ID: 1098579236

View in Genome Browser
Species Human (GRCh38)
Location 12:72079343-72079365
Sequence AAGTAGACCTTCAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098579236 Original CRISPR AAGTAGACCTTCAGTGAGGA GGG (reversed) Intronic
900200186 1:1401183-1401205 ATGAAGGCCTGCAGTGAGGATGG + Intronic
901436117 1:9248344-9248366 AAATACACATTCAGAGAGGAAGG - Intronic
904965401 1:34368893-34368915 AGGTAGACCTGCAGGTAGGAAGG + Intergenic
905381594 1:37565497-37565519 AAGAAGACATTAAGTAAGGAAGG - Exonic
905853746 1:41293630-41293652 AAGCAGAACTACAGTGAAGAGGG - Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
908971070 1:69832359-69832381 AAGAAAACCTTCAGACAGGAAGG + Intronic
909403070 1:75256280-75256302 AGGTAGACCTTCAGGGAAAAGGG + Intronic
910505141 1:87942030-87942052 ACGTAAACCATCAGTGAGTAGGG - Intergenic
912131577 1:106608617-106608639 AAATAGACATTGAGTGAGCAAGG + Intergenic
913183428 1:116344696-116344718 GAGGAGGCCCTCAGTGAGGAGGG - Intergenic
914505700 1:148287316-148287338 AAGAAGACCTTCAGTGGAAATGG + Intergenic
915970184 1:160349360-160349382 AAGTAGAGCTTTAGTGAGTAAGG - Intronic
916599961 1:166283108-166283130 AAGTAGACCCCCTGTAAGGAGGG - Intergenic
916767284 1:167873607-167873629 GAGTAGACCTAAAATGAGGAAGG - Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1067254749 10:44626019-44626041 CAGTAGAACTTCTGTGATGAAGG - Intergenic
1067409450 10:46051774-46051796 AAGTGGACCCTCAGGGAGGCTGG - Intergenic
1069239813 10:66125112-66125134 AAGAAGTTCTTCAGTGAGAAGGG + Intronic
1071114840 10:82206022-82206044 AAGTAGAGCATCATTGAGTAAGG - Intronic
1073842450 10:107513534-107513556 AGGCAGACCTACAGTTAGGAAGG + Intergenic
1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG + Intergenic
1074770742 10:116731988-116732010 AAGTGGTCCTGCAGAGAGGAGGG + Intronic
1074867094 10:117551086-117551108 AAGTAAACCTTCTGTTAAGACGG - Intergenic
1077245079 11:1532928-1532950 AAGGAGACCTTCAAAGAGAAGGG + Intergenic
1077564942 11:3291716-3291738 AAGGAGACTAACAGTGAGGATGG - Intergenic
1077570828 11:3337533-3337555 AAGGAGACTAACAGTGAGGATGG - Intergenic
1080306470 11:30842007-30842029 AAGTAGCACTTAAGTCAGGAGGG - Intronic
1081335140 11:41856235-41856257 AAGTTGACCTACAGTGTGGGAGG + Intergenic
1081962800 11:47150738-47150760 AAGGACAGCTTCAGGGAGGATGG + Intronic
1084284630 11:68122973-68122995 AAGTTGACCTGCAGGGAGGTAGG + Intergenic
1085276815 11:75305887-75305909 CAGTAGCCCTTCAGTCAGCAGGG + Intronic
1091407139 12:216097-216119 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407152 12:216192-216214 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407165 12:216287-216309 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407182 12:216382-216404 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407195 12:216477-216499 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407211 12:216572-216594 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091781954 12:3219467-3219489 AGGCGGACCTTCTGTGAGGATGG + Intronic
1092969223 12:13675806-13675828 AATTTGTCCTTCAGTGAAGATGG - Exonic
1098579236 12:72079343-72079365 AAGTAGACCTTCAGTGAGGAGGG - Intronic
1100697277 12:97108976-97108998 AAGTAGTAGTGCAGTGAGGATGG - Intergenic
1101061434 12:100976593-100976615 CAGTAGATCTGCAGTGGGGATGG + Intronic
1101502270 12:105315292-105315314 AAGTAGAACTTGTTTGAGGAAGG - Intronic
1103507542 12:121452161-121452183 GAGTAGAGCTTCAGTGGGTATGG + Intronic
1104519400 12:129459091-129459113 ACAGAGACCTTCAGGGAGGAGGG - Intronic
1104616950 12:130278558-130278580 AAGAAGACCTGCTGTGGGGATGG + Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1104958138 12:132475746-132475768 CAGGAGACCTGCAGTGAGGCTGG - Intergenic
1105603102 13:21904478-21904500 TTGTAAACCTTCAGTGATGATGG - Intergenic
1106534781 13:30630163-30630185 AAGCAGACCTTTAGTGTAGAGGG + Intronic
1107559104 13:41544579-41544601 AAGCAAAACTTGAGTGAGGATGG + Intergenic
1108169169 13:47723642-47723664 AAGTTGACCCACAGTGAGCAGGG + Intergenic
1112599679 13:100842565-100842587 AATGAGCCCCTCAGTGAGGATGG + Intergenic
1112627276 13:101120089-101120111 AAGAAGTCTTTCAGAGAGGAAGG - Intronic
1115118675 14:29913497-29913519 AAGTAAACATAGAGTGAGGATGG - Intronic
1115740623 14:36383970-36383992 AAGTAGAACCTCAGTGATGATGG - Intergenic
1116525988 14:45905907-45905929 TATTAATCCTTCAGTGAGGAGGG + Intergenic
1117149234 14:52868368-52868390 AACTTAATCTTCAGTGAGGATGG - Intronic
1120258183 14:82146730-82146752 AAGTAGACCTGCAGAGACCAAGG - Intergenic
1121917465 14:97848866-97848888 AAGGAGACCTGCAGGGAGGAGGG - Intergenic
1126705547 15:51401995-51402017 AAGTAGACCTGGAGTGGTGACGG + Intronic
1132006189 15:98229542-98229564 GAGTAGAAATTCAGTGAGCATGG + Intergenic
1134115443 16:11544388-11544410 AAGAAAACCTTCAGTGAAAATGG + Intergenic
1135765497 16:25174319-25174341 TAGTAGACCAGTAGTGAGGAGGG - Intronic
1141478643 16:84291667-84291689 AAGTAGACACTCAGTAAAGACGG - Intergenic
1142636056 17:1258552-1258574 AAGTGTACCTTCTGTGAGGGTGG + Intergenic
1143974360 17:10819289-10819311 AAGGAGATCATCAGTTAGGATGG - Intergenic
1147151004 17:38513772-38513794 TAGTAGACTTTGAGTGAGAATGG + Intergenic
1149186626 17:54005377-54005399 AAGTATAACTTCAATTAGGAAGG - Intergenic
1151294214 17:73172100-73172122 ATGTATACAGTCAGTGAGGAAGG - Intergenic
1151639581 17:75380973-75380995 AAGATGACCTTAAGTGAGAATGG - Intronic
1152054337 17:78011288-78011310 AAGGACACCTTCAGGGATGATGG - Intronic
1155079608 18:22395539-22395561 AGCTAGGCCTTCAGTAAGGATGG - Intergenic
1156200756 18:34829006-34829028 AAAATGACCTTCAGTAAGGATGG - Intronic
1157332589 18:46714501-46714523 GAGTTGACCTGCAGTGAAGAAGG + Intronic
1158091181 18:53715551-53715573 AATTAAATCTTCAGTGGGGACGG + Intergenic
1166002603 19:39886620-39886642 AAGTATACTTTGAGTGAGGGTGG + Intronic
1166005388 19:39902872-39902894 AAGTATACTTTGAGTGAGGGTGG + Intronic
1166710349 19:44933048-44933070 AAGCAGACCTGCAGTGAACATGG - Intergenic
925751193 2:7091490-7091512 AGGTGGACCTTCCGTGAGCAGGG + Intergenic
925883546 2:8372987-8373009 AAGCAGACTCTCAGTGAGGCAGG + Intergenic
925983866 2:9199147-9199169 AAGTAGACCTTGTGAGAAGAAGG - Intergenic
929355691 2:41021671-41021693 ATGGAGGCATTCAGTGAGGAGGG - Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
935022498 2:99245202-99245224 AGGTTGAGCTTCTGTGAGGAGGG + Intronic
937314496 2:120922416-120922438 CAGCAGGCCTTCAGTGAGTAGGG - Intronic
938241942 2:129748813-129748835 AAATGCACGTTCAGTGAGGATGG - Intergenic
938654440 2:133416588-133416610 AACTAGACTTTCAGAGATGAGGG + Intronic
939554796 2:143661302-143661324 TAATAGACCTTCAATGATGATGG - Intronic
941938865 2:171011506-171011528 GAGTAGAACTTCAGTGTAGAAGG - Intronic
942412357 2:175723611-175723633 AAGTAGACCGAAAGTCAGGAAGG + Intergenic
942795254 2:179810870-179810892 AATCATATCTTCAGTGAGGAGGG - Intronic
944763684 2:202842392-202842414 AAGTAGACCTCCAGAAATGATGG - Intronic
946484080 2:220084344-220084366 TACGAAACCTTCAGTGAGGAAGG - Intergenic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
948529303 2:238593910-238593932 GATGAGACGTTCAGTGAGGAGGG + Intergenic
1169033525 20:2431687-2431709 AAGCAGCCCTTAAGTGAGGGTGG + Intronic
1170638873 20:18134153-18134175 AATTACACACTCAGTGAGGAAGG + Intergenic
1172584921 20:36076598-36076620 AAGAAGAAATTCAGTCAGGATGG - Intergenic
1173337762 20:42126660-42126682 AAATAGACCTTCACAGAGCAGGG - Intronic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1175569228 20:60006466-60006488 AAACAAACTTTCAGTGAGGAAGG - Intronic
1175786708 20:61716475-61716497 ACTCAGACCTCCAGTGAGGATGG - Intronic
1176016318 20:62935235-62935257 AAAGAGACCTTCAGTCAGGATGG - Intronic
1177410663 21:20726434-20726456 AAATACATCTTCAGGGAGGAAGG + Intergenic
1181703140 22:24632133-24632155 AAGTAGACCTGCAGCCAGGGTGG + Intergenic
1184429460 22:44432985-44433007 AGGTAGACCTGAATTGAGGAAGG - Intergenic
949108758 3:232771-232793 AAAGAGACCTTCAGAGAGGTTGG + Intronic
949707083 3:6830822-6830844 AAGTAGACCTGCATTGGGAAGGG - Intronic
951672034 3:25195162-25195184 AACAAGACCTACAGAGAGGATGG - Intronic
956409810 3:68967835-68967857 AGGTAGACCCTCAGTGAGAAGGG - Intergenic
957858718 3:85915201-85915223 AAGTAAAACTTCATGGAGGAAGG + Intronic
960254092 3:115492057-115492079 AAACTGACCATCAGTGAGGAGGG - Intergenic
960644995 3:119870174-119870196 AGGCAGACTTCCAGTGAGGATGG - Intronic
962665552 3:137650531-137650553 AAGTAGGCAGTCACTGAGGAAGG - Intergenic
966051702 3:175624670-175624692 AAGTACACATTCAGTGATTAAGG + Intronic
968711453 4:2122362-2122384 AAGGACACCTTCTGGGAGGAGGG + Intronic
969305958 4:6326454-6326476 AAGGAGAACTTCATGGAGGAGGG + Intronic
971108673 4:23557164-23557186 ATGCAGACTCTCAGTGAGGAAGG + Intergenic
971508895 4:27399476-27399498 AGGTAAGCCTTCAGTGAAGAAGG + Intergenic
974478629 4:62416940-62416962 AAGTACAAATTCAGTGAGGTAGG + Intergenic
974613254 4:64244730-64244752 AACTATATTTTCAGTGAGGAGGG - Intergenic
974667901 4:64989105-64989127 ATGTAGAACTTCAGTAAGGTAGG - Intergenic
975264972 4:72352839-72352861 AAATAGAACTTCAAAGAGGATGG + Intronic
975373287 4:73612993-73613015 ATCTGGACCTGCAGTGAGGAGGG - Intronic
978605569 4:110475893-110475915 AAGAAGCCCTTTAGTTAGGAGGG + Intronic
979662245 4:123270395-123270417 ATGTATACCTTCTGTGGGGAAGG + Intronic
979783488 4:124685936-124685958 AAGTAGATATACATTGAGGAAGG + Intronic
981430993 4:144659899-144659921 AGAAATACCTTCAGTGAGGAAGG - Intronic
985707099 5:1407687-1407709 ACATAGACCTTCACAGAGGAAGG - Intronic
986168029 5:5292720-5292742 AAGGAGGCCTTCAGTGTGGCAGG - Intronic
987382921 5:17302569-17302591 ATGTAGAACTTCTGTGTGGAGGG + Intergenic
988738325 5:34044824-34044846 AAGGAATCCTCCAGTGAGGAAGG - Intronic
989807986 5:45635531-45635553 AAGTAGACGTTGAGTAAGGAAGG - Intronic
990326283 5:54678703-54678725 AGGAAGACCTTCAGGGAGGGAGG + Intergenic
990647336 5:57859160-57859182 AACAAGCCCTTCACTGAGGAAGG + Intergenic
993360162 5:86965034-86965056 AAAGAGACCTCCAGTGAGAATGG + Intergenic
994879929 5:105477132-105477154 AAGTTGTCCTTCAGCGATGAAGG + Intergenic
995516181 5:112956154-112956176 AATCAGAACTTCAGTAAGGAGGG + Intergenic
1000252181 5:159506213-159506235 TAGTAGACCTGCAATAAGGAGGG - Intergenic
1002209540 5:177589005-177589027 ATGTAGAGGTTCAGTCAGGATGG - Intergenic
1005528079 6:26672042-26672064 AAATAGACCCTGGGTGAGGAAGG + Intergenic
1005542716 6:26829597-26829619 AAATAGACCCTGGGTGAGGAAGG - Intergenic
1009281681 6:61760304-61760326 AATTAGAGCTTTAGAGAGGATGG + Intronic
1010468732 6:76200023-76200045 AAGTAAACTTTCTGTCAGGATGG + Intergenic
1011506002 6:88044944-88044966 AAGAAGACCTTCAGTGAGGTAGG + Intergenic
1011936016 6:92778526-92778548 ATATAGACCCTCAATGAGGAAGG + Intergenic
1012703256 6:102490393-102490415 AAGTTAATCTTGAGTGAGGAAGG - Intergenic
1013834371 6:114316157-114316179 AATTAGGCCATCAGTGAGCAAGG + Intronic
1015945347 6:138494870-138494892 AAGTAGTTCTTCAAAGAGGAAGG - Intronic
1030636245 7:111952423-111952445 AAGTAACCCTTCAGTTGGGAAGG + Intronic
1032359783 7:131244646-131244668 AAGTAGAGTTACAGTGACGACGG + Intronic
1033591102 7:142809121-142809143 AAATAGAACTTCAGAGGGGAGGG + Intergenic
1033592940 7:142829220-142829242 AGATAGACCTGCACTGAGGAAGG + Intergenic
1035413547 7:158665761-158665783 AAGAACAACTTCAGTGAGGGTGG - Intronic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1039080767 8:33732087-33732109 AAGTAGAAATTGACTGAGGAAGG + Intergenic
1039253647 8:35694240-35694262 AGGTTGAGCTTCAGTGAGGCTGG + Intronic
1039968556 8:42301743-42301765 CACCAGATCTTCAGTGAGGAGGG - Intronic
1044587540 8:93882072-93882094 AAGTGGATCTTCAGAGAGGTTGG + Intronic
1046539790 8:115564842-115564864 AAGTATACCATGAGTGTGGATGG - Intronic
1047663051 8:127059521-127059543 AAGCAGACCTGCAGTAAAGAGGG + Intergenic
1051521154 9:17990333-17990355 ATGTAAACCTTCAGTGATTAAGG - Intergenic
1051814206 9:21086768-21086790 AAGTTGACCTTCAGAAATGAGGG + Intergenic
1052109522 9:24563807-24563829 AAGTAGAGCATCAATGAAGAGGG - Intergenic
1052153423 9:25150140-25150162 AAGTTGTTCTTCAGTGAGAAGGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058236912 9:102501731-102501753 AAGTATACGTTCTGTGAAGAAGG + Intergenic
1059995358 9:119903559-119903581 GCGTAGCCCCTCAGTGAGGATGG - Intergenic
1186104432 X:6191261-6191283 GGGTAGAACTTCAGTAAGGAGGG + Intronic
1186257612 X:7739803-7739825 AGGTAGATTCTCAGTGAGGATGG - Intergenic
1187047143 X:15658168-15658190 AAGTAGAGCATAAGTGAGGCAGG + Intronic
1189332580 X:40152747-40152769 AAGCAGACATTCAGTGAGGAGGG - Intronic
1196764955 X:119235287-119235309 AAGCAGACCTCCACGGAGGAAGG - Intergenic
1201056452 Y:9997328-9997350 AAATAGAGCTTCAGAGAGAATGG - Intergenic
1201254241 Y:12091383-12091405 TGGTAGACCTTCAGTGAGGCTGG + Intergenic
1202104230 Y:21345515-21345537 AAATAGAGCTTCAGAGAGAATGG + Intergenic