ID: 1098573082

View in Genome Browser
Species Human (GRCh38)
Location 12:72011122-72011144
Sequence AGTTATGTAAGTTCAGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098573079_1098573082 11 Left 1098573079 12:72011088-72011110 CCTCACAGTGAAGTTTAGCTATT 0: 1
1: 0
2: 3
3: 7
4: 107
Right 1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 185
1098573078_1098573082 17 Left 1098573078 12:72011082-72011104 CCATGTCCTCACAGTGAAGTTTA 0: 1
1: 0
2: 1
3: 22
4: 190
Right 1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098573082 Original CRISPR AGTTATGTAAGTTCAGCAAA GGG Intronic
901502256 1:9660081-9660103 AGTTTTGTACTTTCAGCAGACGG + Intronic
904883700 1:33719883-33719905 AGTTAGATGAGTTGAGCAAAGGG - Intronic
909209416 1:72804731-72804753 AAATATGTCAATTCAGCAAAAGG - Intergenic
909387913 1:75081436-75081458 AGATATTTAAGAACAGCAAATGG + Intergenic
910764841 1:90771396-90771418 AGTTCTGTGAGTTCAGAAAAGGG + Intergenic
911029447 1:93470569-93470591 AGATATGAAAGTCCAGGAAATGG + Intronic
911936480 1:103981614-103981636 AATAATGAAAGTTCAGTAAATGG + Intergenic
911990307 1:104687593-104687615 AGTTATTTAAGCTTAGCAAAAGG - Intergenic
919498081 1:198301619-198301641 AGTTCTGTAAGTTGAGTACAGGG + Intronic
921355044 1:214278019-214278041 AGTCATTTAAGTTCATCACAGGG + Intergenic
923516491 1:234702148-234702170 AGATAGGTAGGTTCTGCAAAGGG - Intergenic
924031500 1:239890008-239890030 AGTAGTGTAAGTTAAACAAATGG + Intronic
924737186 1:246768813-246768835 AGTCATATACTTTCAGCAAATGG - Intergenic
1064160954 10:12945892-12945914 TGTTATCTAAGTGCAGCAGAAGG - Intronic
1064420786 10:15189048-15189070 AGTTGTGTAACATCATCAAAAGG - Intergenic
1064764643 10:18659007-18659029 AGTTTTCTAAGAGCAGCAAACGG + Intergenic
1066328443 10:34391164-34391186 GGTTATAGAAGGTCAGCAAAGGG - Intronic
1071322955 10:84483063-84483085 ATTTATATAAGTTCAGCAATTGG + Intronic
1071332640 10:84575115-84575137 ATTTATGTAGCTTCAGCAAAGGG + Intergenic
1073844816 10:107543338-107543360 AGTCATGTAAGTTAAGAGAAGGG - Intergenic
1080278128 11:30525834-30525856 ATTTATGTAATTTAAGAAAATGG + Intronic
1080782305 11:35440949-35440971 AGTGGTGTAAGTTCAGCAAAAGG - Intronic
1081391902 11:42539486-42539508 AGCAATGTAGGCTCAGCAAAAGG + Intergenic
1081579038 11:44339439-44339461 TGTTGTGATAGTTCAGCAAAGGG - Intergenic
1082665232 11:55967969-55967991 AATTGTGTTAGTTCCGCAAAAGG + Exonic
1082995460 11:59251016-59251038 AGGTATGAGAGTTCAGAAAAGGG - Intergenic
1084990939 11:72925015-72925037 AGTATTTTGAGTTCAGCAAATGG + Intronic
1087321436 11:96664559-96664581 AGCTTTGTAATTTCACCAAAAGG - Intergenic
1090566179 11:127994248-127994270 AGTTATGTAAGTACAGTTTAGGG + Intergenic
1090604982 11:128412326-128412348 AATTACGTAAGTTTAGAAAAGGG + Intergenic
1091640514 12:2233526-2233548 AATCATGTAAGTTCAGCCTAGGG + Intronic
1094343014 12:29433734-29433756 AGTTATGTAAGTATATCATAAGG - Exonic
1094485158 12:30919867-30919889 CGTTAAGTATTTTCAGCAAAAGG + Intergenic
1095618136 12:44217001-44217023 AGTTATTAAAGTTTAACAAAAGG + Intronic
1097385047 12:58940732-58940754 AGTCATGTAATTTGAGAAAAAGG + Intergenic
1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG + Intronic
1100853769 12:98740195-98740217 AGCTGTGTGACTTCAGCAAATGG + Intronic
1100886028 12:99071065-99071087 AGTTTTGTACGTTAAGTAAAAGG - Intronic
1104476563 12:129075070-129075092 AAATATGTAAGTTAATCAAATGG + Intronic
1106742535 13:32660918-32660940 AGCTATGCAAGTTATGCAAAGGG - Intronic
1107574127 13:41698548-41698570 AGTCATGTAAATACACCAAAGGG - Intronic
1108945067 13:56012134-56012156 GGTTAAGTAAGTTCAGAAAAAGG - Intergenic
1108966689 13:56315137-56315159 GGTTGTGTAATTTCAGTAAATGG + Intergenic
1109037809 13:57287377-57287399 AGCAATGTAAGCTCAACAAATGG + Intergenic
1111979789 13:95003466-95003488 TGGTATTTTAGTTCAGCAAAGGG + Intergenic
1117166929 14:53044761-53044783 TGTTGTGCAAATTCAGCAAAAGG + Exonic
1121482028 14:94286142-94286164 AGTTCACTAAGGTCAGCAAAGGG + Exonic
1124644239 15:31424753-31424775 AGTAATGGAAGTTCAGCTAGAGG + Intronic
1125120331 15:36150228-36150250 AGTACTGGAAGTTCAGCTAAAGG + Intergenic
1125202110 15:37109262-37109284 ACTTATTTAAGTACATCAAAAGG - Intergenic
1125401084 15:39303972-39303994 AGTTATCTGATTTCAGCAAGTGG + Intergenic
1127416931 15:58767284-58767306 AGTTATTTAAGTTCATGAAAAGG - Intergenic
1131587216 15:93708404-93708426 ATTTTTGTAACTTCAACAAAAGG - Intergenic
1131763802 15:95653456-95653478 TGTTTTATAAGTTCAGCAGAGGG - Intergenic
1132224830 15:100132245-100132267 CTTTATGTAAATTTAGCAAATGG - Intronic
1134037074 16:11039402-11039424 ATTTATGTAAGTTCAGTTTATGG + Intronic
1135720005 16:24808337-24808359 AGTTATCTAAGTTCGGCAACAGG + Intronic
1135948665 16:26890841-26890863 AGTTATGTAAGATGAACAAGTGG - Intergenic
1139586183 16:67905286-67905308 AGTTATAGAAGGTCAGCAGAAGG - Intronic
1141816348 16:86412178-86412200 AGCTATAAAAGTTCAGCTAATGG - Intergenic
1142528211 17:560166-560188 AGTTGTGTAAGCTCCTCAAAGGG - Intronic
1145822218 17:27847625-27847647 ATTTATATAAGTACAGCACATGG - Intronic
1146029984 17:29357781-29357803 ATTTATGTAAGTTCCACAAAAGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1154180003 18:12128509-12128531 GGTTATAGAAGGTCAGCAAAGGG + Intronic
1155121468 18:22824571-22824593 AATTATGTCAGTTTAGCATAAGG - Intronic
1156282850 18:35657903-35657925 ATTTATGTATGTTCAGGAAGAGG + Intronic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1158181877 18:54725463-54725485 AGTTGTGTAAGTTCTTTAAAAGG + Intronic
1159356513 18:67343434-67343456 AGTTATTTGAGTTCAGCCAAAGG + Intergenic
1161121553 19:2529724-2529746 TGTTCTGTCAGTTCAGCAAGAGG - Intronic
1163139614 19:15338116-15338138 AGTTATGTTATTTAAACAAAAGG + Intergenic
1164334470 19:24299234-24299256 ATTTTTGTAGGTTCTGCAAATGG + Intergenic
1164347830 19:27288310-27288332 AGTTTTGTAATATCTGCAAATGG + Intergenic
1164725178 19:30461310-30461332 AGTTGTGTAAATGCAGCAGAAGG + Intronic
1165914567 19:39249790-39249812 TATGATGTATGTTCAGCAAATGG - Intergenic
1166545507 19:43632536-43632558 AGTGAAGTAAGGTCAGCAAGGGG - Intronic
929253208 2:39781142-39781164 AGTTATGTCAGTACAACCAAAGG + Intergenic
929661507 2:43790195-43790217 ATTTCTCTAAGGTCAGCAAACGG - Intronic
930403809 2:50928398-50928420 AATTATGTAAAGTTAGCAAATGG - Intronic
931331104 2:61284981-61285003 AGATATTTAAATACAGCAAAAGG + Intronic
932939311 2:76143644-76143666 AAGTTTGTAAATTCAGCAAAAGG + Intergenic
937215395 2:120309494-120309516 CTTTTTGTAAGTTCAGAAAATGG - Intergenic
937544490 2:123000334-123000356 AGTTGTGTAACTTCAGAAAAAGG - Intergenic
939022521 2:136976180-136976202 AGTAATGTAAGTTCTGGACAAGG - Intronic
941248624 2:163133372-163133394 AATTGTTTAAGTTCAGCATAAGG - Intergenic
941286416 2:163618846-163618868 AGGTATGTAAGTTAAGAAACTGG - Intronic
941620800 2:167776387-167776409 ATTTAAGTAAGTTCAGCCAGTGG - Intergenic
941655400 2:168138426-168138448 AGTTTTGTAAGTTCTGTCAATGG - Intronic
942616068 2:177793367-177793389 ATTTATGTAAGTTCAAGAACAGG - Intronic
942925115 2:181422315-181422337 AGTTGTTTCAGTTCAGCAACTGG + Intergenic
943192440 2:184695900-184695922 AGTCATCTCTGTTCAGCAAATGG - Intronic
945154097 2:206819568-206819590 AGTTATATATGATAAGCAAATGG - Intergenic
945379246 2:209119903-209119925 CGTTATTTTAGTTCAGTAAATGG - Intergenic
945600269 2:211853910-211853932 GGTTATGTGTGTTCAGAAAAGGG + Intronic
945612858 2:212028009-212028031 ACTTAGGAAAGTTCAGCAACAGG + Intronic
945663258 2:212711910-212711932 TCTTATGAAAGTTCATCAAAAGG + Intergenic
945918371 2:215728878-215728900 AATTATGAAAGTTCAAAAAAGGG + Intergenic
946048698 2:216842909-216842931 AGCATAGTAAGTTCAGCAAATGG - Intergenic
947708923 2:232298932-232298954 AGTTATGGAAGATCAGGAACAGG - Intronic
1168831862 20:849791-849813 ATTTGTCTAAATTCAGCAAATGG - Intronic
1168926058 20:1580045-1580067 GGTTATTAAAGTTAAGCAAATGG - Intronic
1171724910 20:28607551-28607573 AGTTATGTAAGTTATGTAAATGG + Intergenic
1171753163 20:29075500-29075522 AGTTATGTAAGTTATGTAAATGG - Intergenic
1171789099 20:29502058-29502080 AGTTATGTAAGTTATGTAAATGG + Intergenic
1178188596 21:30254486-30254508 AATTGTGTAAGTTTAGAAAATGG - Intergenic
1180298460 22:10966243-10966265 AGTTATGTAAGTTACGTAAATGG + Intergenic
1180409953 22:12597564-12597586 AGTTATGTAAGTTATGTAAATGG - Intergenic
1182167437 22:28190517-28190539 AGGTATGTTAGTGTAGCAAATGG + Intronic
1183993674 22:41616921-41616943 AGTTATGTCAGTTCTCCAATGGG - Intronic
951045505 3:18033441-18033463 CTTTATTTAAGTTAAGCAAATGG - Intronic
952009237 3:28880936-28880958 AGTTATGAATATTCAGCAAATGG + Intergenic
956726670 3:72162271-72162293 TATTATGTATGTTAAGCAAAGGG - Intergenic
957568120 3:81910306-81910328 AATTATGTAATTACAGCACAAGG - Intergenic
960004012 3:112763547-112763569 ATTTAGGAAAGTTCAGGAAAGGG - Intronic
960381978 3:116974047-116974069 TTTTCTGTAACTTCAGCAAAAGG + Intronic
962124802 3:132605781-132605803 TGTTATGTAAGTTCAGAGGAAGG - Intronic
962615127 3:137118080-137118102 AGTTATTTCACTTAAGCAAATGG + Intergenic
963203781 3:142612267-142612289 TGTTAATTAAGTTCAGAAAAGGG - Intronic
963596159 3:147327874-147327896 AGCCCTGTAAGATCAGCAAAAGG - Intergenic
963957464 3:151270648-151270670 GACTATGTAAGGTCAGCAAAGGG + Intronic
964072231 3:152648534-152648556 AGTTAAGTAAGGTAAGTAAAGGG + Intergenic
964369869 3:155988684-155988706 GGTTATAGAAGGTCAGCAAAGGG + Intergenic
964584626 3:158283535-158283557 AGTTATGTATTTTCACGAAATGG - Intronic
965673907 3:171174689-171174711 TTTTATGTAAGTTTATCAAAAGG + Intronic
966530798 3:180977151-180977173 AGTTAAAAAAATTCAGCAAATGG - Exonic
967251857 3:187547913-187547935 AGTCATGTATTTTCAACAAAAGG + Intergenic
971175639 4:24279864-24279886 AGTTATGTACCTTAAGCATATGG - Intergenic
971584782 4:28391779-28391801 ACATAAGTAAGTTCAGAAAATGG + Intronic
971976304 4:33692535-33692557 AGTCATTCAAGTTCAGCATATGG - Intergenic
972601467 4:40576469-40576491 TGTTATGTAAGTTGATCACAGGG - Intronic
975553513 4:75637292-75637314 AGTTATTTAATTTTAGAAAAGGG - Intergenic
976139690 4:81978186-81978208 AGTTATGCAAGTTATGCAATGGG - Intronic
978246892 4:106583651-106583673 AGTTATGCAAGTTCAGTGTAGGG + Intergenic
979228254 4:118316432-118316454 TGTAATGTAAGTTTAGCAAAAGG - Intronic
979528578 4:121743167-121743189 AGTATTGAAAGTTCAACAAATGG + Intergenic
979718533 4:123870525-123870547 TGTTATGTAAATTCAGAAAAGGG + Intergenic
982262696 4:153508968-153508990 ACTTAAGTAAGTTAAACAAATGG + Intronic
982530699 4:156539189-156539211 AGTTATGTCAGTTCTGTTAAGGG - Intergenic
985436564 4:189936159-189936181 AGTTATGTAAGTTATGTAAATGG - Intergenic
988276150 5:29083245-29083267 AGTAATGTAAGTGCAGCAAAGGG + Intergenic
989850598 5:46204565-46204587 GGTTTTGTCCGTTCAGCAAATGG + Intergenic
991188874 5:63845044-63845066 AGATATGAGAGATCAGCAAAAGG - Intergenic
991763541 5:69948100-69948122 TTTTATGGAAGTTCAGGAAAAGG - Intergenic
993364235 5:87017123-87017145 AGTTGTAGAAGTTCAGGAAAAGG - Intergenic
994221234 5:97197718-97197740 ATATATGTAAGGTTAGCAAAAGG + Intergenic
994719081 5:103359967-103359989 AGTTATGAAACCTCAGAAAATGG + Intergenic
995292832 5:110478670-110478692 AATTCTGTATGTACAGCAAAGGG + Intronic
995453734 5:112330942-112330964 AGATACGTAAGGTCAGGAAATGG - Intronic
995548453 5:113255865-113255887 CGTTATGCAAGCACAGCAAAGGG + Intronic
995578085 5:113562795-113562817 ATTTAAGCAAGTTCAGAAAAGGG - Intronic
998039022 5:138939291-138939313 ACTTATGTACGTTCTGGAAAAGG - Intergenic
1000718204 5:164673662-164673684 AGCAATGTAAGTAAAGCAAAAGG - Intergenic
1001172751 5:169436569-169436591 AGCTATGAAAGTTCATAAAAAGG + Intergenic
1003668273 6:8131713-8131735 TGTTCTGTACGTTTAGCAAATGG + Intergenic
1004169166 6:13282514-13282536 AGTTGAGTAAGTACAGAAAAAGG - Intronic
1005033127 6:21529985-21530007 AGTTCTGTAAGTTCAAAGAAAGG + Intergenic
1008947281 6:57112154-57112176 AGTTATATAAGTTGAGTAGAAGG + Intronic
1010260511 6:73810358-73810380 AGTTTAGTAACTTAAGCAAAAGG + Intronic
1012409610 6:98941800-98941822 AGTTAAGCAATTACAGCAAATGG + Intronic
1012641803 6:101626737-101626759 AGTTTTGAAAATTCAGCTAAGGG + Intronic
1012773619 6:103475676-103475698 AGTTATTTTAGGTCAGTAAAGGG - Intergenic
1013020773 6:106215135-106215157 TTTTATGTAAGTACACCAAAAGG - Intronic
1013446167 6:110229952-110229974 AGTTATGTGATTTCAGGAGATGG + Exonic
1014979092 6:127925359-127925381 AGTAATGTAAGACCAGGAAATGG + Intergenic
1015259369 6:131217685-131217707 ATTAATTTAATTTCAGCAAAAGG - Intronic
1015363543 6:132370672-132370694 AGTTATTTACCTTGAGCAAAAGG - Intronic
1017311146 6:152979098-152979120 AGTAATATAAGTTAAGCAATGGG - Intronic
1018211261 6:161484262-161484284 AGTTATAGGAGTTCAGAAAATGG - Intronic
1020485930 7:8720534-8720556 AGTTTAGTAAATCCAGCAAATGG + Intronic
1020834574 7:13132967-13132989 AATAATGTAAGTTGAGAAAATGG + Intergenic
1021088531 7:16452703-16452725 AGTTATGGAAGAGCTGCAAAGGG + Intergenic
1022454236 7:30544506-30544528 AGATAAGTAAGTACAGCTAAAGG + Intronic
1022759360 7:33330716-33330738 AATTTTGTAATTTCAGCAATGGG - Intronic
1024130188 7:46344066-46344088 AGTTATGCATGTTCTGCAATAGG - Intergenic
1025527506 7:61834417-61834439 TGTTTTGTAAATTCTGCAAATGG - Intergenic
1027862862 7:83607162-83607184 AGTTATGTAAGTACAGCTTTAGG - Intronic
1031152781 7:118073881-118073903 AGTTATCCCACTTCAGCAAAGGG + Intergenic
1031848926 7:126839895-126839917 AAGTATGTACATTCAGCAAAGGG - Intronic
1031951144 7:127893456-127893478 AGTTATGTTAGTTCAGAAGTTGG + Intronic
1033471230 7:141651422-141651444 ACTTATGTAAGCTCATAAAAAGG + Intronic
1035610443 8:959237-959259 AGTTGTGTAAGTGCAGCAGCTGG + Intergenic
1035947209 8:3978525-3978547 ACTTATGTGAGTTTGGCAAAGGG + Intronic
1037025010 8:14024554-14024576 AATTCTACAAGTTCAGCAAATGG + Intergenic
1038133231 8:24757881-24757903 AGGAATGTGAGTTCAGAAAAGGG - Intergenic
1040842774 8:51802283-51802305 AGTTATGTAAATTAATCAGAAGG + Intronic
1040928303 8:52708617-52708639 AGTTCTGTAAATTCAGAGAAAGG - Intronic
1041151487 8:54939839-54939861 TGTTATGAGAGTTCAGCAAAGGG - Intergenic
1041585124 8:59507719-59507741 ACTTGTGTAAGTTGAGTAAAAGG - Intergenic
1045584401 8:103516403-103516425 AATTAAATAAGTTCAGTAAAGGG - Intronic
1046818686 8:118613438-118613460 TGTTATATAACTTCAGCAACAGG + Intronic
1047651793 8:126931128-126931150 AAGTATGTAAGTAAAGCAAATGG - Intergenic
1050250388 9:3737517-3737539 AGTAATATATTTTCAGCAAAAGG + Intergenic
1052635610 9:31099857-31099879 AGTTTTGTAACTTCAGTTAAAGG - Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1054911868 9:70462361-70462383 AGTTATCTGATTTCAGTAAATGG - Intergenic
1055502806 9:76918663-76918685 AATTCTGTAAGTGCGGCAAAGGG + Intergenic
1055699953 9:78933182-78933204 AATTGTGGAAGTTCAGCAAAAGG + Intergenic
1059017799 9:110540297-110540319 AGTTATTAAATTTCAGCTAAGGG - Intronic
1060021835 9:120138332-120138354 GATTATGTAAGCTCAGCAGAGGG - Intergenic
1061128847 9:128695173-128695195 GGTTATAGAAGGTCAGCAAAGGG + Exonic
1062337272 9:136077514-136077536 ACATATGTATCTTCAGCAAAGGG + Intronic
1203450116 Un_GL000219v1:104366-104388 AGTTATGTAAGTTATGTAAATGG + Intergenic
1186214988 X:7289956-7289978 AGTTATGTCACTTTTGCAAAGGG + Intronic
1187498155 X:19814187-19814209 ATTTCTGTAAGTACAGCCAACGG - Intronic
1191260495 X:58314439-58314461 AGTTTTGTAGGATCTGCAAAGGG + Intergenic
1193700653 X:84756501-84756523 GGTTATGGAAGGTCAGCAAAGGG + Intergenic
1196545952 X:116964161-116964183 GGTTATAGAAGGTCAGCAAAGGG + Intergenic
1196911656 X:120489995-120490017 AGTTATGTTATTTCTGGAAAGGG - Intergenic
1198417514 X:136435568-136435590 AGTAATGTAAGAACAGTAAAAGG + Intergenic
1198515470 X:137402285-137402307 AGTTATCAAAATTCACCAAACGG + Intergenic