ID: 1098574411

View in Genome Browser
Species Human (GRCh38)
Location 12:72024712-72024734
Sequence CTGGTTAATGAGGCATGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098574405_1098574411 3 Left 1098574405 12:72024686-72024708 CCTGACTTTCCACAGGATCTTCT 0: 1
1: 0
2: 0
3: 23
4: 242
Right 1098574411 12:72024712-72024734 CTGGTTAATGAGGCATGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1098574408_1098574411 -6 Left 1098574408 12:72024695-72024717 CCACAGGATCTTCTGGTCTGGTT 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1098574411 12:72024712-72024734 CTGGTTAATGAGGCATGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1098574404_1098574411 4 Left 1098574404 12:72024685-72024707 CCCTGACTTTCCACAGGATCTTC 0: 1
1: 0
2: 0
3: 21
4: 231
Right 1098574411 12:72024712-72024734 CTGGTTAATGAGGCATGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098574411 Original CRISPR CTGGTTAATGAGGCATGTGT GGG Intronic
906152379 1:43595066-43595088 ATGTTTCATGAGGCCTGTGTGGG + Intronic
907251768 1:53144198-53144220 TTGGAAAATGAGGCATTTGTTGG - Intergenic
909356364 1:74714580-74714602 CTGGTTCATGGGGCAAGTGGAGG - Exonic
909661910 1:78092877-78092899 CTGGTTGCTGAGGCATCTCTAGG + Intronic
910171322 1:84380389-84380411 GTAGTTAATGAGGCTTGGGTAGG + Intronic
912806082 1:112758197-112758219 CTGGGTCATCAGGTATGTGTTGG + Intergenic
922567362 1:226609558-226609580 CTGGTTGATGAGGGAAATGTGGG + Intergenic
1067788484 10:49270393-49270415 CTCTTTAATGAGGGAAGTGTAGG - Intergenic
1070698150 10:78578291-78578313 GTATTTAATGAGGCATGAGTTGG - Intergenic
1073369971 10:102979156-102979178 GTGGTTCATGAGGTATGTGTGGG + Intronic
1073411725 10:103348158-103348180 CAGGTTAATGAGGCTAGTTTAGG - Intronic
1074209495 10:111316779-111316801 CTGCCTAATGAGGCATGAGATGG + Intergenic
1074329183 10:112487039-112487061 CAGATTAAGGAGGCTTGTGTAGG + Intronic
1077169086 11:1158464-1158486 CTGGTGAACTGGGCATGTGTGGG - Intronic
1077617223 11:3685479-3685501 CAGGTGAATGTGGCATGTTTAGG - Intronic
1078566086 11:12415458-12415480 CTGGTTATTGAAGCACATGTTGG - Intronic
1078968106 11:16371085-16371107 CGGGTTAAATAGGAATGTGTAGG - Intronic
1080738031 11:35036643-35036665 CTGGTTAAAGAGGAATACGTAGG + Intergenic
1081105718 11:39066602-39066624 CTGGTGATTGAGGCAGCTGTGGG - Intergenic
1082251308 11:49983898-49983920 CTTCTCAATGAAGCATGTGTGGG - Intergenic
1082947116 11:58772292-58772314 CTGGTAAATAGGGCATTTGTAGG + Intergenic
1084760230 11:71266212-71266234 CTGGTGAATGAGGCAGGCGTAGG - Intergenic
1084765917 11:71308224-71308246 CTGGTTAATGAGCAATTTGCTGG + Intergenic
1092835941 12:12488285-12488307 ATGGTTAATTATGCATGAGTGGG - Intronic
1096206994 12:49731080-49731102 CTTGGTCATGAGCCATGTGTTGG - Intronic
1098574411 12:72024712-72024734 CTGGTTAATGAGGCATGTGTGGG + Intronic
1100749520 12:97681723-97681745 TTGGTTCATGAGGTTTGTGTCGG - Intergenic
1101275278 12:103193122-103193144 TTGGTTATTGATGAATGTGTTGG - Intergenic
1105551929 13:21405596-21405618 CTGATTGATGAGCAATGTGTAGG + Intronic
1106218968 13:27729049-27729071 CTGTCTAAAGAGCCATGTGTTGG - Intergenic
1106344146 13:28859486-28859508 CTGGGGAATTAGGCATGTGCTGG + Intronic
1108555617 13:51588873-51588895 CTGGATAAAAAGGCCTGTGTTGG + Intronic
1109350116 13:61169334-61169356 CTGGTTGTTAAGGCATGGGTAGG + Intergenic
1111843445 13:93478470-93478492 CTGGTAAATTATGCCTGTGTTGG - Intronic
1113698978 13:112369005-112369027 CTGGGTCATGTGGCATGTGTAGG - Intergenic
1114266429 14:21075018-21075040 CTGGTTAAGGAGGAATATGAAGG + Exonic
1114743418 14:25121369-25121391 CTGGTTCAGTAGGCCTGTGTGGG + Intergenic
1115826698 14:37286366-37286388 CTGGTTCATTAGGCCTGGGTTGG + Intronic
1121663329 14:95652384-95652406 CTGTGTAAGGAGGTATGTGTGGG + Intergenic
1127255668 15:57290665-57290687 CCGGTGAAGGAGGCTTGTGTTGG + Intronic
1129319079 15:74763826-74763848 CTGGGTAATCAGGCAGGTTTGGG + Intergenic
1135167959 16:20157098-20157120 GTGGCAAATGAGGCATTTGTTGG - Intergenic
1135601665 16:23788983-23789005 CTGGTCAATGAGACACGAGTGGG + Intergenic
1135972220 16:27080828-27080850 CTGGGACCTGAGGCATGTGTGGG - Intergenic
1139122289 16:64035021-64035043 CTTGTTAATGAAGCATATGTGGG - Intergenic
1139253352 16:65517961-65517983 CTGGTTAATGTGACATGGGAAGG + Intergenic
1141560524 16:84864774-84864796 CTGGTGGATGAGGCAGGTGGTGG + Intronic
1141998645 16:87650548-87650570 CTGGTGCATGAGGCCTGTCTCGG - Intronic
1146153495 17:30498545-30498567 CTGGTTCTTGAGGAATGAGTAGG + Intronic
1146629827 17:34461956-34461978 CTGCTTTTTCAGGCATGTGTAGG + Intergenic
1146904727 17:36610789-36610811 CTGGAGAAGGAGCCATGTGTTGG + Intergenic
1147400159 17:40176145-40176167 CTGGTAACTGTGGCATGTGCTGG + Intergenic
1148189315 17:45667563-45667585 CTCCTTGATGAGGCATCTGTTGG + Intergenic
1155742069 18:29300656-29300678 CTGCTTAATGAAGCATGAGGGGG - Intergenic
1157471438 18:47991952-47991974 CTGGGTAAGCAGCCATGTGTTGG - Intergenic
1159295981 18:66489304-66489326 GTGGTAAATAAGGCATATGTAGG - Intergenic
1163000722 19:14365035-14365057 CTGGGAAATGGGGCTTGTGTCGG + Intergenic
925376398 2:3388819-3388841 CTGGGTAATTAGGGATCTGTTGG + Intronic
926860964 2:17308293-17308315 CTGGATGATGAGGCAGGTTTTGG + Intergenic
932395807 2:71446710-71446732 CTGGTTAATAGGGCATGTTGTGG + Intergenic
933544562 2:83694456-83694478 CTGGTTAATGAGGGAGGTCAAGG - Intergenic
938158231 2:128959399-128959421 TTGGCTCATGGGGCATGTGTGGG - Intergenic
941321041 2:164054991-164055013 CTGGGTAATCAGGAATGTATAGG + Intergenic
941762332 2:169258387-169258409 CTGGGTAATCAGGCATTGGTGGG + Intronic
941856001 2:170231586-170231608 CTGGTTAATGGAGCATGTCCAGG - Intronic
943018640 2:182546109-182546131 CTTGTTACTGAAGCAAGTGTTGG + Intergenic
945775228 2:214098847-214098869 CTGGTTACAGAGGCAGGAGTTGG + Intronic
1173446043 20:43119513-43119535 CTGGGTCATGATGCATGTGAAGG - Intronic
1184769700 22:46589963-46589985 CTGGTTCCTGCGGCATGTATTGG + Intronic
1185034455 22:48464513-48464535 GTGGTTAAGGAGGCATCTGCCGG + Intergenic
950150354 3:10682032-10682054 CTGGGTCATGAGGGATGAGTAGG + Intronic
952568023 3:34681517-34681539 ATGGTTAATGTGGCATTTGTGGG + Intergenic
954145187 3:48630968-48630990 CTGGGTGATGCGGGATGTGTAGG - Intronic
954867408 3:53741642-53741664 CTTGTTGATGAGGCCTCTGTGGG + Intronic
959053766 3:101549566-101549588 GTAGTTAAATAGGCATGTGTGGG + Intergenic
959889895 3:111542792-111542814 AATTTTAATGAGGCATGTGTAGG + Intronic
961469944 3:127105309-127105331 CTGGGTGATGAGGCATTTTTGGG + Intergenic
963910224 3:150810680-150810702 CTGATTTTTGAAGCATGTGTAGG + Intergenic
964436882 3:156662921-156662943 TTGGTTAATGTGATATGTGTTGG + Intergenic
967153101 3:186667619-186667641 CTGTGTAATGATGCATGGGTAGG + Intronic
967785553 3:193490055-193490077 CTGGTTAATAAGGTAACTGTGGG - Intronic
969486708 4:7476331-7476353 CTGGTAACTGAGGCAGGAGTGGG + Intronic
969848829 4:9941101-9941123 ATGGTTAGTTAGGCATGTGAAGG - Intronic
974699721 4:65425400-65425422 CTTATTAATGAAGCATGTCTAGG + Intronic
975134658 4:70862974-70862996 CTGTATAATGATGCATATGTAGG + Intergenic
975495390 4:75030805-75030827 CTGGCTTATGAGGAAGGTGTGGG - Intronic
978552970 4:109947938-109947960 CTAGTTAATGATGAATGTGGGGG + Intronic
983503384 4:168526131-168526153 ATGGTTCTTGAGGCGTGTGTTGG - Intronic
984148240 4:176091207-176091229 CTTATAAATGATGCATGTGTTGG - Intronic
986977299 5:13409461-13409483 CAGGTAAATGAGGCAGGTGGAGG - Intergenic
986993001 5:13575642-13575664 CTGGACAATGAGTCCTGTGTGGG + Intergenic
990363336 5:55043749-55043771 GGGGCTATTGAGGCATGTGTTGG - Intergenic
1003211141 6:4067879-4067901 CTAGTTAATGAGTTATGTGTTGG + Intronic
1003728673 6:8794917-8794939 CTGGTTCATGAGGTATCTGCTGG + Intergenic
1005496386 6:26391769-26391791 CTGGTGCCTGAGGGATGTGTGGG - Intronic
1005727813 6:28666642-28666664 GTGGTTAATTAGATATGTGTGGG + Intergenic
1007098614 6:39229486-39229508 CTGGTTAAAGAGGCGTGCGGAGG - Intergenic
1008871600 6:56278778-56278800 GTGTTTAATGAGGTATGTGGAGG - Intronic
1011249099 6:85351702-85351724 CTGTTTAATGAGCTCTGTGTTGG + Intergenic
1011771974 6:90683430-90683452 CTCTTTAATGAGGCTTGGGTTGG + Intergenic
1011849575 6:91609660-91609682 CTCTTTACTGAGGCATCTGTAGG - Intergenic
1014344390 6:120249728-120249750 CTGGTTAGTGAGGGAGGTGCAGG + Intergenic
1018061287 6:160091907-160091929 CTGATGGCTGAGGCATGTGTAGG - Intronic
1019877471 7:3826998-3827020 ATGGTGAAGGAGGCATGAGTGGG - Intronic
1023359008 7:39396824-39396846 CTAGTTCATGAGGCAGGGGTGGG + Intronic
1025025152 7:55510634-55510656 CTTGTTATGGAGGCCTGTGTTGG + Intronic
1031002630 7:116434917-116434939 CTGGTTCTTGAGGCATGAATAGG + Intronic
1032561697 7:132899193-132899215 CTGATTATGGGGGCATGTGTGGG + Intronic
1032840585 7:135710765-135710787 CTGGTTGATGAGGGTTGTGTAGG + Intronic
1034877949 7:154741980-154742002 CTAGTAAATGAGGACTGTGTGGG - Intronic
1037607052 8:20447040-20447062 GTGGATAATGAAGAATGTGTAGG - Intergenic
1038549247 8:28451500-28451522 CTGAGTAAGGTGGCATGTGTCGG - Intronic
1040714666 8:50235634-50235656 CTGGTTTATGGGGAATGTGTTGG + Intronic
1042404396 8:68387107-68387129 CTGGCTCATGGTGCATGTGTGGG + Intronic
1042680480 8:71378059-71378081 GTGGTTATTGAAGCATGTATGGG - Intergenic
1045853010 8:106725515-106725537 CTGGTTAGTGAAGTATATGTAGG + Intronic
1053620714 9:39812003-39812025 CTGGTTATTCAGGAGTGTGTTGG + Intergenic
1053625995 9:39871931-39871953 CTGGTTATTCAGGAGTGTGTTGG - Intergenic
1053878879 9:42571286-42571308 CTGGTTATTGAGGAGTGTGTTGG + Intergenic
1054217893 9:62378770-62378792 CTGGTTATTCAGGAGTGTGTTGG + Intergenic
1054232812 9:62530409-62530431 CTGGTTATTGAGGAGTGTGTTGG - Intergenic
1054263449 9:62895437-62895459 CTGGTTATTCAGGAGTGTGTTGG - Intergenic
1055204131 9:73707169-73707191 GTGGTTAGTGGGCCATGTGTTGG - Intergenic
1058879045 9:109270889-109270911 CTGTTTAATGAGTCTTGGGTGGG - Intronic
1059386058 9:113965444-113965466 CTGGTGAATAAGGAATGGGTGGG + Intronic
1186753387 X:12644681-12644703 CTGCTTAAGGAGACTTGTGTTGG - Intronic
1187336978 X:18389825-18389847 CTCATTAATGAAGCATCTGTTGG - Intergenic
1188586568 X:31783466-31783488 CTGGTGGATGAGGCTTGTGAGGG - Intronic
1188695533 X:33185810-33185832 ATGTTTAATGAAGCATATGTTGG - Intronic
1188881083 X:35492857-35492879 CTGGTTAGACAGGCATGAGTGGG + Intergenic
1190625749 X:52336928-52336950 ATGGGAAATGAGGCCTGTGTTGG + Intergenic
1197702834 X:129612468-129612490 AAGGTTAAAGAGGCAGGTGTGGG - Intergenic
1198000515 X:132430720-132430742 CTGGTTAAAGTGGCATCTGCTGG + Intronic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic