ID: 1098572449

View in Genome Browser
Species Human (GRCh38)
Location 12:72003965-72003987
Sequence CAGAGAATAAAGAGTTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098572449 Original CRISPR CAGAGAATAAAGAGTTACCA AGG (reversed) Intronic
900383008 1:2394526-2394548 CAAAGACTAAAGAGTTGCCCTGG - Intronic
900838781 1:5030010-5030032 GAGGCAATAAAGAGTTTCCAAGG - Intergenic
904444167 1:30554290-30554312 CATGGATTAATGAGTTACCATGG - Intergenic
906212948 1:44022270-44022292 CAGAGAAGAAAGAGCAACCAGGG + Intronic
906317045 1:44793165-44793187 CAGAGATTAGAGAGGTAACATGG + Intergenic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
907062737 1:51447605-51447627 CAAAGAATCAAGAGTTAACTAGG + Intronic
907629762 1:56068604-56068626 CAGAGAATAGAGACTCAGCAAGG + Intergenic
907769732 1:57448953-57448975 CAGAGAAGAAAGTGTGACCATGG - Intronic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
908492619 1:64661508-64661530 CAGAGACAGAAGAGTCACCACGG - Intronic
909593905 1:77382749-77382771 CTGCTAATAAAGAGTTAACATGG + Intronic
910358227 1:86386941-86386963 CAGAGAAAGAAGATTTACCACGG - Exonic
911898955 1:103476014-103476036 CACAGAATGAAGAGTTACTGGGG + Intergenic
912995730 1:114530909-114530931 CAGAAAACACAGAGTTAGCAGGG - Intergenic
915338476 1:155162477-155162499 AAAAAAAAAAAGAGTTACCATGG - Intergenic
916441894 1:164834729-164834751 CAGAGAAGAGAAAGTTAGCAAGG - Intronic
918514296 1:185345373-185345395 CAGAGAATTAACAGGTGCCAAGG - Intergenic
918682623 1:187374029-187374051 CAGATAATAAATATTTATCAAGG - Intergenic
919349046 1:196425351-196425373 CAGAGAAAAAATGGTTGCCATGG - Intronic
919593703 1:199536462-199536484 CAGAGAATTATGAGATGCCAGGG + Intergenic
921026928 1:211293136-211293158 CAGAGATTAAAGAAATACCTTGG - Intronic
921877695 1:220217530-220217552 CACAGAATAAACAGGTAGCAGGG - Intronic
921905810 1:220494405-220494427 AAGAGAATAAAGAAGTTCCAAGG - Intergenic
924482434 1:244449571-244449593 CAAATAATACAAAGTTACCAAGG + Intronic
924866825 1:247991889-247991911 CAGAGATTAAAGAGTTTCTCAGG - Intronic
1063339700 10:5251790-5251812 CATAGAATAAAGAGACATCAGGG - Intergenic
1065682543 10:28251743-28251765 AAGTGAATAAAGAGGTGCCAGGG - Intronic
1065703323 10:28446317-28446339 AAGAAAAAAAAAAGTTACCAGGG - Intergenic
1065944401 10:30593708-30593730 CAGAGAAGGCAGAGTGACCAAGG - Intergenic
1067495733 10:46758427-46758449 CAGAGATGTAAGAGTAACCATGG - Intergenic
1067598922 10:47581961-47581983 CAGAGATGTAAGAGTAACCATGG + Intergenic
1067948582 10:50708546-50708568 CAGAGATGTAAGAGTAACCATGG + Intergenic
1067972369 10:50987337-50987359 GAGAGAAGAAAGAGTTAAGATGG - Intergenic
1068396982 10:56475039-56475061 CACAGTATAAAGAGTTAACAGGG - Intergenic
1068917464 10:62447727-62447749 CAGAAAGAAAAGAGTTTCCAGGG - Intronic
1069057395 10:63859013-63859035 CAGAGAGTAAAGAATTTTCAAGG - Intergenic
1069080839 10:64086644-64086666 CAGAGAGTTAAGATTTACCCTGG - Intergenic
1069314885 10:67085801-67085823 TAGAGAATAAAGACTTCTCAGGG - Intronic
1070229868 10:74554095-74554117 CAGAGTATAAGAAGCTACCATGG - Intronic
1071116142 10:82222673-82222695 CAGAAAATAAAGAGCTTGCAGGG - Intronic
1071650459 10:87389843-87389865 CAGAGATGTAAGAGTAACCATGG + Intergenic
1074307405 10:112291818-112291840 CAGAGACAAAAGCATTACCATGG - Intronic
1074498275 10:113999038-113999060 CAAAAAATAAAGAGTTAACTGGG + Intergenic
1080402940 11:31954236-31954258 TACAGAATAAAGAGTTGGCAGGG - Intronic
1085551214 11:77374310-77374332 GAGTAAATAAAGACTTACCAAGG + Exonic
1086431858 11:86743737-86743759 CAGAGAATAAAGACATACCTTGG + Intergenic
1088037871 11:105339264-105339286 AATAAAATAAAGAATTACCAAGG + Intergenic
1089095243 11:115914851-115914873 AAGAGAATAAAGACTGACAAGGG + Intergenic
1089269249 11:117290244-117290266 CAGAGCAGCAAGAGTTACCTGGG - Intronic
1090931795 11:131304352-131304374 AAGATAATAAAGTGTTCCCAAGG - Intergenic
1091017519 11:132065956-132065978 AAAAAAATAAAGACTTACCAAGG - Intronic
1092312290 12:7370702-7370724 GAGAGAGAAAAGAGTTAACACGG - Intronic
1092900918 12:13058648-13058670 CAGTGAACAGAAAGTTACCATGG + Intronic
1094029913 12:25999707-25999729 CAGATAATAAAAAGTTCCCAAGG + Intronic
1094118728 12:26946274-26946296 CAGAGAAAAGAAAATTACCAGGG - Intronic
1094249022 12:28338536-28338558 CAAATAATAGAGAGATACCAGGG + Intronic
1095132919 12:38565085-38565107 CAGAGAATACACATTCACCAGGG + Intergenic
1097484824 12:60183018-60183040 CAGTGCATAAAGTGATACCAGGG - Intergenic
1097656448 12:62369295-62369317 CATAAAATAGAGAATTACCAGGG + Intronic
1098526368 12:71491467-71491489 TAGAGAATAAAGTTTTTCCATGG + Intronic
1098572449 12:72003965-72003987 CAGAGAATAAAGAGTTACCAAGG - Intronic
1099004884 12:77224393-77224415 CAGAGAAAAAGGAGGAACCAGGG - Intergenic
1099062643 12:77931526-77931548 CAGAGAATTGAGGTTTACCAGGG - Intronic
1099453287 12:82834364-82834386 CAGAGGTTATAGAGTTACAAGGG - Intronic
1100748250 12:97669123-97669145 CAGAGAATTAGAAGTTACTAGGG - Intergenic
1101009492 12:100434790-100434812 CAGAAAACAAAGATTTACTATGG + Intergenic
1101232464 12:102755368-102755390 CAGACAAGAAAGAGTGAACAAGG + Intergenic
1105719160 13:23096712-23096734 AAGAAGAAAAAGAGTTACCATGG + Intergenic
1105839876 13:24244881-24244903 CAGAGAAGCAAGAGTTAAAAGGG + Intronic
1106609531 13:31265217-31265239 CAGAGTATTAACAGTTGCCAGGG + Intronic
1106915911 13:34514396-34514418 CAGAGACAAAAGAAATACCAAGG - Intergenic
1107182471 13:37477344-37477366 CATAAAATAAAGAGTTATGATGG + Intergenic
1108492117 13:50992125-50992147 AAAAGAATAAATAGTTTCCAGGG + Intergenic
1108725637 13:53177435-53177457 CATTTAATAAAAAGTTACCAGGG + Intergenic
1109201103 13:59432234-59432256 CAAAGAAAAAAGAGTCACCTAGG - Intergenic
1109704782 13:66076271-66076293 CAGAAAATAAAAAATTTCCAAGG + Intergenic
1109744423 13:66604145-66604167 AAGAGAATAAAGTGTGAGCAAGG - Intronic
1110727767 13:78845442-78845464 CAAAAAATAAAGAGTTAGCTGGG - Intergenic
1110740987 13:78996485-78996507 TAGAGAATAAAGAATTAGAATGG + Intergenic
1110927381 13:81171353-81171375 CAGAGAATAAAGATTGATTATGG - Intergenic
1110933477 13:81252759-81252781 TAAAGAATAAATAGTTCCCAGGG - Intergenic
1111059353 13:82993373-82993395 CAGAGAATAAATATTCATCAAGG + Intergenic
1111299900 13:86334979-86335001 TAGAAAATAAAGAATAACCAGGG - Intergenic
1112345467 13:98585598-98585620 CAGAGAATGAAGTTTTACAATGG - Intergenic
1112783591 13:102927924-102927946 CAGAGAAGAAAGATTTCCTAGGG - Intergenic
1113309602 13:109118164-109118186 TAGAGAAAAAAGAGTGATCAAGG - Intronic
1115966688 14:38897593-38897615 CACTAAATAAAGGGTTACCAAGG + Intergenic
1117210375 14:53491756-53491778 TAGAGAAGAAAGACTTGCCAAGG - Intergenic
1117215900 14:53551341-53551363 CTGAGAATAGAGAGATAACAAGG - Intergenic
1117682555 14:58219958-58219980 CAGAGTATACAGGGTTACCAGGG + Intronic
1117747785 14:58888820-58888842 CAGAGAATGAAGAGTTTGAAAGG - Intergenic
1118358575 14:65036608-65036630 CAGAGAATTAAGAATCACAATGG - Intronic
1119643915 14:76334950-76334972 CAGAGAATGAAGAGTCACCTCGG - Intronic
1119814340 14:77552078-77552100 AAGAAAAGAAAGACTTACCAAGG + Exonic
1119895692 14:78218194-78218216 CAGAAAAAAAAAAGTTACCTAGG + Intergenic
1120304489 14:82751439-82751461 CAGAGATTACAGAGTTAGCATGG + Intergenic
1120556918 14:85938973-85938995 CAGAGATTAAAGAGAGGCCATGG + Intergenic
1122831328 14:104398123-104398145 AAAAGAATAAAGAGTTGCGATGG + Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1124162088 15:27281084-27281106 CAGAGCAAAGAGAATTACCAAGG - Intronic
1124164000 15:27302369-27302391 CAGAGCATAGAAAATTACCAGGG + Intronic
1127456993 15:59164399-59164421 GAGAGAATAAAATGTTACCATGG - Intronic
1129740393 15:77987016-77987038 CAGTGAAGAAACAGTCACCAAGG - Intronic
1131159603 15:90096504-90096526 CAGAAAATAAAGTGCTAGCAAGG + Intronic
1131435407 15:92417937-92417959 CAGAGAATTAAGAGGAAGCAAGG - Intronic
1131816976 15:96232265-96232287 GACACAATAAAGAGTCACCATGG - Intergenic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1135894858 16:26390206-26390228 CAGAAAATGAAGACTTACAAAGG - Intergenic
1137302387 16:47164732-47164754 CTGAGAATGAAGATTTTCCAGGG + Intronic
1137867079 16:51909937-51909959 CAGATAATAAGGAGTTACTCTGG - Intergenic
1138063128 16:53912285-53912307 CAGAGGCTAAAGTGTTACCCAGG - Intronic
1138869044 16:60858615-60858637 CTGGGAATAAAGAGTAAGCAAGG + Intergenic
1139232697 16:65300615-65300637 CAGAGCATGAATAGTTATCAGGG + Intergenic
1140835222 16:78787815-78787837 CAGAAAATAAAGTGTTGGCAAGG - Intronic
1140846273 16:78891394-78891416 CAGGGAATACAGAGTTAAAAAGG + Intronic
1143024169 17:3931231-3931253 CAGAGACTAATGAATTGCCAAGG + Intronic
1143411225 17:6710435-6710457 TAGAGAATCAAAAGTTACCGAGG - Intronic
1145398886 17:22515590-22515612 CAGAGAGTGAAGAGCCACCAAGG + Intergenic
1146131538 17:30280962-30280984 CAGTGAATAAACAGTCACTAAGG - Intronic
1147306712 17:39569142-39569164 AAGGGAAGAAAGAGGTACCAGGG + Intergenic
1149811734 17:59681028-59681050 CACTGAATACAGAGTTATCAAGG - Exonic
1149929918 17:60741128-60741150 CAGAGAATCACAATTTACCAGGG - Intronic
1150365985 17:64584785-64584807 CAGAAAATAAAGAGATGCTAGGG + Intronic
1152458259 17:80428194-80428216 CAGAGAAGCAAGTGTTAGCAGGG + Intronic
1154044296 18:10889856-10889878 CATAGAAGAAAGAGCTCCCAAGG + Intronic
1154094836 18:11403291-11403313 CAGGGATTAACGAGTTATCACGG + Intergenic
1154458016 18:14547915-14547937 CAGGAAAGAAAGAGTTACCGTGG - Intergenic
1155167002 18:23239761-23239783 CAGAGAGTAAACAGTAAACAAGG + Intronic
1155679381 18:28471292-28471314 GAGAGAATAAAGAGTTTTCCTGG - Intergenic
1156142377 18:34130926-34130948 CAAAGAACAAAGAGTTTTCATGG + Intronic
1156498641 18:37543009-37543031 CAGAGATTGAAGAGTTAAAATGG - Intronic
1156806470 18:41188680-41188702 TAGAGAAAAAAGAGTGAACAAGG + Intergenic
1158930013 18:62314814-62314836 CAGAGAATAAAGTATAATCAGGG + Intergenic
1159341256 18:67136549-67136571 TAGAGAATGAAAAGCTACCAAGG + Intergenic
1161525058 19:4749253-4749275 CAAAAAATAAAGAGTTAGCTGGG + Intergenic
1162946119 19:14044823-14044845 CAGAGAATAAAACATTACCAGGG + Intronic
1166894955 19:46017224-46017246 CTGAGAAAAAGGAGTAACCAAGG - Intronic
1168486648 19:56768217-56768239 AAGAGGGTAGAGAGTTACCATGG - Intergenic
925982955 2:9191880-9191902 CAGAGAGCAAAAAGTTCCCAAGG - Intergenic
930042730 2:47140549-47140571 CAGAGAATTACAATTTACCAGGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932473727 2:71985228-71985250 CAGAGCAAAGAAAGTTACCAGGG - Intergenic
934080134 2:88460571-88460593 CAGAGAGTAAAGTGCTATCATGG - Intergenic
935181838 2:100698303-100698325 CATAAAAAAAAAAGTTACCAGGG + Intergenic
935441118 2:103096908-103096930 CAGAGCAAAAAGTGTTACCAGGG + Intergenic
936531772 2:113281178-113281200 CAGAGAATTAGGAAGTACCAAGG - Intergenic
938983525 2:136549747-136549769 CAGAGAAGCAAGAGGTACAATGG - Intergenic
939848210 2:147273384-147273406 CAGGTAATAAGGAGTCACCAAGG + Intergenic
940718231 2:157253065-157253087 CAGAGAATAATGATTATCCATGG - Intergenic
940797454 2:158095523-158095545 CAGAGTAGAAAGAGTTTTCATGG + Intronic
940951826 2:159683776-159683798 AAGAGAAAAAAGAGTTAGTAGGG - Intergenic
942999803 2:182312236-182312258 CAGAGAATGAAAAGATGCCATGG - Intronic
943347860 2:186761680-186761702 AACAGAAGAAAGAGTTTCCATGG + Exonic
943927735 2:193807772-193807794 CAAAAAATTAAGAGTTATCAAGG + Intergenic
944833183 2:203553571-203553593 CACAGAACAAAGAATTACCATGG + Intergenic
945133044 2:206595446-206595468 CTGAGAAAAGAGGGTTACCAAGG + Intronic
945136373 2:206632501-206632523 CTGAGAATAAAGAAGTTCCATGG + Intergenic
945335078 2:208582413-208582435 CAGAGACTACAGAGGTACTATGG - Intronic
945897390 2:215499237-215499259 GAGAAAATAAAGAGATACAAAGG + Intergenic
947296060 2:228631839-228631861 CAGATAATACAGAGTTAGGAAGG + Intergenic
948169151 2:235887353-235887375 CAGACAATAGGGTGTTACCAGGG - Intronic
948233068 2:236365920-236365942 CCGAGAATTAAGAGATAACAAGG + Intronic
1168911709 20:1453150-1453172 CAGGGAGTAAACAGTTACCAGGG + Intronic
1170080376 20:12468442-12468464 CAGAGAATAATGTTCTACCAAGG + Intergenic
1170086023 20:12532670-12532692 CAGAAAGTAAATAGTTGCCAGGG - Intergenic
1170435100 20:16318314-16318336 CAGAGAATAAATAGTCACGTAGG + Intronic
1172162403 20:32877843-32877865 GAGTGAATAAAGAGCTCCCAGGG + Intronic
1175382220 20:58571167-58571189 CACAGAAAAAAGAATTTCCAAGG - Intergenic
1176588537 21:8616158-8616180 CAGAGCAAAGAAAGTTACCAGGG + Intergenic
1176737828 21:10568457-10568479 CAGTAAAAAAAGAGTCACCAGGG - Intronic
1177268423 21:18813241-18813263 CAGAAAAAGAAGAGTTGCCAGGG + Intergenic
1178120149 21:29461228-29461250 AAGATGATCAAGAGTTACCATGG - Intronic
1179665323 21:42907750-42907772 CAAAGAATAAAAAATTAGCAGGG - Intronic
949282934 3:2367808-2367830 CAGAGAAAAAAAAGTTTCAATGG - Intronic
950791050 3:15472651-15472673 CAGAGAATAAAGAGAGAAAAGGG - Intronic
951313572 3:21160442-21160464 CACAAAATTAAGAGTTACCCAGG + Intergenic
952045359 3:29312411-29312433 AAGAGAACAAAGAGTGATCAGGG + Intronic
952664962 3:35893227-35893249 CAGAGGATAATGAGATAACATGG + Intergenic
953076539 3:39576476-39576498 CTGAGAATAAAGTCTTTCCAAGG - Intergenic
953144762 3:40264317-40264339 CAGAGCATATAAAGTTAGCAGGG - Intergenic
953308867 3:41857278-41857300 AAGAGAATAATGAGTACCCAAGG - Intronic
954955181 3:54512534-54512556 CAGTGAAAAAAGGGTTTCCAAGG - Intronic
956036252 3:65095347-65095369 ATGAGGATAAAGAGTAACCAAGG + Intergenic
956098011 3:65737652-65737674 CAGAAAATAAAGATTTTACATGG + Intronic
956633363 3:71338251-71338273 CAGAGAACAAATAGGTACAAAGG + Intronic
956718216 3:72096814-72096836 TAGAGAAAAGAGAGTTTCCAAGG - Intergenic
956825428 3:72993471-72993493 CAAAAAATAAAAAATTACCAGGG - Intronic
956867915 3:73387436-73387458 CAGAGATTCAAAAGTTACCCAGG - Intronic
957011829 3:75014604-75014626 TAGAGAATGAAAAGTAACCATGG - Intergenic
957253687 3:77809497-77809519 TAGAGATTAGAGATTTACCAAGG + Intergenic
959088413 3:101876380-101876402 CAGAGTATAAAGAGTAAACTCGG + Intergenic
959797420 3:110447320-110447342 CAGATAATCAAGAGTTAAAAAGG + Intergenic
963847696 3:150176509-150176531 CAGAGAATAAAGAAATACAATGG - Intergenic
964396448 3:156250772-156250794 CAGAGATAAAAGAGTGACAAAGG + Intronic
966214463 3:177488251-177488273 CAGAGATTAAAGACTCAACAGGG - Intergenic
966892906 3:184420363-184420385 AAGAGAATAAAACCTTACCATGG + Intronic
967592338 3:191293538-191293560 CAGAGACAAAATAGTTACAAAGG - Intronic
971066393 4:23037372-23037394 CACAGAATAAAAATTTTCCAAGG + Intergenic
971120795 4:23702547-23702569 CAGATAATAAATAGGTAGCAAGG + Intergenic
971467596 4:26980530-26980552 CAGAGAACAAAGAATTACCAAGG + Intronic
971955529 4:33413062-33413084 CAGAAAATAAAGAGATATAAAGG + Intergenic
972562963 4:40245082-40245104 CAGAGAACAGAAAGTTATCAGGG + Exonic
973647260 4:52962135-52962157 GGGAGATTAAAGAATTACCATGG - Intronic
974211537 4:58783265-58783287 CACAGAATAAAAAATTACTAAGG - Intergenic
974653695 4:64789528-64789550 GAGAGAATAAAGATTTACAAAGG + Intergenic
977694296 4:99949776-99949798 CGGAGAATATAGAATTACCAAGG + Intronic
978131876 4:105208249-105208271 AAGAGAATGAAAAGTTAGCAAGG - Intronic
978316207 4:107440274-107440296 CTGATAAAATAGAGTTACCATGG - Intergenic
979031146 4:115649159-115649181 CAGAAAATAAAAAGTTGCTAAGG - Intergenic
979409080 4:120352630-120352652 TAGAGAATAAAGCCTTATCATGG + Intergenic
979552750 4:122009645-122009667 CAGGGAATGAAGAATTACCCTGG + Intergenic
980199295 4:129634298-129634320 CAGTGAAGAAAGATTTAACAGGG - Intergenic
982488914 4:156003660-156003682 AAGAGTATAAAGAGGTACCCAGG + Intergenic
982773987 4:159423530-159423552 AAGAGACTACGGAGTTACCAGGG - Intergenic
983636707 4:169905242-169905264 CAGAAAATAAAGAGGTGCCATGG + Intergenic
983788573 4:171764953-171764975 CACAGAATAAACACTTAACATGG - Intergenic
983794362 4:171842303-171842325 CAGAAAATAAAAAGTAAGCAAGG - Intronic
984428534 4:179619202-179619224 CACAGCATAAATAATTACCATGG - Intergenic
984949270 4:184994646-184994668 CAGAGAGAAAAGCGTTATCACGG - Intergenic
986515128 5:8553445-8553467 AAGAGAATAAAGAGTAAACAAGG + Intergenic
986583590 5:9291518-9291540 GAGAGAATAAAGAGATGACATGG + Intronic
986855920 5:11868692-11868714 AATAGATTAATGAGTTACCATGG + Intronic
987609618 5:20185490-20185512 CAAAGAACTAAGAGTGACCAAGG - Intronic
988729842 5:33961194-33961216 CAGGGAATAAAGAGGTACCCAGG - Intronic
989707089 5:44347564-44347586 AAGAGAAGAAAGATTTGCCAGGG - Intronic
993012223 5:82496131-82496153 CTGAGAATAAACTGTTACCAAGG + Intergenic
993388984 5:87295103-87295125 CAGAGCATGGAAAGTTACCAGGG - Intronic
995011788 5:107264465-107264487 TAGAGATGAAAGAGTTATCAAGG + Intergenic
996113929 5:119597726-119597748 GAGAGGATACAGTGTTACCAGGG - Intronic
996219293 5:120910013-120910035 AAGAAAATGAAGAGATACCAGGG - Intergenic
996278488 5:121697543-121697565 CACAGGGTAAAGAGGTACCAAGG - Intergenic
997615941 5:135246297-135246319 CAGAGAAAGAAAAGTTGCCATGG + Intronic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1001317151 5:170651757-170651779 GAGACAATAAATAGTTACAAAGG - Intronic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1004742760 6:18478026-18478048 CAGAGAGCAAAAAGTTTCCATGG - Intergenic
1004758601 6:18641065-18641087 CAGAGAAAAAATACTTATCATGG - Intergenic
1004898399 6:20171035-20171057 TACAGAATAAAGAGTAAGCACGG - Intronic
1005665505 6:28049521-28049543 TAGGGAACAAAGACTTACCAGGG + Intergenic
1005893377 6:30158210-30158232 CAGAGAGCAAAAAGTGACCAGGG + Intronic
1005942784 6:30573181-30573203 TGAAGAATAAAGAGTTACTAAGG + Intronic
1007481778 6:42155078-42155100 GATAGAATGAAGAGTTGCCAAGG + Intergenic
1008060772 6:46994405-46994427 CAAAGAATGAAGATTTATCAGGG + Intergenic
1010558883 6:77323233-77323255 CAGAGAACAGAGAGTTATTATGG - Intergenic
1010704229 6:79088789-79088811 GAGAAAATAAAGAGTAACAAGGG + Intergenic
1011823238 6:91276735-91276757 CAGAGAAGAAAGAGTAAAGAGGG - Intergenic
1012984680 6:105863148-105863170 CAGAGAATAGATAGTTTCAAAGG - Intergenic
1014530295 6:122551211-122551233 GAGAAATTAAAGAGTAACCAGGG - Intronic
1015859265 6:137658464-137658486 CAGTGAATAGAGATTTAGCATGG + Intergenic
1017040782 6:150307169-150307191 GATAGAATGAGGAGTTACCAAGG - Intergenic
1017576349 6:155809001-155809023 TAGTGAATAATGAGATACCAGGG + Intergenic
1018150637 6:160934172-160934194 AAGAGAAAAAAGAAGTACCAGGG - Intergenic
1020432495 7:8128156-8128178 CAGAGAACAAAACGTCACCACGG + Intronic
1020746340 7:12083266-12083288 CAGAGGAAAAAGAATTACAAAGG + Intergenic
1021112899 7:16715587-16715609 CAGAGAATAGAGAGTAACACAGG + Intergenic
1022224701 7:28350961-28350983 AAGAGACTCAACAGTTACCATGG + Intronic
1023620212 7:42064094-42064116 CAGAGTATAAAGAGTAATGAGGG + Intronic
1023660075 7:42462076-42462098 CAGAGAATATAGAGATTTCAAGG + Intergenic
1024057718 7:45674804-45674826 CAGAGCAAAAAAATTTACCAGGG - Intronic
1024448782 7:49514214-49514236 CAGAGAACAGGAAGTTACCAAGG + Intergenic
1024791215 7:52966937-52966959 CAGAGAATAAGGAGAGAACAAGG + Intergenic
1026159149 7:67853410-67853432 ACCAGAATAGAGAGTTACCATGG - Intergenic
1027491845 7:78837150-78837172 CAGAGAATTTTGAGTTAACAAGG - Intronic
1027552992 7:79622398-79622420 AACAGAATAAAGAGAAACCAAGG + Intergenic
1028571159 7:92288897-92288919 CAGAGCATTCAGAGTTACCATGG - Intronic
1028789080 7:94832981-94833003 GAGAGAATGAAGATATACCATGG - Intergenic
1029191012 7:98772353-98772375 CAGAGAAGAACGAGTTGTCAGGG + Intergenic
1029546583 7:101213294-101213316 CAGGGAATAAAGGGACACCAGGG + Intronic
1029970729 7:104786104-104786126 CAAGGAATAAACACTTACCAAGG + Intronic
1030400295 7:109040675-109040697 CAAAAAAAAAAGAGGTACCATGG + Intergenic
1031443972 7:121828317-121828339 CAGATAATTCAGAGTTACCTGGG + Intergenic
1032691515 7:134292330-134292352 TAGAGAAAAAACAGTTCCCAGGG + Exonic
1033897513 7:146092384-146092406 CACTGAATAAGGAGTTACAAAGG - Intergenic
1036026683 8:4916730-4916752 CAAAGAATAAATAGGTATCAAGG + Intronic
1037357213 8:18034041-18034063 TATAAAATAAAGAGTTACTATGG - Intergenic
1037453364 8:19039153-19039175 CAGAGAAAAAAGGATTCCCATGG - Intronic
1038735558 8:30165932-30165954 CAAAAGACAAAGAGTTACCACGG - Intronic
1040934481 8:52768248-52768270 CAGAGAATAATTCCTTACCATGG - Intergenic
1042823998 8:72961795-72961817 CACAGAATAAAGAATTCCCAAGG + Intergenic
1043405709 8:79930334-79930356 CAGAGATTAAAGAGTAACACGGG - Intronic
1044352508 8:91183687-91183709 CAAAGAATTATGAGTTATCAAGG + Intronic
1045672282 8:104568768-104568790 CAGACAATAAAGTGTTGGCAAGG + Intronic
1046520116 8:115313921-115313943 AAGACAATAAAGAATTACTAAGG + Intergenic
1048556909 8:135487511-135487533 AAGAGAATAAGGTGTTACCATGG + Intronic
1048573110 8:135671083-135671105 CAGAGAATCAAGAGTTAGAGGGG - Intergenic
1049908163 9:238438-238460 AAGAAAATAAAAAGTTAACATGG + Intronic
1053266201 9:36715408-36715430 CAGAAAATGAAGAAATACCATGG - Intergenic
1053423151 9:37993405-37993427 CAGAAAATATAAAGTTCCCAGGG + Intronic
1056574505 9:87844481-87844503 CAGAGATGTAAGAGTAACCATGG - Intergenic
1056588888 9:87949409-87949431 CAGAGAAAAGACAATTACCAGGG - Intergenic
1057712485 9:97459148-97459170 CAGAGCCTAAACATTTACCATGG - Intronic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059982648 9:119790153-119790175 CAAAGAATCAAGAGTTAGCAGGG - Intergenic
1203624830 Un_KI270750v1:5494-5516 TAGAGAATTAAGATTTACAAAGG + Intergenic
1189541915 X:42000480-42000502 TAGAGAACAGAGAGTTACAAGGG + Intergenic
1189961400 X:46327923-46327945 CACTGAATGAAGAGTTTCCAAGG - Intergenic
1190524160 X:51311375-51311397 CAGAGAAACTAGAGTTAGCAGGG - Intergenic
1190544494 X:51511394-51511416 CAGAGAAGAGAGAGAGACCAAGG - Intergenic
1192096251 X:68214316-68214338 CAGAGAATAAGAAATTAACAAGG + Intronic
1192169467 X:68845260-68845282 AACAGAATCAAGAGTTACCTGGG - Intergenic
1193133629 X:77945560-77945582 CACAACATAAAGAGTTATCAAGG - Intronic
1194282415 X:91969635-91969657 CAAAAAATAAAAAATTACCAGGG + Intronic
1195292941 X:103446606-103446628 CAGAGGATAAAAATTTCCCAGGG + Intergenic
1195842147 X:109185812-109185834 AAGATAATTAAGAATTACCATGG - Intergenic
1197516412 X:127435450-127435472 CACAGAATAAAAATTTAGCAAGG + Intergenic
1197579811 X:128268223-128268245 TAAAGAATAAAGAGTTTCAATGG - Intergenic
1198143419 X:133829780-133829802 CAGAGCAAAAAGAATTATCAGGG + Intronic
1198428059 X:136539574-136539596 CTGAGAAGAAATAGTAACCAGGG - Intronic
1198561614 X:137856481-137856503 GAGAGGATGAAGAGTTCCCAGGG - Intergenic
1200600003 Y:5194272-5194294 CAAAAAATAAAAAATTACCAGGG + Intronic