGACTGCAGATTTTGCAGGG - Intergenic
1057523148 9:95776070-95776092 ATAAATTTGGAGATTTTGGAAGG - Intergenic
1185838951 X:3370711-3370733 ACAGGTGTGGAGATTGTGGGTGG - Intergenic
1186989471 X:15051951-15051973 AGATATGTTCAGATTTGGGATGG - Intergenic
1188544367 X:31287258-31287280 ACAGATGTACAGATGTTCTAAGG - Intronic
1188575722 X:31647298-31647320 TCAGAGTTGCAGATTTGGGATGG + Intronic
1188669705 X:32868275-32868297 ACAGCTGTGCAGATTCTCGCAGG + Intronic
1188772594 X:34172245-34172267 ACTGAGGTGAACATTTTGGAAGG + Intergenic
1188888531 X:35581450-35581472 AGAGATGGGAAGAGTTTGGAGGG + Intergenic
1189274082 X:39772238-39772260 ACAGAGTTGCAGATTCTGCAAGG - Intergenic
1189762757 X:44339488-44339510 ACAAATGTTCATATTTTAGAAGG + Intronic
1190458756 X:50650194-50650216 ACAGATATGCAAATATTGAAAGG + Intronic
1191865572 X:65700988-65701010 ACAGATGTGAGTATGTTGGAGGG - Intronic
1193473331 X:81933568-81933590 AGAGATTGGAAGATTTTGGAGGG + Intergenic
1193666085 X:84319013-84319035 TCATATGTACACATTTTGGAAGG + Exonic
1194369733 X:93057933-93057955 ACAGATGTTAAAATTATGGAAGG + Intergenic
1195768514 X:108322430-108322452 ACAGTTGAGCAGATGTTGGAGGG - Intronic
1198311682 X:135430945-135430967 ACAGATCTGCAATTTTGGGAGGG - Intergenic
1198454872 X:136806633-136806655 ACAGATTTGCTGATTTTAGATGG - Intergenic
1199917142 X:152355484-152355506 TCAGAGGTGCAGATTTTTGGTGG - Intronic
1200103766 X:153701289-153701311 AAAGGTGTGCAGAGTTGGGAAGG - Intronic
1200677924 Y:6174143-6174165 ACAGATGTTAAAATTATGGAAGG + Intergenic