ID: 1098577803

View in Genome Browser
Species Human (GRCh38)
Location 12:72063530-72063552
Sequence ACCAGGACATTGAGGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098577803 Original CRISPR ACCAGGACATTGAGGGCACA AGG Intronic
900992009 1:6102422-6102444 ACCAAGACGGTGAGGGCAGAGGG + Exonic
901499313 1:9641737-9641759 ACCTGGGGATGGAGGGCACAAGG + Intergenic
902367847 1:15989236-15989258 CCCCTGACCTTGAGGGCACAGGG - Intergenic
903156632 1:21448832-21448854 ACCAGAGAATTGAGGTCACAGGG - Intronic
903702758 1:25262836-25262858 ACCTGCACATTGAGGGCGGATGG + Intronic
903891702 1:26574205-26574227 ACCAGGGCATTCGGGCCACAGGG + Exonic
904981526 1:34506946-34506968 ACCAGGATAGTGAGAGCACAGGG + Intergenic
905866596 1:41380333-41380355 ACCAGGAAGTTGAGGCCACCAGG + Intronic
907108460 1:51905318-51905340 ACCAGGACACTGAGGAGGCAGGG + Intergenic
908062710 1:60369197-60369219 AGCTGAACATTGAGTGCACATGG - Intergenic
910132613 1:83926359-83926381 ACCAGGGCATCCAGGGTACATGG + Intronic
912455547 1:109794429-109794451 AACAGGACTTTGAGGGCTAACGG + Intergenic
912493862 1:110078740-110078762 GCCAGGACAATGCGGGCAGATGG + Intergenic
912657244 1:111497913-111497935 ACCAGGAGACTGAGGGCAGCAGG + Intronic
913992942 1:143631834-143631856 ACCAGAGAATTGAGGTCACAGGG + Intergenic
914978340 1:152388249-152388271 AAAAGGACATTGAAGGCAGATGG - Intergenic
914978469 1:152389879-152389901 AAAAGGACATTGAAGGCAGATGG - Intergenic
916180269 1:162077633-162077655 AACAGGACATGGAAGGCAGATGG - Intronic
917132655 1:171758412-171758434 ACCAGGGCATGGAGGGAAAATGG + Intergenic
919412120 1:197258607-197258629 ACCAGGACATTGTGGTGTCATGG - Intergenic
919973083 1:202593254-202593276 CCTAGGACATTAAGGGAACATGG + Exonic
920445426 1:206012586-206012608 GCCAGGCCATTGTGGACACAGGG - Exonic
921299230 1:213734806-213734828 ACCTGGGCATTGGCGGCACAAGG + Intergenic
923550893 1:234962201-234962223 ATCACGTCATTGAGGCCACAAGG - Intergenic
1063896151 10:10684490-10684512 CCCAGGACTTTGAGAGGACAAGG + Intergenic
1064551590 10:16506696-16506718 AACAGGAGACTGAGGACACATGG + Intronic
1064600851 10:16990906-16990928 ACAAGGACACTGAAGGCCCAGGG - Intronic
1065181607 10:23131783-23131805 AGCAGGACATTCAGTGCTCAGGG + Intergenic
1065797545 10:29321127-29321149 CCCAGGATGTTGAGGGGACAGGG - Intergenic
1065930569 10:30475337-30475359 CCCAGCACTTTGAGGGGACAAGG + Intergenic
1066684372 10:37966582-37966604 AGCAGGAGATAGAGGGCAAAGGG + Intronic
1067319948 10:45208745-45208767 ATCAGAAAATTGAGGTCACAGGG + Intergenic
1067451491 10:46384711-46384733 ACCAGAGCATTAAGGGCACAGGG - Intronic
1067559631 10:47295797-47295819 ACCAGGACAGAGAGGCCAGATGG + Intergenic
1067585748 10:47475045-47475067 ACCAGAGCATTAAGGGCACAGGG + Intronic
1069563142 10:69445400-69445422 ACAAGGCCAGTGAGGGGACAGGG - Intergenic
1070861500 10:79669284-79669306 ACCAGGTAATTGAGGGGATAAGG + Intergenic
1070875746 10:79806305-79806327 ACCAGGTAATTGAGGGGATAAGG - Intergenic
1071642674 10:87328444-87328466 ACCAGGTAATTGAGGGGATAAGG - Intergenic
1074983610 10:118639171-118639193 ACCAGGACTGTGAAAGCACATGG - Intergenic
1074996502 10:118761316-118761338 ACCAGCACTTTGAGAGGACAAGG - Intergenic
1075489210 10:122852205-122852227 ACCAGAAAATTGAAGTCACAGGG + Intronic
1075729384 10:124627279-124627301 CCCGGGGCATGGAGGGCACAGGG - Intronic
1076070116 10:127482510-127482532 ACGGGGACACTGAGGGCCCAGGG - Intergenic
1076338435 10:129726312-129726334 GCCAGGTCCTTGATGGCACAGGG + Intronic
1076698448 10:132258025-132258047 ACAGGGACAGTGAGGGCACTTGG - Intronic
1078079263 11:8192342-8192364 ACCAGGAGAGAGAGGGCACAGGG - Intergenic
1079402083 11:20113934-20113956 CCCGGGAGATTGAGGCCACAGGG + Intronic
1081679537 11:44992045-44992067 ACCAGGTCAAAGAGGGCTCAAGG + Intergenic
1083328558 11:61886108-61886130 ACCAGGACATTGAGGGGTGCTGG - Intronic
1084581172 11:70024379-70024401 ACCAGGACAAGAACGGCACAAGG + Intergenic
1089393067 11:118115171-118115193 TCCAGGTCATTGACAGCACACGG + Exonic
1091331740 11:134736206-134736228 ACGAGGACTTTGGGGGCACAAGG + Intergenic
1091397731 12:163923-163945 CCCAGGACAGGGAGTGCACAGGG + Intronic
1091715511 12:2773600-2773622 ATCAGGACAAGGAGGCCACAGGG - Intergenic
1091780178 12:3208595-3208617 ACCAGGACACAGAGCACACAGGG + Intronic
1092640490 12:10503132-10503154 AGCTGGACATTGAGTACACATGG - Intergenic
1094675537 12:32616401-32616423 CCCAGGAGAATGAGGTCACATGG + Intronic
1095843479 12:46720409-46720431 ATCAGGAAATTGGGGGAACAAGG + Intergenic
1097311565 12:58124535-58124557 AGCTGAACAATGAGGGCACATGG - Intergenic
1098577803 12:72063530-72063552 ACCAGGACATTGAGGGCACAAGG + Intronic
1100317217 12:93455317-93455339 AGCTGGACATTGAGAACACATGG - Intergenic
1101216567 12:102591546-102591568 ACCTGGACAATGAGGGTAAATGG + Intergenic
1104133265 12:125915024-125915046 ACCTGGCCAAAGAGGGCACATGG + Intergenic
1104714328 12:131006441-131006463 GCCAGGAAACTGAGGGCTCAGGG + Intronic
1106592825 13:31111669-31111691 ACCAGCACCTTGTGGGCTCAGGG + Intergenic
1106911116 13:34464625-34464647 AGCAGGACTTTGAGGACAAAAGG + Intergenic
1107565910 13:41604173-41604195 CCCTGGACATTGAGAGCACCAGG - Intronic
1108185694 13:47886513-47886535 ACCAAGACATTCAGGTCACAAGG + Intergenic
1111883368 13:93987233-93987255 ACCAGAACATTGTTGGAACATGG + Intronic
1113616525 13:111684507-111684529 ACCATGACAGTGATGGCACCGGG + Intergenic
1113622055 13:111769778-111769800 ACCATGACAGTGATGGCACCGGG + Intergenic
1113728512 13:112623519-112623541 ACCAGCACAGTGAGCACACATGG + Intergenic
1114644492 14:24247116-24247138 ATCAGAGAATTGAGGGCACAGGG - Intergenic
1115480224 14:33853151-33853173 ACCAGGAGATGGAGATCACAGGG + Intergenic
1118593088 14:67415917-67415939 AGCTGGACATTGAGATCACATGG + Intergenic
1119193203 14:72698426-72698448 ACCAGCACTTTGAGGGGCCAAGG + Intronic
1119231252 14:72981618-72981640 ACCAGGATCTTGTGGGAACATGG + Intronic
1119665323 14:76481217-76481239 ACCAGCAGATCGAAGGCACAGGG - Intronic
1123667405 15:22618522-22618544 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1123858588 15:24438333-24438355 ACCAGGCAATCGAGGTCACAGGG - Intergenic
1124321248 15:28713087-28713109 TCCAGGACTTTGAGAGCCCAAGG + Intronic
1124441586 15:29689561-29689583 ACCAGGCCCTTCAGGGCTCATGG + Intergenic
1124481248 15:30082265-30082287 TCCAGGACTTTGAGAGCCCAAGG - Intergenic
1124487703 15:30134361-30134383 TCCAGGACTTTGAGAGCCCAAGG - Intergenic
1124522349 15:30414927-30414949 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1124755826 15:32403960-32403982 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1124762336 15:32456301-32456323 TCCAGGACTTTGAGAGCCCAAGG + Intergenic
1124776295 15:32592769-32592791 TCCAGGACTTTGAGAGCCCAAGG - Intergenic
1124819951 15:33034809-33034831 AACTGGAGATTGAGGGCACAGGG - Intronic
1125597364 15:40895390-40895412 TCCAGGAGAATGAGGGCATAGGG + Intronic
1125850123 15:42895332-42895354 AACAGTCCATTGAGGGTACAGGG + Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126686478 15:51252691-51252713 TCCAGTGCATGGAGGGCACACGG + Intronic
1127192446 15:56545169-56545191 ATCAGGTAATTGAGGCCACAGGG - Intergenic
1127310674 15:57749292-57749314 ACCAGGACATTGAGAACCCTAGG + Intronic
1128400150 15:67270652-67270674 GCCAGGACATAGAGATCACATGG - Intronic
1128460023 15:67859914-67859936 AAAAGGGCATTGAGGGCAGAAGG + Intergenic
1129042740 15:72704122-72704144 ACCAAGACAGTGGGGGCAGAAGG - Intronic
1129228269 15:74182312-74182334 AACAAGACATGGAGGGCTCAGGG - Intronic
1131393655 15:92069618-92069640 ACCAGGACCTTGGGGGCAGAGGG + Intronic
1131888409 15:96945493-96945515 ACCAGGATCTTGAGTTCACAAGG - Intergenic
1132860859 16:2071121-2071143 AACAGGACTCTGAGGCCACAGGG - Intronic
1133625948 16:7571022-7571044 AGCAGGACAGTGAGAACACATGG + Intronic
1133735454 16:8611534-8611556 TACAGGACATTGAGGGCTCATGG - Intergenic
1133934592 16:10258334-10258356 ACCAGGCCTCTGAGGACACAAGG + Intergenic
1135808485 16:25566030-25566052 CCCAGGACATTTACTGCACATGG - Intergenic
1137247120 16:46714775-46714797 ACCATGAGAATGAGGGCACACGG + Intronic
1138599526 16:58046443-58046465 CCCAGGACCCTGGGGGCACAGGG - Exonic
1141474884 16:84266176-84266198 CACAGAACATGGAGGGCACATGG + Intergenic
1143103977 17:4519370-4519392 ACCAGGACACCGAGGGCCCGTGG + Intronic
1144573318 17:16414407-16414429 ATCTGGACTTTGAGGGCTCATGG + Intergenic
1144643475 17:16952591-16952613 ACCAGGAGAGTGAGGGCAGCTGG + Intronic
1146628974 17:34456482-34456504 ACCAGGACAGTTAGTGCAAAAGG - Intergenic
1151163320 17:72184009-72184031 TCCAGGACATTTAGGGCACCAGG - Intergenic
1151512650 17:74570748-74570770 AACAGGACAATGACAGCACAGGG - Intergenic
1151940999 17:77291948-77291970 ACCAGCAGACTGAGGGCAAACGG - Intronic
1154494438 18:14945280-14945302 ACCCTGACATTGAGGGGAGATGG - Intergenic
1157159321 18:45298815-45298837 ACCAGGTCTTTGGGGGCACAAGG - Intronic
1157623008 18:49026912-49026934 ACCGGGACACTGTGGGCCCAGGG + Intergenic
1159184799 18:64955659-64955681 ACAAGGAGTTTGAGTGCACAGGG - Intergenic
1159888757 18:73935408-73935430 ACCAGGACAATGAGGGTAAGGGG + Intergenic
1160007145 18:75075799-75075821 ACCTGGACATTGTGGGGACCAGG - Intergenic
1160152948 18:76408574-76408596 ACTAGGAAACTGAGGGCACATGG + Intronic
1160308899 18:77769802-77769824 ACCAGGACATTGACATCACAGGG - Intergenic
1162552624 19:11366016-11366038 GCCAGGGCACAGAGGGCACAAGG + Intergenic
1163337340 19:16681891-16681913 ACCAGTACATTTAGGGTAAATGG + Intronic
1163587442 19:18171806-18171828 ACAAGGACAGTGAGGCCCCAGGG - Intronic
1163933286 19:20419681-20419703 CCCAGCACTTTGAGGGGACAAGG + Intergenic
1165258221 19:34592723-34592745 ACATTGACATTGAGGTCACAGGG - Intergenic
1165561640 19:36685458-36685480 TCCAGGACCTTATGGGCACATGG - Intergenic
1167417839 19:49386545-49386567 ATCAGGGGCTTGAGGGCACATGG + Intergenic
1167909886 19:52693090-52693112 ACCAGGACTTTGGGAGGACAAGG + Intergenic
925014875 2:515159-515181 AGCAGAAAATTGAGGTCACAGGG - Intergenic
925622153 2:5804473-5804495 ATTAAGACATTGAGGGCACGAGG - Intergenic
927720519 2:25379110-25379132 AACAGGGCAAGGAGGGCACATGG + Intronic
928744226 2:34392504-34392526 ACAAGGATAATTAGGGCACAAGG + Intergenic
928997934 2:37315590-37315612 AACAGGAGGTAGAGGGCACAAGG - Intronic
931435378 2:62241218-62241240 AGCAGAACATCGAAGGCACAGGG - Intergenic
931533253 2:63241672-63241694 CCCAGGAGTTTGAGGTCACAGGG - Intronic
932450928 2:71810388-71810410 ACCAGGACCCTGTGGGCACATGG - Intergenic
932771855 2:74504918-74504940 GGCAAGACATTGAGGGCCCATGG + Intergenic
933061725 2:77745938-77745960 CCCAGCACTTTGAGAGCACAAGG - Intergenic
933554395 2:83813805-83813827 AGAGGGACATTGAGAGCACAAGG + Intergenic
935371259 2:102349412-102349434 ACCAGGACAATGATGGGAGAGGG - Intronic
937056341 2:118940534-118940556 ACCAGATAATTGAGGACACAGGG - Intergenic
937642114 2:124225205-124225227 CTCAGAACATTGAGGGCTCATGG - Intronic
943000962 2:182328398-182328420 ACGAGGGCATTGAGAGTACATGG + Intronic
944393743 2:199246481-199246503 ACCAGAAAATTGAGGTCACAGGG - Intergenic
945205445 2:207326830-207326852 ATCCGGACATTTGGGGCACATGG + Intergenic
946965361 2:225031434-225031456 AGGAGGACAATGTGGGCACAGGG + Intronic
947133620 2:226955080-226955102 CACAGGACCTTGAGGGCTCAGGG + Intronic
947361739 2:229352329-229352351 ACCAGCATAGTGATGGCACATGG - Intergenic
948826877 2:240577260-240577282 ACCAGGACGCTGAAGGCCCAGGG - Intronic
1169260745 20:4136281-4136303 AGCAGGACCTGGAGGGCGCAGGG + Intronic
1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG + Intronic
1173078833 20:39846679-39846701 ACCAGGGCATTGGGAGCAGAGGG - Intergenic
1173702679 20:45086734-45086756 ACCAGGACATAGATGGCAGAGGG - Intergenic
1175722398 20:61295031-61295053 ACCAGGATATTGAGGGTGCAAGG - Intronic
1175927565 20:62478366-62478388 ACCCGGGCTTTGAGGGCAGAGGG - Intergenic
1176048469 20:63104549-63104571 CCCAGGACATTGGGGGCCAATGG + Intergenic
1178055669 21:28796002-28796024 AACAGGAGGTAGAGGGCACAAGG - Intergenic
1179365206 21:40752609-40752631 CCCAGGAGTTTGAGGTCACAGGG + Intronic
1181517166 22:23421460-23421482 ACAAGCACATTGAGAGCACCAGG + Intergenic
1181830579 22:25557276-25557298 ACAAGGACATTCAGAGGACAGGG + Intergenic
1181897240 22:26121333-26121355 AAAAGGACATTGAGGCCAGAGGG - Intergenic
1181987205 22:26808395-26808417 ACCAGGACAGTTCGGGCAAAGGG - Intergenic
1183196266 22:36355754-36355776 AGCAGGGCATTGAAGCCACACGG - Intronic
1183837997 22:40472785-40472807 CCCAGGACCTGGAGGACACAGGG + Intronic
1184894971 22:47401433-47401455 ACCATGACCTCGAGGGCCCATGG + Intergenic
1184973039 22:48041083-48041105 CCCAGCACATTGAGGGGCCAAGG - Intergenic
950781960 3:15399763-15399785 ACCATGACATTCAGGGACCAGGG + Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
951844183 3:27067893-27067915 ACCTGGACCTAGAGGCCACAGGG - Intergenic
952274066 3:31860138-31860160 ACAAGGCCTTTTAGGGCACAGGG - Intronic
954281099 3:49578616-49578638 ATCAGGAGATTGAGACCACATGG - Intronic
956981266 3:74641380-74641402 CCCAGGAATTTGAGGGTACAGGG - Intergenic
957665428 3:83218933-83218955 CCCAGGACCCTGAGAGCACAGGG + Intergenic
958751954 3:98202239-98202261 GCCAGGACTTTGAGGGGACCTGG - Intergenic
959111058 3:102123493-102123515 ACCTGGAGATTGAGGCCACTGGG + Intronic
961168845 3:124781458-124781480 ACCAGCACATGGAGGGGAGAGGG - Intronic
961347406 3:126273095-126273117 ACCAGCACATTGAGAGGCCAAGG - Intergenic
962239888 3:133743459-133743481 ACCAGGACATGCAGGGGCCAAGG - Intergenic
962298483 3:134215316-134215338 AGCTGGCCAATGAGGGCACAGGG + Intronic
964448307 3:156784247-156784269 AACAGGAAATTGATGCCACAGGG - Intergenic
966188566 3:177249756-177249778 CCCAGGAGCTTGAGGCCACATGG + Intergenic
966313951 3:178625018-178625040 AGCAGGGCAAGGAGGGCACAGGG + Intronic
967974498 3:195025465-195025487 AAAAGGACATTGAGGTCAAATGG - Intergenic
968554889 4:1241847-1241869 ACCAGGGGACGGAGGGCACAGGG + Intronic
980241669 4:130185277-130185299 ACCACCACAGTGTGGGCACATGG - Intergenic
980804481 4:137794148-137794170 ACCAGCACTTTGAGGGGCCAAGG + Intergenic
981266038 4:142784441-142784463 ACCAGAAAACTGAGGTCACAGGG + Intronic
986568783 5:9143948-9143970 ACCAGGACAAAGGAGGCACAGGG + Intronic
987682897 5:21160757-21160779 ACCAGGACAGAGAGGGGTCATGG + Intergenic
987697683 5:21354093-21354115 ACCAGGAGAGAGAGAGCACAAGG + Intergenic
988204153 5:28113312-28113334 ATCAGGACTTTGATAGCACAAGG - Intergenic
988754553 5:34232601-34232623 ACCAGGAGAGAGAGAGCACAAGG - Intergenic
988817197 5:34846106-34846128 CCCAGGAAATTGAGGCCACAGGG + Intronic
989054631 5:37355255-37355277 ACCAGGACTTTGAGAGGCCAAGG + Intronic
990443080 5:55866131-55866153 CCCCTGACTTTGAGGGCACAGGG + Intronic
990556020 5:56936584-56936606 CTCAGGACTTTGAGGTCACAGGG - Intronic
990852975 5:60227975-60227997 AGCATGACATTGAGGGGAGAAGG - Intronic
991742761 5:69698295-69698317 ACCAGGAGAGAGAGAGCACAAGG - Intergenic
991754935 5:69856909-69856931 ACCAGGAGAGAGAGAGCACAAGG + Intergenic
991794334 5:70278033-70278055 ACCAGGAGAGAGAGAGCACAAGG - Intergenic
991822149 5:70573608-70573630 ACCAGGAGAGAGAGAGCACAAGG - Intergenic
991834262 5:70732057-70732079 ACCAGGAGAGAGAGAGCACAAGG + Intergenic
991886714 5:71277575-71277597 ACCAGGAGAGAGAGAGCACAAGG - Intergenic
996353685 5:122573829-122573851 CCCAGGACTTTGAGGGCAGCTGG + Intergenic
997639359 5:135438529-135438551 ACCAGGACACTCAGTGCACAGGG - Intergenic
998162931 5:139823506-139823528 ACCAGGAAATCCAGGGCATATGG + Intronic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
999605724 5:153313523-153313545 ACCAGAAAATTAAGGGCAAATGG + Intergenic
1000285047 5:159819716-159819738 ACCGGGACATAGGGGGAACATGG - Intergenic
1002296595 5:178234761-178234783 ACCTGGGCATTCAGGGGACAGGG - Intergenic
1002774635 6:318376-318398 AAGAGGACATTCAGGGCACAGGG + Intronic
1004796966 6:19097246-19097268 CCCAGGAGATTGAGGCTACAAGG - Intergenic
1005553168 6:26944314-26944336 ACCAGGAGAGAGAGAGCACAAGG - Intergenic
1006698311 6:35950934-35950956 GCCATGACAGTGAGGGCACTTGG + Intronic
1006963076 6:37953700-37953722 CCCAGGACATTGTGGGGTCAAGG - Intronic
1007031458 6:38631492-38631514 AACAGGACATAAAAGGCACATGG + Intronic
1010629086 6:78175551-78175573 AACAGTGCATTGAGGACACATGG - Intergenic
1011659488 6:89581919-89581941 AACAGGGCATTGAGGGTATACGG + Intronic
1012742770 6:103040940-103040962 ACCAGGAAATTATAGGCACACGG + Intergenic
1013523908 6:110957326-110957348 CCCAGGAGTTTGAGGGTACAGGG + Intergenic
1014971185 6:127817648-127817670 ACCAGAGAATTGAGGTCACAGGG + Intronic
1016320251 6:142835299-142835321 GCCTGGACATTGAGTGCAGATGG - Intronic
1016492622 6:144624079-144624101 AAAATGACATTGAGGGCAGAGGG + Intronic
1018391865 6:163347001-163347023 CCCTGGACAAGGAGGGCACATGG - Intergenic
1018645597 6:165945002-165945024 ACCAGGAGATGGGGGTCACAGGG - Intronic
1020228919 7:6301921-6301943 CCCAGGAGATTGAGGGCGCAGGG + Intergenic
1021205391 7:17773785-17773807 TCTAGGACATTGAGAGCACAAGG - Intergenic
1023554123 7:41402293-41402315 ACAATGGCATTGAGGGCAGATGG - Intergenic
1024570364 7:50718083-50718105 GCCAGGACAAAGAGGGGACAGGG + Intronic
1025574560 7:62619731-62619753 ACCAAGACATTCAGTTCACAGGG - Intergenic
1027859378 7:83556507-83556529 ACCTAGACATTGAGGGGCCAGGG + Intronic
1027992178 7:85376698-85376720 GCGAGGAGATTGAGGGCACAGGG - Intergenic
1029464931 7:100719586-100719608 ATGAGGACATTGAGGGCTCAAGG + Intergenic
1031508659 7:122620980-122621002 CCCAGGAGGTTGAGGGTACATGG - Intronic
1032467082 7:132152957-132152979 CCCAGCACACTGGGGGCACATGG - Intronic
1032525916 7:132577891-132577913 CCGAGGACACTGAGGGCACAAGG + Intronic
1033335605 7:140449635-140449657 ACGATGACAAGGAGGGCACACGG + Intergenic
1033482885 7:141759631-141759653 AGCAGGAGAGAGAGGGCACAGGG + Intronic
1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG + Intergenic
1036917208 8:12815429-12815451 ACCCCGACATTGGGGTCACATGG + Intergenic
1037820924 8:22134165-22134187 ACCAGGACACGGAGGGCCCCAGG + Intergenic
1038488528 8:27953171-27953193 GCCAGGACATTGAAGAAACAAGG + Intronic
1038646910 8:29369630-29369652 ACCAAGACAGTGAGTGCAGATGG + Intergenic
1040277000 8:46018915-46018937 AAGAGGACATTGAGGCAACATGG - Intergenic
1041430249 8:57773422-57773444 AGCTAAACATTGAGGGCACATGG + Intergenic
1043760486 8:84062471-84062493 CCCAGGACCTTGAGAGTACATGG - Intergenic
1045170501 8:99662520-99662542 CCCAGGAGATTGAGGCTACAGGG - Intronic
1045595934 8:103656687-103656709 ATCAGAAAATTGAGGTCACAGGG + Intronic
1045845283 8:106627847-106627869 AAGTGGAGATTGAGGGCACAGGG + Intronic
1047400296 8:124540736-124540758 AACAGCACAATGAGGGCAAATGG - Intronic
1047921346 8:129637848-129637870 ACCAGGAGATTGTGGGCCTAGGG + Intergenic
1054268784 9:62947098-62947120 TCCAGGACTTTGAGAGAACAAGG + Intergenic
1057092441 9:92271036-92271058 ATCAGGACTTTGAAGGAACAAGG - Exonic
1057628733 9:96701561-96701583 ATCAGAAAATTGAGGTCACAGGG + Intergenic
1057755728 9:97833575-97833597 ACCATGAAACTGAGGTCACAGGG + Intergenic
1058921303 9:109617726-109617748 ACCAGGACATGGAGATCACTGGG + Intergenic
1059885453 9:118740251-118740273 CCCAGCACATTGAGGGGTCAAGG - Intergenic
1060938826 9:127531678-127531700 GCCATGAGATTGAGGGCACGGGG - Exonic
1062365823 9:136208577-136208599 ACCAGGACTTTGAAGCCAAAAGG + Exonic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1186643535 X:11482525-11482547 ACCAGGACAGTATGAGCACAAGG - Intronic
1186822588 X:13305708-13305730 ACCAGAGAATTGAGGTCACAGGG - Intergenic
1187560463 X:20398102-20398124 ACAAGGACAGTGAAGGAACAGGG - Intergenic
1188497161 X:30792961-30792983 ACAAGGAAAGGGAGGGCACAAGG - Intergenic
1189847821 X:45152411-45152433 ACCAGGAGATTTAGGACTCAGGG + Intronic
1190294332 X:49015989-49016011 AAAAAGAAATTGAGGGCACATGG + Intergenic
1190641298 X:52483908-52483930 ACCTGGACATCCAGGGCTCATGG + Intergenic
1190646374 X:52528957-52528979 ACCTGGACATCCAGGGCTCATGG - Intergenic
1190898798 X:54648683-54648705 ATCAAGGCATTGAGGTCACAGGG - Intergenic
1191672576 X:63762158-63762180 ACCTGGACATGGAGGTCAGAGGG - Intronic
1192062481 X:67842584-67842606 ACCAGGATGTTAGGGGCACAGGG + Intergenic
1193638086 X:83977738-83977760 ACCTGGACTGTGATGGCACAGGG - Intergenic
1198473727 X:136975114-136975136 ACCAGCACTTTGAGAGGACAAGG - Intergenic
1198835555 X:140801111-140801133 AACATGACATTGAAGGCAAAGGG + Intergenic
1199062447 X:143375486-143375508 AGCAGGAGAGAGAGGGCACAGGG + Intergenic
1199746072 X:150772557-150772579 GCCAGGACCTTGAGGGCAGCAGG + Intronic
1200948318 Y:8867637-8867659 ACCAGGTGCTTGAGGGAACAGGG - Intergenic