ID: 1098579901

View in Genome Browser
Species Human (GRCh38)
Location 12:72087386-72087408
Sequence CTGAAGACACAGAAGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1067
Summary {0: 1, 1: 0, 2: 19, 3: 117, 4: 930}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098579897_1098579901 20 Left 1098579897 12:72087343-72087365 CCTGTTTGTTTGCTGCAGGAGAA 0: 1
1: 0
2: 0
3: 22
4: 199
Right 1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG 0: 1
1: 0
2: 19
3: 117
4: 930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098579901 Original CRISPR CTGAAGACACAGAAGAAAGA TGG Intronic
901053081 1:6435420-6435442 CTGATTACACAAAAGAAACATGG - Intronic
901470333 1:9451632-9451654 GGGAAGAGAGAGAAGAAAGAAGG - Intergenic
902481160 1:16712629-16712651 CTGATTACACAAAAGAAACATGG + Intergenic
902999184 1:20252603-20252625 TTGATGACACAGAAAAAAGATGG + Intergenic
903306563 1:22417161-22417183 CTGAAGGCAGAGGAGAAAAATGG - Intergenic
903656009 1:24949236-24949258 CTGAAGAAACAGCAAAAAGGAGG + Intronic
903985262 1:27222875-27222897 GTGAGGACACAGCAAAAAGATGG - Intergenic
904041067 1:27585605-27585627 CTGAAGACACACAAGGAAACGGG + Intronic
904585285 1:31576628-31576650 GTGTAGACAGAGAAGAAACAGGG + Intronic
905705313 1:40052001-40052023 CTGAAGAAATAGAAGACACATGG - Intronic
905815286 1:40945560-40945582 CTGAAGACAAAGAAGTAAAGTGG + Intergenic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906477398 1:46178972-46178994 CTGAAGAGACAGAAGAGAGAGGG - Intronic
906641386 1:47442984-47443006 CTGAAGGCAGAGAAGAAGGGAGG + Intergenic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
906874146 1:49517508-49517530 ATGAAGACAAAGGAGAATGAGGG + Intronic
907100015 1:51823105-51823127 CTGAAGACAATGATAAAAGAAGG + Intronic
907180088 1:52561877-52561899 TTCAAGACACAGAAGAGAAAAGG + Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
908053879 1:60261847-60261869 GTGAAGACACAGCAAGAAGATGG - Intergenic
908089986 1:60675886-60675908 GTGAAGACACAGACCAAAAAAGG - Intergenic
908146516 1:61250975-61250997 CCATAGACACAGAAAAAAGATGG + Intronic
908401735 1:63777618-63777640 CTCAAGATACAGAAGAGAAAGGG - Intronic
908562512 1:65320878-65320900 CTGAAGAAACAGAAACAAGCAGG + Intronic
909064070 1:70911572-70911594 CTGAAGACAGGGAAAAAAGTGGG + Intronic
909076765 1:71058436-71058458 CTTAAGAAACAGAAAAAAGCTGG + Intergenic
909091534 1:71232187-71232209 CTGAAGAAAGAGAAGAAAATGGG - Intergenic
909249616 1:73335050-73335072 GTGAAGACACGGCAAAAAGATGG + Intergenic
909331886 1:74423216-74423238 ATGGAGAGACAAAAGAAAGAGGG - Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909700607 1:78517676-78517698 TTGAGGACACAGAAGAAGGTAGG + Intronic
909747268 1:79113153-79113175 ATGAAGACAGGAAAGAAAGAAGG + Intergenic
910017422 1:82544379-82544401 ATGAAGAAACAGAACAAAGCTGG + Intergenic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
910772671 1:90845593-90845615 TTAAATACACAGAGGAAAGAAGG + Intergenic
911105670 1:94129598-94129620 CTGAAGATTGAGAAGAAAGTTGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
912759813 1:112356895-112356917 CTGAAGACCCAGAAGACACAGGG + Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913476223 1:119240943-119240965 CTGAAGACTCAGGGAAAAGATGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914506904 1:148297249-148297271 CTGCAGATACAGTAGGAAGATGG - Intergenic
915035247 1:152918184-152918206 CTGATGGCATAGAAGAAAGCTGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915347219 1:155203637-155203659 CTGGAGCCCCAGAATAAAGATGG + Intronic
915693407 1:157714290-157714312 ATGAAGATAGAGTAGAAAGATGG - Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915783523 1:158581331-158581353 CAGAAGACACAGTAGAAAAAAGG + Intergenic
915879333 1:159649764-159649786 GTGAAGACACAGGGAAAAGATGG - Intergenic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
916165561 1:161964309-161964331 CTGAAGACATAGATAAAATATGG - Intergenic
916947753 1:169745790-169745812 CTAAATACTCAGAAGAAATAAGG + Intronic
917182291 1:172312587-172312609 CTTAAGAGACAAAAGAAACAGGG - Intronic
917339665 1:173962341-173962363 ATTAAGACACACCAGAAAGAGGG - Intronic
917545692 1:175965090-175965112 CTGAAGACAGAAAAAAAAAATGG - Intronic
917919823 1:179742437-179742459 CTGAAGACAGCGAGGACAGAGGG - Intergenic
917985395 1:180312022-180312044 TTGAAGAAAAACAAGAAAGAAGG - Intronic
918080909 1:181207057-181207079 CTGGAGACACAGGAGACAGAAGG + Intergenic
918374073 1:183891245-183891267 CTGAAGACAAAGAATTAATAGGG - Intronic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918587950 1:186209472-186209494 ATAAAGAAAAAGAAGAAAGAAGG + Intergenic
918728667 1:187960728-187960750 GTGAAGTCACAGCAAAAAGATGG - Intergenic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
919973360 1:202594960-202594982 CTGTAGACACCCAAGACAGATGG - Exonic
920240542 1:204545421-204545443 CTCAAGACTCAGAAGAAATTGGG + Intronic
920244172 1:204575627-204575649 CTGAAGTCCCTGAAGAATGAGGG + Intergenic
920437348 1:205956064-205956086 ATAAAGAAAGAGAAGAAAGAAGG - Intergenic
920980956 1:210834802-210834824 GGGAGGACACAGAAAAAAGATGG + Intronic
921014844 1:211179724-211179746 CTCAAAACAAAAAAGAAAGAGGG - Intergenic
921875294 1:220188921-220188943 CTAAAGTCACAGAAGACATAGGG + Intronic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
922067444 1:222157928-222157950 TTGAAGACACAGCAGAAAAAGGG + Intergenic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
923344087 1:233034344-233034366 GTGAGGACACTGCAGAAAGATGG + Intronic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923654283 1:235901739-235901761 CCGAAGACACAGGAGAAATTGGG + Intergenic
923760325 1:236836689-236836711 TTTAAGACACAAATGAAAGATGG - Intronic
923885771 1:238153599-238153621 CTGCATACACAGTAGAAAGGTGG + Intergenic
923948045 1:238912746-238912768 TTGAGGACACAGCAAAAAGATGG - Intergenic
923995785 1:239492686-239492708 CTGCAGACAGAGAAAAAAGACGG - Intronic
924013834 1:239697632-239697654 TTCAAGACACATAAGAGAGAGGG + Intronic
924062364 1:240188293-240188315 CTTAAGACAAATAAGACAGATGG - Intronic
924111882 1:240708208-240708230 ATGAAGAACGAGAAGAAAGACGG + Intergenic
924119249 1:240779506-240779528 GTGAGGACACAGTAGGAAGATGG + Intronic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924388174 1:243520266-243520288 ATGAAGACACAGGGAAAAGACGG + Intronic
924457587 1:244230925-244230947 GTGAAGTCACCGAAGAAAGGTGG - Intergenic
924501014 1:244638057-244638079 TTGAATATACAGAAGAGAGAAGG - Intronic
924728535 1:246691876-246691898 CTGAAGACACAACAGAGACAGGG - Intergenic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063182326 10:3615439-3615461 TTGGAAGCACAGAAGAAAGATGG - Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064937443 10:20693795-20693817 GTAAAGAAACAGAAGAAAAAGGG - Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1064951270 10:20853695-20853717 ATGAAGACAGAGTAGAATGATGG + Intronic
1064990389 10:21251744-21251766 ATGAGGACACAGAGAAAAGATGG + Intergenic
1066130062 10:32384510-32384532 CTGAACAGAAAGAAGAAAGCTGG + Intergenic
1066166680 10:32796069-32796091 CTGAGGACAGAGGAGACAGAGGG - Intronic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066695633 10:38075370-38075392 TTGAATACAGAGAAGAAACATGG + Intergenic
1067426899 10:46217358-46217380 GTGAAGACACAGGAGAAAGAGGG + Intergenic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068450235 10:57176911-57176933 CTGAAGGCATAAAAGAAAGCAGG + Intergenic
1068454309 10:57235384-57235406 GTCAAGAAAGAGAAGAAAGAGGG - Intergenic
1068483467 10:57625796-57625818 ATGAAGACACTGGAGGAAGACGG - Intergenic
1068531538 10:58192898-58192920 CTAAAGGCACTGGAGAAAGAAGG + Exonic
1069336104 10:67352750-67352772 TTGAAGACACAGGAGATAGTAGG - Intronic
1070091603 10:73291302-73291324 TAGAAGACACTGAGGAAAGAGGG - Exonic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1071144605 10:82553417-82553439 CTGTAGACTCCAAAGAAAGATGG - Intronic
1071481159 10:86066078-86066100 CTGAAAAGACAGATTAAAGAGGG + Intronic
1072526561 10:96276800-96276822 GTGGAGACAAGGAAGAAAGAAGG + Intergenic
1072735015 10:97873402-97873424 AGGCTGACACAGAAGAAAGAGGG - Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073573233 10:104598648-104598670 CCCAGGACACAGAAGAAAAAAGG - Intergenic
1074765188 10:116695069-116695091 CTGACAACCAAGAAGAAAGAGGG - Intronic
1074970826 10:118535367-118535389 CAGAATACACAGAAGACAGAAGG - Intergenic
1075646931 10:124102800-124102822 CTGAAGCCACAGGGGAAGGATGG + Intergenic
1075847263 10:125555017-125555039 AGGAAGACACAGAAGAGGGAAGG - Intergenic
1075852778 10:125602650-125602672 CTAAAGACACAAATCAAAGATGG + Intronic
1076326922 10:129631360-129631382 ATGATGAGACAGAAGAATGAAGG + Intronic
1076637829 10:131893919-131893941 CTGAAGGAAGGGAAGAAAGATGG - Intergenic
1077922208 11:6650108-6650130 AGGAAGAAAGAGAAGAAAGAGGG - Intronic
1078455421 11:11470990-11471012 AGGAAGATACAGGAGAAAGAGGG - Intronic
1078772335 11:14362500-14362522 CTGAAGACACAGGAGAATATGGG + Intronic
1079055888 11:17206728-17206750 GTGAAGACATAGTAGAAAGAGGG - Intronic
1079105381 11:17568876-17568898 CTAAAGACACAGAGCAGAGATGG - Intronic
1079380412 11:19933153-19933175 CTGCAGAGACAGAAGAGAGGAGG - Intronic
1079506957 11:21163720-21163742 CTGAGGACACAGAAAAAGGCAGG - Intronic
1079592905 11:22202612-22202634 GTGAAGACACAGTAAGAAGATGG - Intronic
1080288541 11:30644340-30644362 CTGAAAAGAAACAAGAAAGATGG + Intergenic
1080430526 11:32194898-32194920 CCAAAGACACAGATCAAAGAGGG + Intergenic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1080971354 11:37280781-37280803 GTGAAGATACAGAAGAGAGAAGG - Intergenic
1081108681 11:39104743-39104765 GTGAAGACACAGGAGGAAGATGG - Intergenic
1081140037 11:39487283-39487305 CTGAAGACAGAGAAGCCAGTAGG - Intergenic
1081417739 11:42835990-42836012 GTGAAGACATAGAGGAAATATGG - Intergenic
1081431039 11:42976978-42977000 CAGAAGCCAGAGCAGAAAGATGG - Intergenic
1081779206 11:45698488-45698510 TAGAAGACAGAGAAGAAAAAGGG + Intergenic
1082114309 11:48311575-48311597 GTGAGGACACAGAAAGAAGACGG - Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082205328 11:49426688-49426710 GTGAAAACACAGGAAAAAGATGG + Intergenic
1082809210 11:57468423-57468445 CAGAAGAGGCAGAAGACAGATGG - Intronic
1082953508 11:58844014-58844036 CACATGACACAGAAGGAAGAAGG + Intronic
1082969909 11:59009274-59009296 CACATGACACAGAAGGAAGAAGG + Intronic
1083002023 11:59301212-59301234 CTCAAGAAACAGAAGGAAGTGGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083948631 11:65941218-65941240 CTGTGGACAAAGAAGACAGACGG + Intergenic
1084010085 11:66342988-66343010 CTGAAGACACAGAAAAGAGAGGG - Intronic
1084057235 11:66643426-66643448 TTGAAGAAACAGACGCAAGAAGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084499028 11:69523975-69523997 TGGAAGACACAGAAGAGAAAAGG - Intergenic
1084629800 11:70340514-70340536 CTGAACAGACCAAAGAAAGAAGG - Intronic
1085237457 11:75025998-75026020 CTTAAGACAGAGAGGAGAGAGGG - Intergenic
1085293825 11:75419235-75419257 CTAAAGACAAAAAAGAAACATGG - Intronic
1085391701 11:76185488-76185510 GAGAAGACACAGGAGACAGAAGG - Intergenic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085923936 11:80991831-80991853 ATGAGGACACAGAGAAAAGAAGG - Intergenic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1086318652 11:85620735-85620757 AGGAAGCCACAGAAGAAAGCTGG + Intronic
1086649775 11:89273846-89273868 GTGAAGACATAGGAAAAAGATGG - Intronic
1087749801 11:101994848-101994870 CTCAAGACACAGAAAAGATATGG - Intronic
1087788441 11:102381859-102381881 CCAAAGAGAAAGAAGAAAGAAGG - Intergenic
1088046969 11:105464758-105464780 ATGAAGATACAGTAGAATGAAGG + Intergenic
1088123732 11:106398721-106398743 GGGAAGAAAAAGAAGAAAGAAGG - Intergenic
1088629705 11:111762930-111762952 TTGAGGACACAGAAGAAACAAGG + Intronic
1088864184 11:113831138-113831160 CTGAAGACACAAAGACAAGAAGG + Intronic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089590903 11:119540232-119540254 ATAATGAAACAGAAGAAAGATGG + Intergenic
1089623856 11:119739091-119739113 TTGAAGAAACAGAAGCTAGAGGG + Intergenic
1089955115 11:122563448-122563470 CTGAAGTGACATCAGAAAGATGG + Intergenic
1090369088 11:126234743-126234765 CTTCAGAAACAGAAGCAAGATGG + Intronic
1090517737 11:127446840-127446862 CTGAAGACCCAGAGGAAATGAGG - Intergenic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1090968538 11:131619596-131619618 CAGAACACACTCAAGAAAGAGGG + Intronic
1091357092 11:134945431-134945453 CGAAAGACAGAGAAGAAAGAGGG - Intergenic
1091658393 12:2362734-2362756 CTGCAGCCACAGGAGAGAGAGGG - Intronic
1091773439 12:3168771-3168793 GTGGAGACACAGAAAAGAGAGGG - Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1092314559 12:7396650-7396672 CTGAAGTCCCCCAAGAAAGAAGG + Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1093110183 12:15142684-15142706 CTCAAGAAAGAGAAGAGAGAGGG + Intronic
1093195973 12:16129961-16129983 TTGAAGACAAAGGAGAAACAAGG + Intergenic
1093428151 12:19052606-19052628 CTTAAAACATAGAAGAAAGGAGG + Intergenic
1093778975 12:23112017-23112039 AGGAAGAAAAAGAAGAAAGAAGG - Intergenic
1094086202 12:26594796-26594818 GTGAAGAAATATAAGAAAGAAGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094320632 12:29179010-29179032 CTGAAGACACAGGAAAAAGATGG - Intronic
1094749846 12:33393191-33393213 ATGAAGACAGTGAAGTAAGAGGG + Intronic
1094804901 12:34080200-34080222 CTGGAGAAAGAAAAGAAAGAAGG + Intergenic
1095042608 12:37459411-37459433 CCGAAGACACAGAAGAAGGCAGG - Intergenic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1095237214 12:39812176-39812198 GTGAGGGCACAGATGAAAGATGG - Intronic
1095392546 12:41726283-41726305 CTGAAGACAAAGAGAAAACATGG - Intergenic
1096059066 12:48681382-48681404 CCAAAGCCAGAGAAGAAAGATGG - Exonic
1096255846 12:50061969-50061991 CTGACAACCCAGAAGCAAGAAGG - Intronic
1096896585 12:54826775-54826797 CTGAGGACAAACAAAAAAGATGG - Intergenic
1097180631 12:57169770-57169792 CTGAAGAGACAGAGGAGAGAGGG + Intronic
1097386556 12:58956760-58956782 GTGAAGACAAAGAATAAAGAGGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1099245358 12:80187390-80187412 CTGAAGATCCAGCAGAAATATGG + Intergenic
1099265724 12:80445005-80445027 CTGAAGAAACAGCAGAATGCAGG - Intronic
1099389575 12:82062839-82062861 GTGAAGACACAGAAAAAAGATGG + Intergenic
1099749615 12:86756211-86756233 TTGAACACACAGAAAAAAGGTGG - Intronic
1099964697 12:89433317-89433339 CTGATGACACAGGAGAGTGAGGG + Intronic
1100038661 12:90283586-90283608 GTGAAGACAGAGGGGAAAGATGG - Intergenic
1100502575 12:95188266-95188288 CTGAAGGCACAGAAAAAAAATGG + Intronic
1100871909 12:98918366-98918388 ATGAATACACAGAAGATACAAGG + Intronic
1100879895 12:99004865-99004887 CTGAAGAGATAGAAGTGAGAGGG + Intronic
1100929360 12:99587943-99587965 CAGAAGACAAAGGAGAAACAGGG + Intronic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101544767 12:105702150-105702172 CTGAAGACACATAGTAAATAGGG + Intergenic
1101858902 12:108466685-108466707 ATGAAGGCACAGAAGAGAGCTGG - Intergenic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103152206 12:118650618-118650640 CTGAAGGAACAGAACAGAGACGG - Intergenic
1103252298 12:119510696-119510718 AGGATGACACAGAAGAAAGTGGG - Intronic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1104124483 12:125833209-125833231 CAGATGACAAAGAAGAAAGCTGG - Intergenic
1104467455 12:129002534-129002556 CTGAAAGAACAGGAGAAAGAGGG - Intergenic
1105237597 13:18572970-18572992 ATGAGGCCAGAGAAGAAAGAGGG + Intergenic
1105690528 13:22833518-22833540 CTAAAGGCACTGGAGAAAGAAGG + Intergenic
1106546188 13:30732851-30732873 CAGAAGAGAGAGAAAAAAGAGGG + Intronic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1106727825 13:32504392-32504414 GTGATGACACTGGAGAAAGAAGG - Intronic
1106728016 13:32506172-32506194 GTGAAGACACTGGAGGAAGATGG - Intronic
1106862146 13:33921372-33921394 CTGAAGACACACAACTTAGAGGG + Intronic
1107011071 13:35671789-35671811 TTGAAGACACAGCAGAAAGGGGG + Exonic
1107331751 13:39308853-39308875 CTGAAGAAATATAAGAAAGTTGG - Intergenic
1107612610 13:42131336-42131358 TTGAAGACTCAGGAGAGAGAGGG + Intronic
1107793978 13:44031215-44031237 CTCAAAAAAAAGAAGAAAGATGG - Intergenic
1107809441 13:44186203-44186225 GTGAAGACACAGCAAAAAGGTGG - Intergenic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108695005 13:52895536-52895558 CTGAAGACACAGGAGAGGAAGGG - Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109587932 13:64434187-64434209 CTGAAGACAATGAGCAAAGAAGG + Intergenic
1110076011 13:71244123-71244145 CTGAAAACACAAAAGTAATACGG - Intergenic
1111105482 13:83640423-83640445 CTGAACATAAAGAACAAAGATGG - Intergenic
1111454697 13:88465651-88465673 GCAAAGTCACAGAAGAAAGATGG - Intergenic
1111530203 13:89526632-89526654 CTGCAGACATAGAAGCAAGCTGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111801009 13:92980840-92980862 CAGAAGACAGAGAGGAAAAAAGG - Intergenic
1111880900 13:93955838-93955860 CTGGAGAAAAAGAAGATAGAAGG - Intronic
1112264804 13:97913590-97913612 GAGAGGACACAGGAGAAAGATGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112883050 13:104133278-104133300 CTGAAGTCACAGAAGAAATCAGG - Intergenic
1113263317 13:108590686-108590708 CAGAAGACATAAAAGAGAGAAGG + Intergenic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1114819216 14:25996301-25996323 ATGAAAACATAGAAGAATGAAGG - Intergenic
1114885508 14:26844838-26844860 GGGAAGAGACAGAAGACAGATGG - Intergenic
1115012163 14:28562053-28562075 CTGAAGACAGTGAGGAAAAAGGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115279266 14:31642627-31642649 CTGAGCACAAAGAACAAAGATGG - Intronic
1116586308 14:46709216-46709238 TTGAGGACACAGCAGAAAGATGG + Intergenic
1116722816 14:48522761-48522783 CTCAAGAAACAGAAGTAAGGTGG + Intergenic
1116769087 14:49106524-49106546 CTGAAGAAAAAAAAAAAAGAGGG + Intergenic
1116770188 14:49118480-49118502 ATGAAGGCAGAGAGGAAAGAGGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117653911 14:57934849-57934871 GAAAAGACACAGAAGAATGAGGG + Intronic
1117768264 14:59106289-59106311 CTGAAGTTACAGGAGAAAAAAGG - Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118032105 14:61828095-61828117 GTGAAGACACAGGAAGAAGATGG + Intergenic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1118506838 14:66422857-66422879 CTTATTACACAGAAGAGAGAGGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118837410 14:69486588-69486610 CTGCTGAGGCAGAAGAAAGATGG - Intronic
1118896302 14:69948670-69948692 GAGAACACACAGAAAAAAGAGGG - Intronic
1118944071 14:70366686-70366708 TGGAAGACACAGAAGACACACGG - Exonic
1119890196 14:78176814-78176836 CTGAAGAAAGAGAACTAAGAAGG - Intergenic
1119925311 14:78488087-78488109 GTGAGGACACAGGAAAAAGATGG - Intronic
1120126734 14:80753270-80753292 CTAAAGACACAGAAGCAAACGGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120142591 14:80945184-80945206 CTGAGGATACAGAGAAAAGATGG - Intronic
1120290267 14:82560667-82560689 ATGAAGACAAAGATGAAATATGG - Intergenic
1120689917 14:87581042-87581064 ATGCAGACAAAGAAGAAACAAGG + Intergenic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1121283602 14:92717298-92717320 TTCTAGAAACAGAAGAAAGAGGG + Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121874206 14:97436178-97436200 TTGAAGAGACAGAAAAAAGTGGG + Intergenic
1121918762 14:97860775-97860797 GTGAAGACACAGAAGACAGATGG + Intergenic
1121953613 14:98194513-98194535 CTTAAAACACAAAGGAAAGATGG + Intergenic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1122727522 14:103768007-103768029 ATAAAGACACAAAAGCAAGATGG - Intronic
1202940392 14_KI270725v1_random:139594-139616 CTGACGAAACAGGGGAAAGATGG + Intergenic
1123663222 15:22584834-22584856 CTAAAGACACAGAAGAATTATGG - Intergenic
1123807810 15:23893186-23893208 CAGGAGACACAAAAGCAAGAAGG + Intergenic
1123977608 15:25567966-25567988 CTGAAGAGGCAAAAGACAGATGG + Intergenic
1124259320 15:28174253-28174275 CTAAAGACACAGAAGAATTATGG - Intronic
1124317051 15:28679272-28679294 CTAAAGACACAGAAGAATTATGG - Intergenic
1124566400 15:30818217-30818239 CTAAAGACACAGAAGAATTATGG + Intergenic
1125398526 15:39275387-39275409 CTGAAGAGATGGAAGAAACAAGG - Intergenic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1125968917 15:43896298-43896320 GTGAAGTCACAGAGGAAAGAAGG - Intronic
1126567118 15:50112410-50112432 CTGAAGACTCAGGAAAAAGCAGG + Intronic
1126993057 15:54406017-54406039 CTGAGGACTCAGAGGATAGAAGG - Intronic
1127040133 15:54966140-54966162 GTGAAAACACAGCAAAAAGATGG - Intergenic
1127366106 15:58292178-58292200 ATGAAGACACAGGAATAAGATGG - Intronic
1127715940 15:61649577-61649599 TGGAAAACACAGAAGAACGAAGG - Intergenic
1127858668 15:62974353-62974375 GTGATGACAGAGAACAAAGAAGG + Intergenic
1128443755 15:67738573-67738595 CTGAAGTCCAAAAAGAAAGAAGG - Intronic
1128955686 15:71940939-71940961 AAGAAGAGACAGAAGAAAGGAGG + Intronic
1129292468 15:74578891-74578913 CTCAAAAAACAAAAGAAAGAAGG + Intronic
1130050441 15:80479713-80479735 CTGAAGGCTCAGCAGAAACAGGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130338797 15:82981071-82981093 TTGAAAACAGAGAAGAGAGAAGG + Intronic
1130635768 15:85618468-85618490 GTGAAGAAACAAAAGAAAAAGGG - Intronic
1131860840 15:96651688-96651710 TTGAGGAGAGAGAAGAAAGAAGG + Intergenic
1132272786 15:100540922-100540944 ATGAAAACACCAAAGAAAGAAGG - Intronic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133606679 16:7394382-7394404 CTGAAGACTAAGGAGACAGAAGG - Intronic
1133838951 16:9391519-9391541 GTGAAGACACAGAAGTCACAAGG + Intergenic
1134145282 16:11755807-11755829 ATGAAGACACAGAACAGAGAAGG + Intronic
1134383652 16:13751490-13751512 ATCAAGACAGAGAAGAGAGAGGG + Intergenic
1134408134 16:13980887-13980909 TTGAAGAGACTGAGGAAAGATGG + Intergenic
1134514394 16:14875021-14875043 TGGAAGACCTAGAAGAAAGACGG - Exonic
1134904842 16:17971529-17971551 AAGAAGAGACAGGAGAAAGATGG + Intergenic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135741228 16:24976760-24976782 CTGAGGGCACAGGAGAGAGAAGG + Intronic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1135900563 16:26455813-26455835 CTGAGCACACAGAACAAACAAGG + Intergenic
1135972226 16:27080857-27080879 CTGAAGAGAGAGAAGGAAAAGGG - Intergenic
1136029120 16:27489987-27490009 CTGAATTCACTGAAGACAGAAGG + Intronic
1136071192 16:27788278-27788300 CTCAAGAAAGAGAAGAAAGTGGG - Exonic
1137088793 16:36162463-36162485 ATGAACACAAGGAAGAAAGAAGG + Intergenic
1137774075 16:51041086-51041108 ATGAAGACAAGGAAGAAGGAAGG + Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1138681452 16:58686240-58686262 GTGAGGACACAGCAGGAAGATGG - Intergenic
1138705165 16:58908201-58908223 CTGAAGAGAAAGAAAAAATAAGG - Intergenic
1138947763 16:61872874-61872896 CAGAAGGCACAGAAGCAAGAAGG + Intronic
1139065916 16:63314420-63314442 TTAAAGACTCAGAAGATAGAGGG + Intergenic
1139134098 16:64180374-64180396 TTAAAGACTCAGAAGATAGAAGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139146651 16:64332707-64332729 CTGAAGACACAGAAATGAAAAGG + Intergenic
1139264307 16:65624696-65624718 CTGGAGACAGAGGAGAAAGAGGG - Intergenic
1139687958 16:68618949-68618971 CTGAGGATACGGGAGAAAGAGGG - Intergenic
1140559923 16:75967080-75967102 TTGAAGACAAGGAAGAGAGAAGG + Intergenic
1140675383 16:77323608-77323630 TTAAAAACACAGAGGAAAGACGG + Intronic
1140757438 16:78080607-78080629 ATGAAGAGTCAGAAGAAAGTAGG + Intergenic
1140923184 16:79558284-79558306 ATAAAGAGAAAGAAGAAAGAAGG + Intergenic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141198381 16:81878586-81878608 CTCAAGAGACAGTAGGAAGAAGG - Intronic
1141243474 16:82284833-82284855 ATGAAGAAACAGAAGAAATTAGG + Intergenic
1142025187 16:87808981-87809003 CTGTACACAAAGAAGAAAGAAGG + Intergenic
1143182402 17:4991599-4991621 ATGAAGACAGAGAAGATAAAGGG - Intronic
1143271570 17:5679318-5679340 GTGAAGACATAGAGAAAAGATGG + Intergenic
1143477004 17:7208531-7208553 GTGAAGACACAGATGCCAGAGGG - Intronic
1144089187 17:11838565-11838587 GTGAAGACCCAGATGAATGAAGG + Intronic
1144349466 17:14380894-14380916 GTGCAGAAACAGAAGAGAGAAGG + Intergenic
1144498615 17:15766329-15766351 GTAAAGACACAGTAAAAAGATGG - Intergenic
1144894761 17:18521681-18521703 ATGAAGACAGGGAGGAAAGATGG + Intergenic
1145161998 17:20581367-20581389 GTAAAGACACAGTAAAAAGATGG - Intergenic
1147443543 17:40461741-40461763 TTCAACCCACAGAAGAAAGAAGG - Intergenic
1148068259 17:44889479-44889501 CTGATGGCACAGGAGAGAGAGGG + Intronic
1148656937 17:49291603-49291625 CTGAAGACATACAAGACAGCAGG + Intronic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149090246 17:52769396-52769418 ATGAAGACCCAGAAGGGAGAGGG + Intergenic
1149144356 17:53472177-53472199 GTGAAGACACAGCAAGAAGATGG - Intergenic
1149247536 17:54728394-54728416 GAGAAGCCACAGAACAAAGATGG + Intergenic
1149337820 17:55655322-55655344 GTGGAGAGAGAGAAGAAAGAAGG - Intergenic
1149371247 17:55995355-55995377 GAAAAGACTCAGAAGAAAGAGGG + Intergenic
1149440992 17:56673702-56673724 CTAAAGCCACAGAATAAACAGGG + Intergenic
1149482595 17:57015960-57015982 CTTAAGACAGAGTAGAAACAGGG + Intergenic
1149620293 17:58039779-58039801 GTGCAGCCACAGAAGAAGGAGGG + Intergenic
1149707119 17:58705266-58705288 ATGAGGACACAGAGAAAAGATGG - Intronic
1149952898 17:61010226-61010248 ATAAAAACACAGAAGAAAAATGG - Intronic
1150035057 17:61786128-61786150 GTGAAGAGAGAGAAGAAAGAAGG + Intronic
1150345996 17:64405175-64405197 CTGAAGACAAAGGAAAAGGAAGG + Intronic
1150951671 17:69808994-69809016 TTGAAGACACAGCAAAAAGGCGG + Intergenic
1150971208 17:70030107-70030129 CAAAAGACAAAGAATAAAGATGG - Intergenic
1151120045 17:71782900-71782922 CTAAAGACATACAAGAAAGTAGG + Intergenic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1152891562 17:82884508-82884530 CTGAAGACGCAGAAGAGAGTGGG + Intronic
1153084962 18:1274762-1274784 CTGGAGACACAAGAGAAAGGGGG + Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1154497585 18:14973870-14973892 CGAAAGACAGAGAAGAAAGAGGG + Intergenic
1155605985 18:27606459-27606481 GTGAAGACCCAGCAAAAAGATGG - Intergenic
1156412299 18:36842395-36842417 ATGAAGACCAGGAAGAAAGAAGG - Intronic
1156503953 18:37577407-37577429 CGGATGGCACAGAAGAAGGAAGG - Intergenic
1157144060 18:45143112-45143134 CTGTTGACTCACAAGAAAGATGG - Intergenic
1157621155 18:49018169-49018191 AGGAAGACACAGGAGAAGGAAGG + Intergenic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1157882981 18:51339773-51339795 TTGAAGACAAAAAAAAAAGAAGG + Intergenic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1158928581 18:62297419-62297441 ATGAAAATATAGAAGAAAGAAGG + Intronic
1159074673 18:63666783-63666805 TTGAAGACAGAGAAAAACGATGG - Intronic
1159103636 18:63981779-63981801 CTGAAGACACTGAAGAGTGCAGG + Exonic
1159202964 18:65211405-65211427 GTGAAGACACAGTAAGAAGATGG + Intergenic
1159446771 18:68550509-68550531 ATGAAGACAGAGTAGAATGATGG + Intergenic
1159446854 18:68551414-68551436 ATGAAGACAGAGTAGAATGACGG - Intergenic
1159545062 18:69830472-69830494 GTGAGGACACAGCACAAAGATGG + Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1160542019 18:79629062-79629084 CTGAAGACAAAGATCAAAGCTGG + Intergenic
1160596173 18:79975945-79975967 CTGAACACACAGTAGAGAAAAGG + Intronic
1161336195 19:3714943-3714965 CTGAATGCACAGAAGAATTAAGG + Intronic
1163000282 19:14362789-14362811 ACGAAGAAAGAGAAGAAAGAAGG + Intergenic
1163195057 19:15712869-15712891 CAAAAGACACAGAAGAAAATTGG + Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163989256 19:20983139-20983161 CTGTGGACACAGAGTAAAGAAGG - Intergenic
1164464386 19:28475182-28475204 ATGGAGACACAAGAGAAAGAAGG - Intergenic
1164570724 19:29372467-29372489 GGGAAGACCCAGGAGAAAGAAGG + Intergenic
1164760837 19:30727170-30727192 TTGAAGACACAGCACAAAGATGG - Intergenic
1165293295 19:34906089-34906111 CTGAAGACAGAGAAGATGCAGGG + Intergenic
1165647121 19:37450467-37450489 CTGATGCCACAGAAGTAAAAAGG - Intronic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1166168672 19:41010798-41010820 GTGAAGACTCAGAAGAGTGAGGG - Intronic
1166184591 19:41131577-41131599 CTGGAGACACTGAAAAGAGATGG + Intergenic
1167602307 19:50461461-50461483 CACAAGACACAGACGAAAGAAGG - Intronic
1202715195 1_KI270714v1_random:38533-38555 CTGATTACACAAAAGAAACATGG + Intergenic
925044770 2:764512-764534 CTGACCACACAGCAGCAAGACGG - Intergenic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
925309523 2:2872548-2872570 CTGCAGCCAGAGAAGAGAGATGG - Intergenic
925316190 2:2926074-2926096 GTGAAGACACAGGAAGAAGATGG + Intergenic
925720260 2:6820540-6820562 CGGAAGCCACGGGAGAAAGATGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926129241 2:10290510-10290532 CTCAGGAGACAGAAGACAGAAGG - Intergenic
926352142 2:12005540-12005562 GTGAAGACACAGCAATAAGATGG - Intergenic
926696833 2:15775959-15775981 GTGAGGACACAGAGAAAAGATGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926964807 2:18398220-18398242 CTGAAGGGACAGTAGTAAGAGGG - Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927417904 2:22898092-22898114 CAGAAGAAAAGGAAGAAAGAAGG + Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928168550 2:28988513-28988535 CTGAAGACACAGGGGAGGGAGGG - Intronic
928224587 2:29437228-29437250 TCTAAGAGACAGAAGAAAGAAGG - Intronic
928320413 2:30278814-30278836 TTGAAGATACAGAAGAAAGGAGG - Intronic
929404012 2:41620236-41620258 CAGAAGGCAGAGAAGAATGAAGG + Intergenic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
930011238 2:46940279-46940301 CTGAAGACTCAAAAGACAGCAGG - Intronic
930016398 2:46973767-46973789 CAGAAGAGACAGAAAAAAGTCGG + Intronic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
930354058 2:50294916-50294938 CAGACGAGACAGAATAAAGAGGG + Intronic
930514556 2:52389842-52389864 CTGAACACATATAAGAAAGAAGG - Intergenic
930686698 2:54316295-54316317 GTAGAGACACAGAAGATAGAAGG + Intergenic
930953797 2:57178336-57178358 AGGAAGAGACAGAAGATAGAGGG - Intergenic
931196199 2:60054232-60054254 ATGAAGACACTGCAGAGAGAAGG - Intergenic
931210199 2:60186476-60186498 GTGAGGACACAGAAGAAAGGTGG - Intergenic
931905420 2:66837504-66837526 ATGAAGACAGAGTAGAATGATGG - Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932383503 2:71307767-71307789 CTCAAGAGACAGAATAAATATGG - Intronic
932492368 2:72130563-72130585 TCGAAAACACAGAAGAATGAAGG - Exonic
932701817 2:73997405-73997427 CTGAAGCCCTAGAAGAGAGAGGG + Intronic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
932717439 2:74111818-74111840 CTTAAGGTACAGAAGAAACAGGG - Intergenic
933380194 2:81533158-81533180 CTGAAGACCAAAAAGAATGAGGG + Intergenic
933569377 2:83991601-83991623 TTGAAGAAAGAGAAAAAAGAGGG - Intergenic
933760190 2:85667371-85667393 GGGATGACACAGAATAAAGATGG - Intronic
933996933 2:87677014-87677036 ATGAAGGCACAGAAGCAAGACGG + Intergenic
934161870 2:89257452-89257474 CGGAAGACACAGAGGAAGGGAGG + Intergenic
934205412 2:89924910-89924932 CGGAAGACACAGAGGAAGGGAGG - Intergenic
935531284 2:104235179-104235201 ATGAAGACACACAAAGAAGAAGG + Intergenic
935547003 2:104410958-104410980 CTGAAGAAATAGAAGTGAGATGG + Intergenic
935611652 2:105031949-105031971 GTGAAGATACAGGAAAAAGATGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935813437 2:106823820-106823842 GTGAAGACACAGCAGAAAGATGG - Intronic
936156995 2:110053736-110053758 GTAAGGACACAGAAGAAAGATGG - Intergenic
936187699 2:110317708-110317730 GTAAGGACACAGAAGAAAGATGG + Intergenic
936296917 2:111273896-111273918 ATGAAGGCACAGAAGCAAGACGG - Intergenic
936406524 2:112209683-112209705 TTGAAGTCACAAAAGGAAGATGG + Intergenic
936895746 2:117425552-117425574 ATGAAGACACAGGAAAAAGATGG + Intergenic
936946990 2:117940139-117940161 CTTGAGTCAGAGAAGAAAGAGGG + Intronic
937420283 2:121748385-121748407 ATGAAGACACAGTGAAAAGATGG + Intronic
937779049 2:125816274-125816296 CAGAACAAACAAAAGAAAGAAGG + Intergenic
937795368 2:126011654-126011676 GTGAAGACACAGTAAGAAGATGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
938230788 2:129656991-129657013 CTTAAGCCACAGAAGAAGGTGGG + Intergenic
938267110 2:129935746-129935768 CTGAATACACATTAGATAGACGG - Intergenic
938420168 2:131139273-131139295 CTGAAGAGAGAGAAGACAGACGG - Intronic
938512177 2:131961529-131961551 ATGAGGCCAGAGAAGAAAGAGGG - Intergenic
938930173 2:136079864-136079886 GTGAAGACACAGCAGGAAGGTGG - Intergenic
939223749 2:139338755-139338777 ATGATGACACAAAAGAAAGAAGG + Intergenic
939681213 2:145135769-145135791 CTTAAGAGACACAAGACAGATGG + Intergenic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
940322173 2:152389303-152389325 ATGAAGATACAGCAGAAGGATGG - Intronic
940390153 2:153123044-153123066 GTGAAGATACAGAAGACACAGGG + Intergenic
940390159 2:153123112-153123134 ATGAAGATACAGAAGACACAGGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940685005 2:156837880-156837902 CAGAAGGCAAAGAAGAAACAAGG - Intergenic
940805442 2:158181777-158181799 CTGAAGCTAGAGAAGCAAGAGGG + Intronic
941815483 2:169791419-169791441 GTGAAGACACAAAATAAAGTTGG - Intergenic
941924675 2:170883371-170883393 CTGAAGAGAAAGGAGAATGAAGG + Intergenic
942160255 2:173177910-173177932 CTGAAGAAACTACAGAAAGAAGG + Intronic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942629340 2:177938939-177938961 GTGAAGACACAGGAACAAGATGG + Intronic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
942842886 2:180384323-180384345 TTTAAGACACAGAAGAAATCAGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943078735 2:183230765-183230787 GTGAAGACAAAGGAAAAAGATGG - Intergenic
943349045 2:186775732-186775754 CTAAAGACACAGAAATAAAAAGG + Intergenic
943465696 2:188226636-188226658 GTGAAGACACAGAATGAAAATGG + Intergenic
943600979 2:189920660-189920682 CACAAGACACAGAAGAAAGTGGG - Intronic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
944156026 2:196608829-196608851 CTTATAAGACAGAAGAAAGAGGG - Intergenic
944226384 2:197352585-197352607 GTGAGGACACAGTAGAAAGATGG + Intergenic
945154853 2:206827802-206827824 CTGAAAACATGGAAGAAAGAAGG - Intergenic
945646329 2:212499869-212499891 CTGAAGACACAGAAAAGAATAGG + Intronic
945688791 2:213007160-213007182 AGGAAGAAACAGAAGAGAGAAGG - Exonic
945837882 2:214853944-214853966 GTGAGGACACAGCAGGAAGATGG + Intergenic
946617565 2:221526500-221526522 CTGAGCACACAGGAGAAAGGTGG - Intronic
946626025 2:221613138-221613160 CTGGAGACGCAGAGGAGAGAAGG + Intergenic
947164178 2:227244928-227244950 CTGAAGACATAGGAAAAAGGAGG - Intronic
947280657 2:228450090-228450112 GTAGAGACACAGAAGTAAGATGG + Intergenic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947310683 2:228798527-228798549 CTGAAGTCAAATAACAAAGAGGG - Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
948261196 2:236605664-236605686 GTGAGGACACAGAAGAGAGAAGG - Intergenic
948749862 2:240125329-240125351 CTGAAGATACACAAGAAAGTGGG - Intergenic
1169007002 20:2215974-2215996 CTGAAGAGAAAGAAGAAAGGGGG + Intergenic
1169145162 20:3247756-3247778 ATGAAGCCACCGAAGATAGAGGG + Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1169665050 20:8023867-8023889 CTGAAGACACACCAGACTGAAGG + Intergenic
1169679550 20:8195437-8195459 GTGAAGACACAGCAAAAAGATGG + Intronic
1169888519 20:10428918-10428940 CCAAAGACACAGTAGAAAGTGGG - Intronic
1170319610 20:15080562-15080584 GCGAAGATACAGAAGAAAAAGGG - Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170943881 20:20872198-20872220 TTGAAGACAGGGAAGAAAGGGGG - Intergenic
1171040726 20:21760388-21760410 ATGAAAACAGAGAGGAAAGAAGG - Intergenic
1171138918 20:22723754-22723776 TTGAAGACTCAGAAGAGAAAAGG - Intergenic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1171727948 20:28643283-28643305 CAGAATACACAGAAGATACAAGG - Intergenic
1171804071 20:29658669-29658691 CCCAAGACACAGAAGAAGGCAGG + Intergenic
1172262579 20:33581062-33581084 CTCAAGACAGGAAAGAAAGAAGG - Intronic
1172747647 20:37225240-37225262 TAGGAGACACAAAAGAAAGAAGG - Intronic
1173138510 20:40461254-40461276 CTGAAGACACATGAGTGAGAAGG - Intergenic
1173187936 20:40855579-40855601 CTGCAGACAGAGCAGAAACAAGG - Intergenic
1173454384 20:43190967-43190989 GTGCTGACACAGAAGAAGGAGGG - Intergenic
1173762725 20:45578145-45578167 CTGAAGACACATGACAGAGATGG - Intronic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1174436019 20:50507589-50507611 CTAAAAACACAGAAAATAGATGG - Intergenic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175059669 20:56230501-56230523 AGGAAGACAGGGAAGAAAGAGGG + Intergenic
1175106458 20:56618494-56618516 CTGAAGACAGAGAGCAAAGGTGG - Intergenic
1175391857 20:58632494-58632516 CAGAAGACACATAGGGAAGAGGG + Intergenic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1175614114 20:60378052-60378074 CTGCATTCATAGAAGAAAGAGGG - Intergenic
1175765358 20:61588662-61588684 CTGGAGACAGAGGAGAAAGGGGG - Intronic
1176781586 21:13201247-13201269 ATGAGGCCAGAGAAGAAAGAGGG + Intergenic
1176843317 21:13857820-13857842 CACAAGACAGAGAGGAAAGAGGG + Intergenic
1176901772 21:14451028-14451050 CCGATGAAACAGAAGAATGAAGG - Intergenic
1176989561 21:15478920-15478942 CTGAAGACACAAATTAAAGAGGG + Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177507921 21:22041299-22041321 GGGAAGACACAGAAGGAAGCTGG - Intergenic
1177735763 21:25086703-25086725 CTGAGGACACAGGAAGAAGAGGG + Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1177787559 21:25688361-25688383 CTTAAGACACAGAAGACATGAGG + Intronic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1177979287 21:27890396-27890418 ATGAGGCCAGAGAAGAAAGAGGG + Intergenic
1178332826 21:31714593-31714615 GTGAAGATAAAGAAGAACGAGGG + Intronic
1178526674 21:33335888-33335910 TGGAACACCCAGAAGAAAGAAGG - Intronic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178901602 21:36603444-36603466 CTAAAGACACATAAGAAAGGAGG + Intergenic
1179274923 21:39883399-39883421 CTGATGACAAAGAAGAAATGTGG - Intronic
1179298345 21:40083059-40083081 CAGAAGATACACAGGAAAGAGGG - Intronic
1179333490 21:40428026-40428048 GTGAGGACAGACAAGAAAGATGG - Intronic
1180030835 21:45206155-45206177 CAGAAGACAGAGAGCAAAGAGGG - Intronic
1180888485 22:19266813-19266835 CAGTAGACACAGAAAATAGAAGG + Intronic
1180907738 22:19426747-19426769 CTGAAGAGTCAGAAGAAAACTGG - Intronic
1181119809 22:20658180-20658202 AGGAAGACAGAAAAGAAAGATGG + Intergenic
1181411996 22:22730637-22730659 GTGAGGACACAGTACAAAGATGG + Intergenic
1181419036 22:22784966-22784988 GTGAGGACACAGTAAAAAGATGG + Intronic
1182100164 22:27651898-27651920 CTGAAGACCCACTAGAAAGAGGG - Intergenic
1182129037 22:27837255-27837277 AGAAAGAGACAGAAGAAAGAAGG + Intergenic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182942043 22:34286215-34286237 CTGAAGACACAGCCAAAAGCAGG - Intergenic
1183025348 22:35061536-35061558 GGGATGACAGAGAAGAAAGATGG + Intergenic
1183130853 22:35834528-35834550 GTGAAGACAAAGCAGAATGAAGG + Intronic
1183336994 22:37255071-37255093 CTGCAGACAAAGAATACAGACGG + Intergenic
1183590557 22:38777111-38777133 CTGAAGACAGAGAAGTTAGGAGG + Intronic
1184120548 22:42447002-42447024 GAGGAGACACAGAGGAAAGAGGG + Intergenic
1185370144 22:50457112-50457134 CTGAGGGCACAGCAGAGAGAAGG + Intronic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
950138935 3:10601886-10601908 ATGAAGACAAATAAGAAAGAGGG - Intronic
950348681 3:12324879-12324901 CTGAGGACACAGTAGAGAGCAGG - Intronic
950890830 3:16402288-16402310 CTGAAGACACAACAGTAAGCAGG + Intronic
951127603 3:19002127-19002149 CTGAAGGCACAGAAGCAAAAAGG - Intergenic
951318762 3:21219651-21219673 CTGAAGACACAGCATAAGTATGG - Intergenic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952483814 3:33789332-33789354 CTTAAGACAAAGAACAAAGAGGG + Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952961514 3:38594035-38594057 GAGAAGACATAGAAGAAAGAAGG - Intronic
953321377 3:41975219-41975241 CTGAAGACAAGGAAGAAAGAGGG - Intergenic
953896584 3:46807845-46807867 CTGATGAGGAAGAAGAAAGAAGG + Intronic
954962579 3:54579330-54579352 AGGAAGACACAGCAGGAAGACGG - Intronic
954966234 3:54613593-54613615 CTTAAGACTCAGAGGTAAGATGG - Intronic
955562195 3:60203905-60203927 GTGAAGACAGAGTAGAAGGATGG + Intronic
955659774 3:61285590-61285612 GAGAAGACAGAGCAGAAAGATGG + Intergenic
956095210 3:65708809-65708831 AAGAAGAAAAAGAAGAAAGAAGG - Intronic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
956669173 3:71670466-71670488 CTAAAGACACGGAAGAAAGTTGG - Intergenic
957181516 3:76884924-76884946 ATGAAGACACAGAGGAGAGATGG + Intronic
957339910 3:78882666-78882688 CTGGAGGCAAAGGAGAAAGATGG - Intronic
957540119 3:81557444-81557466 ATGAGGATAAAGAAGAAAGAAGG + Intronic
957588367 3:82161833-82161855 GGGAGGACACAGCAGAAAGATGG - Intergenic
958061689 3:88491587-88491609 TTGTAGAGACAGGAGAAAGAAGG - Intergenic
958106364 3:89078883-89078905 CTGATGACACACAAGGCAGAGGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959175224 3:102900755-102900777 CTAAAGTCACAGATGAAAAAAGG - Intergenic
959393962 3:105812672-105812694 ATGAAGATACAAAAGTAAGAAGG + Intronic
959405652 3:105959229-105959251 AGGAACAAACAGAAGAAAGAAGG - Intergenic
959568008 3:107852512-107852534 GGGAGGACACAGCAGAAAGACGG + Intergenic
959908145 3:111732880-111732902 CAGAAGAGATAGAAGACAGAAGG - Intronic
959909241 3:111745039-111745061 CTCATAACAGAGAAGAAAGAAGG + Intronic
960182278 3:114594668-114594690 CTGAATCCACAGCAAAAAGAGGG + Intronic
960228472 3:115195670-115195692 CTGATGAAACAGAAGAGAGAAGG + Intergenic
961071722 3:123936038-123936060 CTGCAGATACAGAAGATAAAGGG - Intronic
962045149 3:131750976-131750998 CAAAAGACATAGAAGAAAGAAGG - Intronic
962751325 3:138436327-138436349 ATTAGGACACAGAAGGAAGACGG - Intronic
963472824 3:145764085-145764107 CTGGAGACACATCAGAAATAAGG + Intergenic
964088272 3:152844750-152844772 ATGTAGACAGAGAAGAAAAAAGG + Intergenic
964191361 3:154005042-154005064 TTAAAGTCACAGAAGAAAAAGGG + Intergenic
964203409 3:154143814-154143836 CTAATGACACAGAAGTAACAAGG - Intronic
964650738 3:159008670-159008692 CTGTACACACTGAAGAAAGCTGG + Intronic
965777211 3:172243672-172243694 GTGAAGACACCAAAGGAAGATGG - Intronic
965892051 3:173526771-173526793 ATGAAGACAGAGTAGAAGGATGG - Intronic
966008459 3:175047012-175047034 CTGAGGACACAGTAAGAAGATGG - Intronic
966087395 3:176085136-176085158 GTGAGGACACAGCAAAAAGATGG - Intergenic
966431455 3:179834991-179835013 ACGAAGACATAGAAGGAAGATGG + Intronic
966678534 3:182615911-182615933 CTGGAGACAGAGAAGAAGTAAGG + Intergenic
966755381 3:183366103-183366125 TTGAAGGCCCAGGAGAAAGAAGG + Intronic
966904495 3:184512313-184512335 CTGAAGCCACAGGAGAGAGGAGG + Intronic
966916111 3:184584823-184584845 AGGAAGAGACAGAAGAGAGAGGG + Intronic
967277617 3:187791885-187791907 CTGACTACACAGAATAAATATGG - Intergenic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
967910020 3:194534998-194535020 CTGAAGACCCTGTAGAAATAGGG - Intergenic
969635508 4:8367105-8367127 GTGAAGACAAAGAAATAAGAAGG + Intronic
970291121 4:14573375-14573397 GTGAAGACACAGGAGGAAGATGG + Intergenic
970778988 4:19712698-19712720 TTGAAGAGAGAAAAGAAAGATGG - Intergenic
970892380 4:21061919-21061941 GTGAAGACACAGCAGGCAGATGG + Intronic
971243311 4:24907953-24907975 GTGAAGACACAGACGGAAGAAGG - Intronic
971303686 4:25462585-25462607 ATGAAGACACAGCAAAAAGATGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971849075 4:31960107-31960129 AAGAAGAGAAAGAAGAAAGAAGG - Intergenic
972033508 4:34492686-34492708 CAGAAGACAAAGGAGAAACAAGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972847701 4:43009639-43009661 GTGATGACACAGGAAAAAGATGG - Intronic
972973407 4:44604841-44604863 ATGAGGACACAGAGAAAAGATGG - Intergenic
973196293 4:47446044-47446066 CTGATGCCACAGAAATAAGAAGG + Intergenic
973557135 4:52094947-52094969 AGGCAGACACAGAAGACAGATGG - Exonic
973646669 4:52957038-52957060 CTGAAGGCACACAAGAGAGGAGG + Intronic
973736306 4:53874914-53874936 CTAAAGTCAAAGAAAAAAGAAGG + Intronic
974207341 4:58723096-58723118 CTCAATACACAAAAGAAACAAGG + Intergenic
974329668 4:60461696-60461718 TGGGAGCCACAGAAGAAAGATGG + Intergenic
974352016 4:60760670-60760692 GAGAAGAAAAAGAAGAAAGATGG + Intergenic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
974525411 4:63043953-63043975 AAGAAGACAAAGAAGAAATATGG - Intergenic
974637912 4:64589601-64589623 CAGAAGACTCAGAAGAAAACAGG + Intergenic
975224054 4:71849045-71849067 CTGAAGAGACAGAAGGGAGTGGG - Intergenic
975271388 4:72438084-72438106 CTGCACACACAGAGTAAAGATGG - Intronic
975664883 4:76725842-76725864 CTGAAGACACAGGACACAGGAGG - Intronic
975947657 4:79727077-79727099 TGGAAAACAGAGAAGAAAGAGGG + Intergenic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976920863 4:90441418-90441440 ATGAAGACACAGCAAAAAGGTGG - Intronic
977194833 4:94045569-94045591 CACAAGCAACAGAAGAAAGATGG + Intergenic
977651194 4:99471509-99471531 CTCAAGGCACAAAAGAAAGGGGG - Intergenic
978035498 4:103987664-103987686 TTGAAGTCACAGAAGAAAACAGG - Intergenic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978204462 4:106063803-106063825 ATGAAGACACAGCATAAAGATGG + Intronic
978524521 4:109652094-109652116 ATGTACACCCAGAAGAAAGACGG - Intronic
978589020 4:110304047-110304069 CTAAATACCAAGAAGAAAGATGG + Intergenic
978690862 4:111507607-111507629 CTGATGACCCAGAAGTAGGAGGG + Intergenic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
979565265 4:122147593-122147615 GTGAAGACACAGGAAGAAGATGG + Intergenic
979862853 4:125715923-125715945 GTGAAGACACAGTAAAAAGATGG + Intergenic
979928375 4:126596610-126596632 TTGTAGACACAGAAGAGAGATGG + Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
980436117 4:132776288-132776310 CTGAATACATGGAAGAAATAAGG + Intergenic
980552087 4:134351700-134351722 CTGATAACACAGAAGTTAGAAGG + Intergenic
980814859 4:137931808-137931830 CTGCAGACACATAAGAAACTGGG - Intergenic
981156119 4:141438353-141438375 TAGAAGACACAGAGGGAAGAAGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981444434 4:144819309-144819331 GTGAAGACACAGGAAGAAGACGG - Intergenic
981518029 4:145631710-145631732 ATGAAGACAGGAAAGAAAGAAGG - Intronic
981888496 4:149708097-149708119 GTGAAGATAAAGAAGAAAGGTGG - Intergenic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982618476 4:157673738-157673760 TTGAAGACACAGAAGATACAAGG + Intergenic
982968865 4:161953057-161953079 CTGAAGGCCCTGAAGATAGATGG + Intronic
982969572 4:161966629-161966651 GTGAAGACACAGAGAAAACATGG + Intronic
983112580 4:163771502-163771524 GTGAAGATACAGCAAAAAGATGG - Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
983731477 4:170999263-170999285 AGGAAGACAGAGAAGAAAGCAGG + Intergenic
984198275 4:176686479-176686501 TTCAAGTTACAGAAGAAAGAAGG + Intronic
985729017 5:1536112-1536134 CTCAATATAAAGAAGAAAGAGGG - Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
986716223 5:10525789-10525811 ATGAAGACAGAAAAGAAAGTGGG - Intergenic
986910376 5:12548563-12548585 GTGAAGACAAATAAGAAAGAAGG + Intergenic
986936626 5:12896142-12896164 ATAAAGACACAGAAGAAAGAAGG + Intergenic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
987774078 5:22342041-22342063 GTGAGGACACAGCAGCAAGAGGG - Intronic
987813259 5:22867250-22867272 TTGTAGACACAGAACAAAGTTGG + Intergenic
987867004 5:23555130-23555152 CTGAAGAGACTGAAGAAAAGTGG - Intergenic
987910085 5:24131421-24131443 CTGAAGATACAAAATAAATATGG - Intronic
988117673 5:26918827-26918849 CTGAAGACCCAGGAGAACCATGG - Intronic
988123036 5:26992413-26992435 GTGAAGACACAGCAGAACAATGG + Intronic
988308081 5:29519859-29519881 CTGAAAACTCAAAAGAAATAGGG - Intergenic
988671131 5:33383127-33383149 TTGAAGAAACAGCAGAAAAAAGG + Intergenic
988708045 5:33744715-33744737 TTGAGGACACAGATTAAAGAAGG + Intronic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
988785112 5:34559679-34559701 CTGAAGACACAGGCAAAAGATGG - Intergenic
988832610 5:35002615-35002637 GTGAGGTCACAGCAGAAAGATGG + Intronic
988901373 5:35736244-35736266 ATTAAGAAAAAGAAGAAAGATGG + Intronic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989228493 5:39058973-39058995 CTGAAGACACAGAAGAGAAATGG + Intronic
989518617 5:42374510-42374532 CTGAAGACACAGAAATCAAATGG + Intergenic
989664497 5:43838040-43838062 GTGAGGACACAGCAAAAAGATGG + Intergenic
989799640 5:45521538-45521560 ACAAAGACACAGATGAAAGAAGG - Intronic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990871842 5:60440561-60440583 CTAAAGACACAGGAGAGATAGGG + Intronic
991335884 5:65546735-65546757 GTGAAGACACAGGAAGAAGATGG + Intronic
991441663 5:66656719-66656741 GTCAAGACACAGCAGAAAGCAGG - Intronic
991659609 5:68936917-68936939 CAGAAGACCCAGAGGAAAGCAGG + Intergenic
992098744 5:73385505-73385527 AGGATGACAGAGAAGAAAGATGG + Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992522013 5:77563693-77563715 CTGCAGACACTGGAGAAACATGG + Intronic
992695053 5:79277791-79277813 CCTAAAACACAGAAGCAAGAGGG - Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
992883806 5:81137671-81137693 GTGAAGACACAGGAAGAAGACGG + Intronic
993003878 5:82410566-82410588 GTGAAGACACAGAACGAAGATGG + Intergenic
993054072 5:82960413-82960435 CTGAAGACAAAGAACCAAGCTGG + Intergenic
993140443 5:84026396-84026418 ATGAAGATAAAAAAGAAAGATGG - Intronic
993224451 5:85149359-85149381 CTGAAGAAACTGAAGAGAGACGG - Intergenic
993313007 5:86360826-86360848 GTCAAGACAAAGAAGAAATAAGG - Intergenic
993367620 5:87052484-87052506 CTGAGCAAACAGAACAAAGAAGG + Intergenic
993574570 5:89585956-89585978 GTGAGGACACAGCAAAAAGATGG - Intergenic
995290770 5:110450079-110450101 CAGGAGACAGAGAGGAAAGAGGG - Intronic
995771131 5:115671652-115671674 ATGAAGACAGAGTAGAAGGATGG + Intergenic
995865090 5:116681840-116681862 CTGAAAACACCGAAGAAACGAGG - Intergenic
995865819 5:116689390-116689412 TTGAATACACAGAAAAAAAAAGG - Intergenic
995913427 5:117214922-117214944 CTGAAGAAACAGCCAAAAGAAGG - Intergenic
996304841 5:122035281-122035303 CTGGACACTCAGGAGAAAGATGG - Intronic
996343750 5:122467580-122467602 AAGAAGAAAAAGAAGAAAGAAGG + Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
996849487 5:127936570-127936592 TTTAAGTCATAGAAGAAAGAGGG + Intergenic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997497347 5:134340307-134340329 CTTAAGACACTGGAAAAAGAAGG + Intronic
997662620 5:135601095-135601117 CAGAAGACACTGAAGAGTGAAGG + Intergenic
998005624 5:138655054-138655076 GAGAAGAGAAAGAAGAAAGAGGG + Intronic
998048944 5:139014941-139014963 CTGAAGGCCCAGAAAATAGAAGG - Intronic
998653506 5:144148123-144148145 CTTATAACACAAAAGAAAGAGGG + Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
999031494 5:148297948-148297970 GTGAGGCCACAGAAGATAGAGGG - Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999384255 5:151143114-151143136 CAGAAGACCCAGAACAGAGAGGG + Intronic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000487639 5:161868087-161868109 CAGAACACAGATAAGAAAGAGGG - Intronic
1000799029 5:165701257-165701279 GTGAAGACATAGAAGGAAGGTGG + Intergenic
1000865535 5:166509658-166509680 CTGAAGAAGGACAAGAAAGAGGG + Intergenic
1001168953 5:169398844-169398866 CTGAAGACCCAGAAGAAATAGGG + Intergenic
1001243218 5:170086024-170086046 CTGAAAGCCTAGAAGAAAGAAGG - Intergenic
1001675456 5:173509381-173509403 CTGAAGAGAAAGAACAAAGCTGG - Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1002721279 5:181262553-181262575 CTGCAGAGACAGAAGACAGAAGG - Intergenic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1003369577 6:5511051-5511073 CTCAAGACACAGGAGGGAGAAGG + Intronic
1003418877 6:5938206-5938228 CTGAAGACACCTGAGAAGGAAGG + Intergenic
1004422521 6:15484435-15484457 CTGCAGACAGAGTATAAAGAAGG - Intronic
1004741389 6:18464634-18464656 GTGAAGACACAGCAAAAAAATGG - Intronic
1005121671 6:22396859-22396881 GTAAAGACACAGAGAAAAGATGG + Intergenic
1005213306 6:23495163-23495185 ATAAAGACACGGAGGAAAGAAGG - Intergenic
1005368517 6:25105167-25105189 GTGAAGAGACAGAGTAAAGATGG + Intergenic
1005376567 6:25188462-25188484 ATGGAGGCACAGTAGAAAGATGG - Intergenic
1005514022 6:26537642-26537664 TGGAAGACTCAGAAGCAAGAGGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006422564 6:33944598-33944620 TGGAAGACAGAGAAGATAGATGG - Intergenic
1007112964 6:39324064-39324086 CTGAAGACCCATAAGACAGTGGG + Intergenic
1007384551 6:41511906-41511928 TTGAAGACACAGAGAATAGAGGG + Intergenic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1007602797 6:43093770-43093792 ATGAAGCAACAGAAGAACGAAGG + Intronic
1007791257 6:44310018-44310040 CAGAAGACACAGCAGTAAGCAGG - Intronic
1007985043 6:46198936-46198958 TTTGAGACACAGAAGAGAGAAGG + Intergenic
1008320267 6:50103665-50103687 CTGAAGTCCCAACAGAAAGAGGG + Intergenic
1008451288 6:51653668-51653690 ATAAAGACACAGAATAAACACGG + Intronic
1008596310 6:53045309-53045331 TTGAAGATAAAGAAGAAAAAGGG - Intronic
1008869203 6:56252065-56252087 AAGAAGAGAAAGAAGAAAGAAGG - Intronic
1009041611 6:58186414-58186436 CTGAAAACACAGAGGATAGCTGG - Intergenic
1009217463 6:60940731-60940753 CTGAAAACACAGAGGATAGCTGG - Intergenic
1009288336 6:61851583-61851605 CTAAGGACACAGCAGGAAGATGG + Intronic
1009323345 6:62318304-62318326 GTGAGGACACAGCAGGAAGATGG + Intergenic
1009371719 6:62912307-62912329 ATGAAGACAGAGAATAGAGAAGG + Intergenic
1009440934 6:63677284-63677306 GTGTAGATAAAGAAGAAAGATGG + Intronic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1009858939 6:69299823-69299845 CTGAACAAAAAGAAGAAAGCTGG - Intronic
1010080011 6:71850039-71850061 GTGAAGAAACAAAAGAAATATGG + Intergenic
1010773330 6:79857781-79857803 CTGAAGACTCTGAAAAAAAAAGG + Intergenic
1010803229 6:80202301-80202323 CTGAAGATGCAGGAGAGAGATGG - Intronic
1010846535 6:80716046-80716068 TGGAAGACACAGAACATAGAAGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011610718 6:89147464-89147486 CTCCAGAGACAGAAAAAAGAAGG - Intronic
1011613470 6:89176552-89176574 GTGAAGACACAGTGGGAAGATGG + Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012655697 6:101816920-101816942 GTCAAGACACAGTAGAAAGGAGG - Intronic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1013318204 6:108961215-108961237 CTGAAGACCCAGAAAACAGGCGG + Intronic
1013505260 6:110793843-110793865 CTGAACAGACAGAGGAAAGGAGG + Intronic
1013822150 6:114167373-114167395 CTGTAGACACAGTAGTAAGTAGG + Intronic
1013991194 6:116255563-116255585 ATTAAGACAAAGAGGAAAGAGGG - Intronic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014098657 6:117485864-117485886 ATGAAAATACAGCAGAAAGAAGG + Intronic
1014141692 6:117950830-117950852 GTTAAGGCACAGAAGAAAGCAGG + Intronic
1014591695 6:123280370-123280392 CCGAAGACAAAGAACAAAGTTGG - Intronic
1014675294 6:124357016-124357038 CTGCAGGCACAGAATAAAGCTGG + Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014736671 6:125101967-125101989 CTGAAGACATAAAGAAAAGATGG + Intergenic
1015370853 6:132450822-132450844 CTCAAAAGAAAGAAGAAAGAAGG + Exonic
1015500361 6:133926153-133926175 CAGAAGACCCAGTAGAAAAATGG - Intergenic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1015719710 6:136228448-136228470 GTGAAGACACAGCAAGAAGATGG + Intergenic
1015782168 6:136879937-136879959 CTGAAGAAACACAAGAAAAAAGG - Intronic
1016029679 6:139324452-139324474 GAGAAGACACAGAATAAACAAGG - Intergenic
1016087751 6:139935791-139935813 CTGAAGGCACTGAAGGAAGGAGG - Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016541223 6:145167941-145167963 CTGATGAAAAGGAAGAAAGACGG + Intergenic
1016774411 6:147889386-147889408 CTGAACACACAAAAGACAGTTGG + Intergenic
1016852634 6:148636561-148636583 GTGAAGACACAGGGGGAAGATGG + Intergenic
1017998076 6:159551545-159551567 ACAAAGACACAAAAGAAAGAAGG - Intergenic
1018053034 6:160028217-160028239 GTGAAGACACAGAAAGAAAACGG - Intronic
1018272484 6:162095089-162095111 CTGAAGACCCAGTAGAAAGATGG - Intronic
1018322631 6:162628193-162628215 ATGAAGACGCAGAGGAAACAAGG + Intronic
1018573202 6:165232236-165232258 CTGGAGACTGAGATGAAAGAGGG - Intergenic
1018795746 6:167184376-167184398 CTGAACACCCAGAGGAAAGGGGG - Intronic
1018820569 6:167370688-167370710 CTGAACACCCAGAGGAAAGGGGG + Intronic
1020187509 7:5970425-5970447 CCGTAGACACAGGAGAGAGATGG - Intronic
1020295407 7:6754345-6754367 CCGTAGACACAGGAGAGAGATGG + Intronic
1020864077 7:13534026-13534048 ATGAAAACACCAAAGAAAGAGGG - Intergenic
1020898884 7:13977356-13977378 CCAAAGAGAAAGAAGAAAGAAGG + Intronic
1021450986 7:20784130-20784152 GTTAAGTCACAGAAGGAAGAAGG + Intronic
1021662236 7:22931169-22931191 ATGAAGACACACAGGAAAGAAGG + Intergenic
1021808954 7:24384026-24384048 GTGAGGACACAGCAAAAAGATGG + Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1022517280 7:30984048-30984070 CTGAAGAGACAGGAGAATCAGGG + Intronic
1022534291 7:31086165-31086187 CTGCACACACAGGACAAAGACGG - Intronic
1022540103 7:31127378-31127400 CTGCAAACAAAGGAGAAAGAGGG + Intergenic
1023467676 7:40475120-40475142 ATGAAGGCACAGGAGAAATACGG - Intronic
1023977604 7:45042340-45042362 CTGAAAAGAGAGGAGAAAGAGGG + Intronic
1024114214 7:46177109-46177131 TTGAAGATATAGTAGAAAGAAGG - Intergenic
1024140129 7:46454662-46454684 TAGAAGGCAGAGAAGAAAGAAGG - Intergenic
1024207249 7:47174411-47174433 CAGAAGACAGAGAATAGAGATGG + Intergenic
1024782889 7:52872731-52872753 CTGAACAAAAAGGAGAAAGATGG + Intergenic
1024846276 7:53646453-53646475 TTAAAGAAAAAGAAGAAAGATGG - Intergenic
1024962624 7:54993727-54993749 CTGGAGAGACAGAAGAATGTGGG - Intergenic
1025288500 7:57689189-57689211 CCGAAGAGACAGAAGAAGGCAGG - Intergenic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1026079724 7:67206991-67207013 ATAAATGCACAGAAGAAAGAAGG - Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026336666 7:69399542-69399564 CTGGAGGGACAGAAGACAGAGGG - Intergenic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1027421867 7:78024678-78024700 CTGAAGACACAATTGAAAGAGGG + Intronic
1028100125 7:86808872-86808894 TGGAAGAGACAGAAGAAATAAGG + Intronic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1028215374 7:88125802-88125824 CTGAAGAAGCAGTAGAAAGGGGG + Intronic
1028266412 7:88732201-88732223 CAGAAGACACAAAAGAAAAAAGG - Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028650791 7:93148899-93148921 GTGAAGACACAAAGAAAAGATGG + Intergenic
1028838180 7:95397034-95397056 CTCAAGACCTAGAAGAAAGAGGG - Intergenic
1028848317 7:95508139-95508161 TTGAAGACAAAGAAGACAGTAGG + Intronic
1029132865 7:98346775-98346797 CTGAAGACACAGAAATGAAATGG + Intronic
1029818533 7:103122422-103122444 CGGTAGACACAGACAAAAGAGGG + Intronic
1029839459 7:103346647-103346669 CTAAAGACAAAGTAGAAGGATGG - Intronic
1029912617 7:104170813-104170835 CTGAAGACAGAAAAGAACAATGG - Intronic
1030155430 7:106449593-106449615 GTTAAGACAGAGATGAAAGATGG - Intergenic
1030205769 7:106951236-106951258 CGTAAGAAACAGAAGTAAGATGG + Intergenic
1030294866 7:107913236-107913258 CTGAATAAAAAGAAGAAAGCTGG - Intronic
1030389467 7:108908192-108908214 CTGAAAACACAGTAGAAAAATGG - Intergenic
1030716379 7:112812614-112812636 CTGAAGACACAGGACAGAAAAGG + Intergenic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1031313319 7:120227160-120227182 GGGAAGACACAGAGGGAAGATGG - Intergenic
1031697448 7:124875754-124875776 CTGAAAACAGAGAGGAAATATGG + Intronic
1031754549 7:125621863-125621885 TAGAAGAGACAGAAGAAAGTTGG + Intergenic
1033021445 7:137729050-137729072 CTTAAAACACACAAAAAAGATGG + Intronic
1033881548 7:145890200-145890222 TTGCAGACACAGAAGAAACCTGG - Intergenic
1034035901 7:147821703-147821725 CTGAAGAGAAACAGGAAAGAAGG + Intronic
1034271935 7:149807388-149807410 GTGAAGAAAAAGAAAAAAGAGGG - Intergenic
1034590250 7:152132312-152132334 CTGAGGACACAGGAGCAAGCAGG + Intergenic
1035251336 7:157599433-157599455 CTGAATACACAGTGTAAAGATGG + Intronic
1036118605 8:5989028-5989050 CTGAAGAAACCCAAGAAAGGAGG - Intergenic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1037035421 8:14160714-14160736 GTGAGGACACAGAAGTAAAATGG - Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037552265 8:19986017-19986039 GTGAAGAAACAGAAGAAAGTTGG + Intergenic
1037744974 8:21635931-21635953 CTGAAGTCACTGAAAAAACAGGG + Intergenic
1037926655 8:22848738-22848760 CTGAAAACACAGCAGAAGAAAGG - Intronic
1038116993 8:24567977-24567999 CTGTAGACAAAGAAGCCAGAGGG - Intergenic
1038134068 8:24766884-24766906 ATGAAGACACAGGAGCAAGCTGG + Intergenic
1038286840 8:26212819-26212841 CTGAGGACACAGTAAGAAGACGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038535964 8:28352930-28352952 CTGCAGAAACACAGGAAAGAAGG + Intronic
1038660810 8:29495078-29495100 CTGATAACACAGTTGAAAGAAGG + Intergenic
1039006526 8:33044229-33044251 CTAAAGACAAAGAAAAAATACGG + Intergenic
1039092400 8:33846175-33846197 CTGAAGCCACAGAGAAAAAAGGG + Intergenic
1039800409 8:40949802-40949824 GTGAAGACACAGAAAGAAGGTGG + Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040601100 8:48884561-48884583 ATGAAGATACATAAGAAACAGGG + Intergenic
1040761280 8:50848342-50848364 TTCAAAACACAGAAGATAGATGG - Intergenic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1040967277 8:53096158-53096180 CCGATGACACAGAAGTAAAAAGG + Intergenic
1041301278 8:56414438-56414460 CCGAAGGCAGAGAGGAAAGATGG + Intergenic
1041357498 8:57015600-57015622 CTGACAACACATAAGGAAGATGG + Intergenic
1042289844 8:67158499-67158521 CAGAAGAAAAAGAAGAAAGACGG + Exonic
1043187637 8:77174608-77174630 CAGAAGGCACAAAAGAAAGTTGG - Intergenic
1043519954 8:81034380-81034402 CTGAAGACAGAGAAGAGAGTAGG + Intronic
1043649771 8:82576868-82576890 GTGAAGACTCAGAAAAAAAAGGG - Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044530921 8:93306647-93306669 CAGAAGACATAGAAGAGTGAAGG - Intergenic
1044566993 8:93675254-93675276 CTGACGACACAGTAACAAGAAGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044751095 8:95416036-95416058 CTGCTGAAAGAGAAGAAAGAAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044927457 8:97221716-97221738 TTGAAGACACACAATGAAGAAGG + Intergenic
1044937338 8:97305831-97305853 GTGAAGACACAGCAAGAAGATGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045660550 8:104433063-104433085 GTGAAGACACAGGAAGAAGATGG + Intronic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046177499 8:110597399-110597421 CAAAAGATACAAAAGAAAGAAGG + Intergenic
1046179835 8:110630245-110630267 TAGAAGACACAGAAGAGATAGGG + Intergenic
1046796960 8:118383990-118384012 CTGAAGAAAAAGCAGAATGAAGG + Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047158367 8:122348072-122348094 CAGAAGAGAAAGAAGAAAGGAGG + Intergenic
1047577039 8:126167766-126167788 TCGAAGACATAGAAGAGAGATGG + Intergenic
1047620114 8:126597620-126597642 GAGAAGTCAAAGAAGAAAGATGG - Intergenic
1048075142 8:131061831-131061853 GGGAAGACAGAGAAGGAAGAAGG - Intergenic
1048361330 8:133699627-133699649 ATGAAGACACACATGAAAGACGG + Intergenic
1048473423 8:134722957-134722979 CAGAAGACACAGAGAAAAGGTGG + Intergenic
1048570195 8:135646540-135646562 GTGAAGACAAAGAAGAAAACCGG - Intronic
1048823745 8:138402977-138402999 GTGAGGACACAGCAAAAAGACGG + Intronic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049807299 8:144546826-144546848 CTCCAGACACAGAACAGAGAAGG - Intronic
1050084147 9:1947014-1947036 CTGATGACAGTGAAGAAAGGAGG - Intergenic
1050185235 9:2966000-2966022 GGGAAGACACAGAGAAAAGAAGG + Intergenic
1050723371 9:8617229-8617251 AGGAAGAGAGAGAAGAAAGATGG + Intronic
1051249218 9:15142384-15142406 ATTAAGGCAAAGAAGAAAGAAGG + Intergenic
1051739463 9:20237532-20237554 CTGAAGACACAGACTAGAGAAGG + Intergenic
1051740627 9:20248487-20248509 GTGAGGACACAGCAGGAAGATGG - Intergenic
1051752281 9:20355401-20355423 CTTAAAACACAGAAGATAGTCGG - Intronic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1052327146 9:27227578-27227600 GTGAGGACACAGCAGAAAGATGG - Intronic
1052566714 9:30162356-30162378 CTCAAGATGCAGAAGAAATATGG + Intergenic
1052668143 9:31520282-31520304 TTGAAGAGAAAGAAGAAAAACGG + Intergenic
1053371805 9:37567850-37567872 CTGAGGACGCAGAAGAGGGAAGG - Intronic
1054741961 9:68815318-68815340 TTTAAGAATCAGAAGAAAGAAGG + Intronic
1054777925 9:69139465-69139487 GTGAAGACATAGAGAAAAGATGG + Intronic
1055145921 9:72934556-72934578 CTACAGACACAAAAGTAAGAAGG - Intronic
1055483779 9:76736581-76736603 GTGAGGACACAGCAAAAAGATGG - Intronic
1055501973 9:76910139-76910161 GTGAGGACACAGGAGAAACATGG + Intergenic
1055640957 9:78318639-78318661 GGGAAGACACGGCAGAAAGAAGG - Intronic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1057151650 9:92801202-92801224 GTGAAGACACAGGGGGAAGATGG - Intergenic
1057461049 9:95262345-95262367 CTGAAGAAAGATAACAAAGAGGG + Intronic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1058299562 9:103355193-103355215 AAGAAGAAACAGAAGAAACACGG - Intergenic
1058892316 9:109371481-109371503 TTGAGGACACAGCAGGAAGATGG + Intergenic
1059535227 9:115074386-115074408 GTGAGGACACAGTAAAAAGATGG + Intronic
1060166525 9:121421712-121421734 CAGAAGAGACAAAAGAAAAAAGG - Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060439844 9:123628220-123628242 CTGAAGCCACTGAAGACAGCAGG + Intronic
1060824900 9:126682363-126682385 GTGAAGACAGGGAAGAGAGATGG - Intronic
1060835126 9:126750010-126750032 CTAAAGTCACAGCAGGAAGAAGG - Intergenic
1061302028 9:129710892-129710914 GTGAAGACAGAAAAGAAGGAAGG - Intronic
1061338579 9:129960617-129960639 ATGAGGTCAGAGAAGAAAGAGGG + Intronic
1061372966 9:130208163-130208185 ATGTAGGCAGAGAAGAAAGATGG + Intronic
1061869644 9:133513853-133513875 CTGAGGACACAGGACAGAGATGG + Intergenic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1203612776 Un_KI270749v1:25354-25376 CTGACGAAACAGGGGAAAGATGG - Intergenic
1185689146 X:2138937-2138959 GTGAAGATACAGTAGGAAGAAGG + Intergenic
1186040539 X:5472803-5472825 CTAAACACAAAGAAGAAAGCTGG + Intergenic
1186080804 X:5929806-5929828 ATGAAGACCCAAAAGAAACAGGG + Intronic
1186123198 X:6384801-6384823 GTGAAATCACAGGAGAAAGAGGG - Intergenic
1186233857 X:7485726-7485748 CTGAAGCCACTGAAGAAACAGGG - Intergenic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1187178576 X:16919770-16919792 CAGAAGGCAGAGAGGAAAGATGG + Intergenic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187746978 X:22419927-22419949 GCCAACACACAGAAGAAAGAGGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188548320 X:31334826-31334848 CTGAAGCCAAGGAAGAAAGATGG - Intronic
1188573345 X:31616364-31616386 CGAAAGACACAGAAGTAAGCTGG + Intronic
1188649085 X:32608745-32608767 CTGAAAACACAAAAGAAATCTGG + Intronic
1189203767 X:39220193-39220215 ACGCAGACTCAGAAGAAAGATGG - Intergenic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189793963 X:44629678-44629700 GTGAAGACACAGCAAAGAGATGG + Intergenic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190393950 X:49960726-49960748 CTGAAGATACAAGAGAGAGAAGG - Intronic
1190718748 X:53129010-53129032 CTGAGGTAAAAGAAGAAAGATGG - Intergenic
1190827034 X:54027138-54027160 TTGAAGATACTGCAGAAAGAAGG - Intronic
1192272063 X:69590309-69590331 GAGAAGACAAAGAGGAAAGATGG + Intergenic
1192908276 X:75576225-75576247 AGGAAGACACAAAGGAAAGAAGG - Intergenic
1193183116 X:78482160-78482182 GTGAAGAAAGAGAAGAAATAAGG - Intergenic
1193397402 X:81001926-81001948 TTGAAGGCAGAGAAGGAAGAGGG - Intergenic
1193455462 X:81726153-81726175 CAGAAGAGACAAAAGAAAAAAGG + Intergenic
1193533057 X:82679439-82679461 CTGAGGACACAGCAAAAAGATGG + Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194438732 X:93902094-93902116 CAGAAGGCAAAGAAGAAACAAGG - Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1195286611 X:103391447-103391469 CTGAAGCCACAGAAATAAAAAGG + Intergenic
1195480277 X:105337120-105337142 TTGAAGATACAGCAGAAACATGG - Intronic
1195614342 X:106900909-106900931 CTGTGGACAGAGAAGAAACATGG + Intronic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1195712925 X:107789306-107789328 TTGAAGACACAGATGAGAGGAGG - Intronic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1196046559 X:111261829-111261851 TTGAAGACACAGAAGAGAAAAGG - Intronic
1196457299 X:115899560-115899582 CTCAAGACAGAGGAAAAAGAAGG + Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196779289 X:119368198-119368220 CTGAAGATACAGTAAAAATACGG - Intergenic
1197160781 X:123319706-123319728 ATAAAGACACAGAGGCAAGAAGG - Intronic
1197340849 X:125265176-125265198 GTGAAGACACACAGAAAAGATGG - Intergenic
1197470145 X:126857054-126857076 CAGAGGACACAAAAGAAAAAAGG + Intergenic
1197520179 X:127487806-127487828 AGGAAGACAGAGAGGAAAGAAGG - Intergenic
1197868137 X:131039872-131039894 ATAAAGACTCAGGAGAAAGATGG + Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198682342 X:139196230-139196252 TTGAAGACACAGGTGAAACAAGG + Intronic
1199048090 X:143201668-143201690 AGGAAGACAGACAAGAAAGAAGG - Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199552318 X:149073818-149073840 CTCAAGAGACAGCAGATAGATGG - Intergenic
1200207152 X:154324727-154324749 GTGAAGACACTGAATAAAGATGG + Intronic
1200366199 X:155667346-155667368 CTGAAGATACAGGACAAATAGGG + Intronic
1200422566 Y:2987145-2987167 CTGAAGTTACAAATGAAAGAAGG - Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1201275096 Y:12289150-12289172 CAGAAGACACTGGAGAGAGAAGG + Intergenic
1201650666 Y:16282339-16282361 GTGAGGAGACAGAAGAAAAATGG - Intergenic
1201691948 Y:16777190-16777212 GTGAGGAGACAGAAGAAAAAGGG - Intergenic
1201945982 Y:19510491-19510513 CTGAACAAACAGAACAAAAAAGG + Intergenic
1202031047 Y:20574707-20574729 CCAAAAACACAGAAGAAAAAGGG + Intergenic