ID: 1098581326

View in Genome Browser
Species Human (GRCh38)
Location 12:72102728-72102750
Sequence CCCCTGTGAAGATGAACATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098581324_1098581326 -3 Left 1098581324 12:72102708-72102730 CCTATAACTGTTAAAATATGCCC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1098581326 12:72102728-72102750 CCCCTGTGAAGATGAACATGAGG 0: 1
1: 0
2: 1
3: 21
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098581326 Original CRISPR CCCCTGTGAAGATGAACATG AGG Intronic
900912163 1:5606183-5606205 TCAATGTGAAGATGATCATGAGG - Intergenic
902460408 1:16571084-16571106 CACCTGTGAGTAAGAACATGCGG + Intronic
904808293 1:33146879-33146901 CCCCTGAGAAGATGGGGATGAGG + Exonic
906061291 1:42950530-42950552 CCCCTGAGAAGATACACATTTGG + Intronic
906461125 1:46035615-46035637 CCTCTGGGAAGCTGAGCATGTGG + Exonic
908148801 1:61277959-61277981 CACTAGTGAAGATGATCATGGGG - Intronic
911205540 1:95088614-95088636 CAGCTGTGATGATGAAGATGGGG + Intergenic
911563286 1:99432496-99432518 CTCCTGTGAAGAGGCACAGGAGG - Intergenic
913605007 1:120457495-120457517 CACCTGTGAGTAAGAACATGCGG - Intergenic
913641871 1:120820211-120820233 CACCTGTGAGTAAGAACATGCGG - Intronic
914083532 1:144431718-144431740 CACCTGTGAGTAAGAACATGCGG + Intronic
914189554 1:145396994-145397016 CACCTGTGAGTAAGAACATGCGG + Intronic
914211403 1:145582701-145582723 CACCTGTGAATAAGAACATGCGG + Intergenic
914276605 1:146130128-146130150 CACCTGTGAGTAAGAACATGCGG + Intronic
914366208 1:146981045-146981067 CACCTGTGAGTAAGAACATGCGG - Intronic
914486235 1:148112379-148112401 CACCTGTGAGTAAGAACATGCGG + Intronic
914537650 1:148581083-148581105 CACCTGTGAGTAAGAACATGCGG + Intronic
914586565 1:149067536-149067558 CACCTGTGAGTAAGAACATGCGG + Intronic
914628275 1:149484262-149484284 CACCTGTGAGTAAGAACATGCGG - Intergenic
917482289 1:175422766-175422788 TCTCAGTGAAGATGGACATGTGG - Intronic
918471917 1:184884086-184884108 CCCCGGTGAAGCAGAACATGGGG - Intronic
918827998 1:189352198-189352220 CTCCTGTGAATAGGAACAAGTGG + Intergenic
920430207 1:205914104-205914126 CTCCTATGAAGATGAAAATAGGG - Exonic
921021772 1:211242469-211242491 CACCTATGAATAAGAACATGCGG - Intergenic
922052800 1:222010253-222010275 CCCCTCTGAAAAAGTACATGTGG + Intergenic
923615513 1:235533941-235533963 TCAATGTGAAGATGAAGATGAGG + Intergenic
923835559 1:237607339-237607361 CACCTGTGAGTAAGAACATGCGG - Intronic
1063790066 10:9434526-9434548 CCTCTGTGAAGATGATGATATGG + Intergenic
1064133591 10:12731522-12731544 CACCAGTGCAGCTGAACATGAGG - Intronic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1066047532 10:31606364-31606386 TCACTGTGAAGATAAACATTTGG + Intergenic
1066566805 10:36729767-36729789 ACCCTCTGAGGATGAACAGGTGG + Intergenic
1068050272 10:51941679-51941701 CACCTATGAATAAGAACATGTGG + Intronic
1070685803 10:78479929-78479951 CCTCTTTAAAGATGAAGATGAGG + Intergenic
1071093975 10:81952037-81952059 CACCTGTGAGGGAGAACATGCGG - Intronic
1071261421 10:83922808-83922830 CTCTTGTGAAGAGGAACATCAGG + Intergenic
1074161437 10:110839799-110839821 TCCCTGTGAAGATGAATATCTGG + Intergenic
1074252892 10:111770533-111770555 CCCCTGTGAGTGAGAACATGTGG - Intergenic
1077200679 11:1305972-1305994 CCCCTGTGAGGAGTATCATGGGG - Intronic
1078088096 11:8246852-8246874 CCCCTGTGAGGCTGGCCATGGGG - Intronic
1078598519 11:12710761-12710783 CCGGTGTGAAGATGAAGAGGAGG + Intronic
1078691818 11:13588491-13588513 CACTTGTGAAGGAGAACATGTGG - Intergenic
1078942055 11:16017921-16017943 CCACTGTCAACATGAAGATGGGG - Intronic
1079568377 11:21911897-21911919 CCTCTGTGAAGTGGAAGATGAGG - Intergenic
1080376759 11:31722561-31722583 GCCCAGTGAAAATGAAAATGTGG + Intronic
1080897669 11:36459837-36459859 CCTCTCTGAAAATGAAGATGGGG - Intronic
1082297382 11:50458708-50458730 CACCTGTGAATGAGAACATGTGG + Intergenic
1084038686 11:66529359-66529381 TCCCTGTGGAGATGAGCAGGAGG + Intronic
1086640955 11:89155395-89155417 CACCTGTGAATGAGAACATGCGG - Intergenic
1087843843 11:102949022-102949044 TACCTCTGAAGATGAAGATGAGG + Exonic
1089355713 11:117851361-117851383 CCCCTGTGGAGAGGCCCATGTGG + Intronic
1090133864 11:124174638-124174660 ACTCTGTGAAGATGAAGATGAGG - Intergenic
1094402206 12:30074341-30074363 TACCTGTGAGGAAGAACATGTGG + Intergenic
1096278271 12:50229457-50229479 CACCTGTGAGTAAGAACATGCGG - Intronic
1098581326 12:72102728-72102750 CCCCTGTGAAGATGAACATGAGG + Intronic
1098863105 12:75732114-75732136 CACCTGTGATGGAGAACATGCGG - Intergenic
1099194985 12:79605413-79605435 CCCATGTTAAGATGATAATGAGG - Intronic
1099253023 12:80281437-80281459 CATCTGTTAAGATGATCATGTGG + Intronic
1103170714 12:118817101-118817123 ACCCTGTGCAGAGGCACATGTGG + Intergenic
1104754527 12:131260728-131260750 CCCCTGTGAAGCAAAACTTGAGG - Intergenic
1105001967 12:132695878-132695900 GCCCTGTGAAGAAGAACCTGAGG - Exonic
1106085997 13:26541968-26541990 CCCCTTTGGAGCTGTACATGGGG + Intergenic
1106132653 13:26952704-26952726 CCTCTGTGAAGATGCACCTCTGG - Intergenic
1107992136 13:45827992-45828014 GCCCAGTGAAAATGAAAATGTGG - Intronic
1112333449 13:98494960-98494982 CCTCGGTGAAGATGACCCTGTGG + Intronic
1112640336 13:101267025-101267047 CCTTTGTGGAGATGGACATGTGG - Intronic
1113974511 13:114216516-114216538 CACCTATGAATAAGAACATGCGG + Intergenic
1114804662 14:25821114-25821136 CCTCTTTGAAGATGAATACGAGG - Intergenic
1116689055 14:48081383-48081405 CACCTGTGAATGAGAACATGTGG - Intergenic
1117283612 14:54264810-54264832 TGCCTGTGAAGATGGATATGAGG + Intergenic
1117327228 14:54680762-54680784 CCTCTGAAAAGATTAACATGAGG - Intronic
1119184671 14:72631530-72631552 CCACTGAGAGCATGAACATGAGG + Intronic
1119498975 14:75106553-75106575 CTCCTGTGGAGATAATCATGTGG - Exonic
1119594392 14:75920475-75920497 CACCTGTGAATGAGAACATGCGG + Intronic
1119991902 14:79207577-79207599 CCACTCTGAAGATGAGCATGTGG + Intronic
1120380760 14:83776077-83776099 CACCTGTGAATGAGAACATGCGG - Intergenic
1120904080 14:89603988-89604010 CCCCTGTGAGGATTACCTTGTGG - Intronic
1121916838 14:97843306-97843328 CTCCTCTGAAGTTGAACAGGTGG - Intergenic
1124479560 15:30066383-30066405 CACCTGTGAGTAAGAACATGCGG + Intergenic
1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG + Intronic
1125095888 15:35850819-35850841 CCTATGTGAAGATGAGCATTTGG - Intergenic
1125805942 15:42493807-42493829 TCTCTGTGAAGTTGAAGATGGGG - Intronic
1126307984 15:47283008-47283030 CCCCTGTTAAGCTCAACATCAGG - Intronic
1126368696 15:47922825-47922847 CCCCTGTTAAGAAGTACATCTGG + Intergenic
1126736669 15:51737695-51737717 CCCCTGTGAAGAGGAAGAGGCGG - Exonic
1127491234 15:59465921-59465943 CACCTGTGAATGAGAACATGCGG + Intronic
1127623318 15:60755210-60755232 CACCTATGAATAAGAACATGTGG + Intronic
1128495879 15:68198212-68198234 CCCCTTTGGAGCTGGACATGGGG + Intronic
1128705376 15:69834315-69834337 ACGCTGTGCATATGAACATGAGG + Intergenic
1131625104 15:94109406-94109428 CCCCTTTGAACATGAACATCTGG + Intergenic
1133284950 16:4686411-4686433 CCCCTGGGAAGATGCGGATGCGG - Intronic
1135873154 16:26170694-26170716 CCCCTGAGAAGCTGAACAGATGG + Intergenic
1136281242 16:29212665-29212687 CCTCTGGGAAGAGGAAAATGAGG - Intergenic
1136412849 16:30086818-30086840 CCCGTGTGAAGAGGAAACTGCGG - Exonic
1137439370 16:48484896-48484918 CCCATGTGTGGATGAACATAAGG + Intergenic
1138294458 16:55874377-55874399 CCCCTGGGAAGATGAGTTTGTGG - Intronic
1138698765 16:58840886-58840908 CACCTGTGAATGAGAACATGCGG + Intergenic
1138784552 16:59830926-59830948 CACCTGTGAATGAGAACATGAGG + Intergenic
1139204099 16:65009286-65009308 CCAAAGTGAAGATGAACAAGAGG + Intronic
1139593559 16:67946046-67946068 CCACTGTGAAGATGCGCATCCGG + Exonic
1140619106 16:76706168-76706190 TCCCTGTGAGGATGACCTTGTGG + Intergenic
1141651216 16:85394097-85394119 CCCCTGGGAGAATGAACATTCGG + Intergenic
1145250245 17:21293464-21293486 CCCCTGTGCAGCTGAGCATCTGG + Intronic
1145864770 17:28233945-28233967 CCCCTTTGAAGATGTCCAGGTGG - Intergenic
1146171142 17:30634647-30634669 CCCCTGTGAATTTGAAAACGTGG - Intergenic
1146344600 17:32050656-32050678 CCCCTGTGAATTTGAAAACGTGG - Intronic
1147516981 17:41128037-41128059 CTCCTGTCAATATGAACCTGTGG - Intergenic
1147921753 17:43921454-43921476 CCCCTGTGAACTTAAAAATGTGG + Intergenic
1148689878 17:49520959-49520981 CCTCTGGGAAGATGAGCTTGAGG + Intergenic
1150094638 17:62362903-62362925 CACCTGTGAGTAAGAACATGCGG - Intergenic
1150289175 17:63971834-63971856 TCCCTGTGAAGGTGTACCTGGGG + Exonic
1150303445 17:64064820-64064842 CCCGGGGAAAGATGAACATGGGG + Intronic
1151216164 17:72577784-72577806 TCACTGTGAAGATGACGATGGGG + Intergenic
1151904579 17:77039344-77039366 CTGCTGTGAAGAAGAACATAAGG + Intergenic
1156756500 18:40533894-40533916 CACCTGTGAATGAGAACATGCGG - Intergenic
1157543579 18:48531190-48531212 CTCCTGTGAAGGTGATAATGGGG + Intergenic
1158754509 18:60305812-60305834 CACCTGTGAGTAAGAACATGCGG - Intergenic
1159044303 18:63354192-63354214 CTCCTGTGAGGATGAAGCTGGGG - Intronic
1160062659 18:75547079-75547101 GCCCAGTGAAGATGAAGGTGAGG + Intergenic
1160553006 18:79707097-79707119 CCCCAGTGAGGAGGAGCATGTGG + Intronic
1161487049 19:4542135-4542157 CTCCTATGCAGATGAAGATGGGG + Intergenic
1163324532 19:16594632-16594654 CCACGGTGAAGATGAAGAAGGGG + Intronic
1202676840 1_KI270711v1_random:14813-14835 CACCTGTGAGTAAGAACATGCGG + Intergenic
924982083 2:232668-232690 CACCTGTGAATGAGAACATGTGG + Intronic
925757637 2:7149004-7149026 ACAGTGAGAAGATGAACATGAGG + Intergenic
926214662 2:10897236-10897258 TCCCTCTGAAGATGGAGATGGGG + Intergenic
926684311 2:15687000-15687022 CACATTTGAAGAAGAACATGTGG + Intergenic
927108402 2:19847037-19847059 CACCTATGAATAAGAACATGCGG - Intergenic
927825918 2:26310235-26310257 GCCCTGAGAAGAGGGACATGGGG + Exonic
928279373 2:29930611-29930633 GCCCTGTGGAGATGTCCATGTGG + Intergenic
930795315 2:55383678-55383700 CCCCTGAGAAGATGTATTTGAGG - Intronic
931505662 2:62923339-62923361 CCCCTATGAAGATGGGCATGTGG - Intronic
933653499 2:84868351-84868373 CACCTGTGAATGAGAACATGCGG - Intronic
937296443 2:120812486-120812508 CCCCTGTGAGGATGACCCTGTGG - Intronic
938214720 2:129501353-129501375 CACCTGTGAGTAAGAACATGCGG + Intergenic
940377066 2:152968957-152968979 CCCCTGTAAGGATGAACAACTGG - Intergenic
941168079 2:162104789-162104811 ACCCTGTGGAGATGTCCATGTGG + Intergenic
942158506 2:173157029-173157051 CCCCTGTGCAGGTGAAAATATGG + Intronic
942185384 2:173420427-173420449 CCCCTCTGAAGATGAACAGCAGG - Intergenic
942253479 2:174067657-174067679 CCCCTGTGAGGACGAAGCTGAGG - Intergenic
943825360 2:192384395-192384417 CACCTGTGAATGAGAACATGTGG + Intergenic
944655067 2:201869294-201869316 CCCCTGTGAGTGAGAACATGCGG - Intronic
944864906 2:203850668-203850690 TCCCTGTGAAGATGAACCACTGG - Intergenic
1169385019 20:5141401-5141423 CTCCTGAGTAGCTGAACATGTGG + Intronic
1171245742 20:23608393-23608415 TTTCTGTGAAGCTGAACATGAGG + Intergenic
1174280367 20:49434745-49434767 ACCCAGTGCAGATGAAAATGTGG + Intronic
1175699102 20:61124310-61124332 GCCATGTGAAGATGAAGGTGGGG - Intergenic
1178018331 21:28378458-28378480 GCCATGTGAAGATTAAGATGAGG + Intergenic
1181973025 22:26707548-26707570 CCCCTGAGAGCATGAGCATGAGG - Intergenic
1182559051 22:31144841-31144863 GCCCTATGAAGATGCCCATGTGG + Intergenic
949616717 3:5761666-5761688 CCCTTGTGTAGATGTAAATGTGG + Intergenic
951291222 3:20874142-20874164 CACCTGTGAATGAGAACATGTGG + Intergenic
951309155 3:21102737-21102759 CATCTATTAAGATGAACATGTGG + Intergenic
951397086 3:22181891-22181913 TCCCTGTGAAGAGGATCATGTGG + Intronic
952487375 3:33827623-33827645 ACACTGTGCAGCTGAACATGAGG - Intronic
953160578 3:40415829-40415851 CCACTGTGCAGAAGAACCTGTGG + Exonic
953985917 3:47442891-47442913 ACCCTGTGAAGAGGATGATGGGG + Exonic
955281312 3:57597285-57597307 CCCCTGTGCCGATGAAGATCCGG + Exonic
956372221 3:68575348-68575370 CACCTATTAAGATGATCATGGGG - Intergenic
956588076 3:70884857-70884879 CCCTTGTTTAGGTGAACATGTGG - Intergenic
959888775 3:111531226-111531248 CCCCTGTGATAAGAAACATGAGG - Intronic
960759289 3:121054504-121054526 CACCTGTGAATGAGAACATGCGG - Intronic
960765894 3:121129602-121129624 CCCCTCTGTTGATGAATATGGGG - Intronic
961114112 3:124314265-124314287 CACCTATGAATAAGAACATGCGG - Intronic
961142300 3:124565761-124565783 CTCCTGCGAAGTTGCACATGTGG - Intronic
964442772 3:156728974-156728996 CCCATGTGAAGAAAAACATTGGG - Intergenic
964816577 3:160724009-160724031 CATCTGTGAAGATGTTCATGTGG - Intergenic
965541738 3:169878247-169878269 CCCCTGTGACAATGAACTTTAGG - Intergenic
966490523 3:180523271-180523293 GCCCAGTGAAAATGAACATCTGG + Intergenic
966963070 3:184960064-184960086 CACCTATGAATAAGAACATGCGG + Intronic
967215875 3:187209877-187209899 CCTCTGTCAAGATGGGCATGAGG - Intergenic
967319030 3:188177592-188177614 TCCCTGGGAAGATGAAGATTAGG + Intronic
967333157 3:188312899-188312921 CACCTGTGAGTAAGAACATGCGG - Intronic
968803659 4:2758639-2758661 ACCCTGTGAAGAGGTCCATGTGG + Intergenic
969581267 4:8066997-8067019 CTGCTGTGAGGATGAACTTGAGG - Intronic
970197968 4:13571948-13571970 ATGCTGTGAAGATGAAAATGTGG + Intronic
972112230 4:35578502-35578524 CACCTGTGAGTGTGAACATGCGG - Intergenic
974488171 4:62530458-62530480 CACCTATGAATAAGAACATGTGG - Intergenic
975623835 4:76322202-76322224 CCCCTATGTATATGAACATTAGG - Intronic
975923672 4:79423556-79423578 CCCTTGTGAAGTTGAATTTGGGG - Intergenic
976765923 4:88597485-88597507 CTCCAGTGAAGATGAAGATGTGG - Intronic
981162629 4:141516992-141517014 GCCCTGTGAAGAGGCTCATGTGG - Intergenic
981293100 4:143099648-143099670 CACATTTGAAGAAGAACATGTGG - Intergenic
981725053 4:147838541-147838563 ACCCTGTGAAGAAGAAGAGGAGG - Intronic
982407367 4:155035377-155035399 CACATGTGAATAAGAACATGAGG - Intergenic
984813363 4:183815306-183815328 CCACTGTGAAGATGCATAAGTGG + Intergenic
986331831 5:6722182-6722204 CCCCTGTGAAGCAGAGCCTGTGG + Intronic
986798338 5:11233968-11233990 CCCCTGGGAACATTATCATGGGG + Intronic
986983709 5:13477172-13477194 CCCAAGTGAAGATGAAGAGGGGG - Intergenic
988596556 5:32597697-32597719 CCCCTGTGCAGTTGAAAATCTGG + Intronic
989846929 5:46156525-46156547 CACCTATGAATAAGAACATGAGG + Intergenic
992613419 5:78527213-78527235 CAGCTGGGAAGATTAACATGGGG + Intronic
992849066 5:80785906-80785928 CACCTGTGAGTAAGAACATGTGG - Intronic
993043218 5:82838559-82838581 ACCCTGTGAAGGAGAAGATGTGG - Intergenic
993475721 5:88361757-88361779 CCCCTGTGAAGATGGACAACTGG - Intergenic
996741826 5:126806541-126806563 GCCCTATGAAGAAGACCATGAGG - Intronic
996942777 5:129029097-129029119 CCCCTGTAAAGATCCACAGGTGG + Intronic
998220596 5:140275464-140275486 TCCCTATCAAGATTAACATGAGG + Intronic
1000843591 5:166252047-166252069 CCCCTCTGAAGATGAAAACTCGG - Intergenic
1001099388 5:168801655-168801677 CCACAGAGCAGATGAACATGTGG + Intronic
1003190508 6:3870526-3870548 CACCTATGAGGATGAACTTGAGG + Intergenic
1003337461 6:5187518-5187540 CACCTGTGAGTAAGAACATGCGG - Intronic
1004032410 6:11883777-11883799 CACCTATGAAGGAGAACATGTGG - Intergenic
1004600590 6:17145740-17145762 CCCCAGTGAGGATGTACATTTGG + Intergenic
1004832072 6:19487644-19487666 CACCTGTGAGTAAGAACATGCGG - Intergenic
1005836542 6:29713773-29713795 ACCCTGTAAAGATGAACCTCTGG - Intergenic
1005845211 6:29771739-29771761 CCCCTGTGAAGATGAACCTCAGG - Intergenic
1005857381 6:29872842-29872864 TCCCTGTGAAGATGAACCTCTGG - Intergenic
1005863136 6:29916677-29916699 ACCCTGTGAAGATGAACCTCTGG - Intergenic
1005874717 6:30002198-30002220 ACCCTGTGAAGATGAAACTCTGG - Intergenic
1006066270 6:31464567-31464589 TCCCTGTGAAGATGAACCTCTGG + Intergenic
1006200908 6:32289692-32289714 CTCCTGTAAAGATACACATGTGG - Intronic
1006201053 6:32291228-32291250 CCCCTGGGAAGACAAATATGAGG - Intronic
1006223303 6:32514292-32514314 CTCCCCTGAACATGAACATGAGG - Intergenic
1009315331 6:62212071-62212093 TCCCTATGAATAAGAACATGTGG - Intronic
1009483728 6:64193726-64193748 CACCTGTGAATGAGAACATGTGG + Intronic
1011340791 6:86312105-86312127 CCTCTATTAAGATGATCATGTGG - Intergenic
1015430446 6:133124952-133124974 CACCTGTGAATGAGAACATGTGG - Intergenic
1015445557 6:133299835-133299857 ATCATGTTAAGATGAACATGGGG + Intronic
1018640271 6:165898534-165898556 CTCCTGTGGAGATCAGCATGTGG + Intronic
1019477961 7:1253040-1253062 CCCCTGTGAAGATGAGGAGTGGG - Intergenic
1019909251 7:4089236-4089258 ACCCTGTGCAGATGCCCATGAGG - Intronic
1020098742 7:5382632-5382654 CCCCTGTGAAGCTGGAGGTGGGG + Intronic
1020470903 7:8533439-8533461 CCCCTATAAAGATCAACATTAGG + Intronic
1021256654 7:18400507-18400529 TCACTGTGAAGTTGGACATGGGG + Intronic
1021694313 7:23261546-23261568 CACCTGTGAATGAGAACATGCGG - Intronic
1021886455 7:25144529-25144551 CCCTTGGGAAGATGGACATAAGG + Intronic
1023090513 7:36613916-36613938 CCTCTGTAAAGATGAGCAAGTGG - Intronic
1024395325 7:48859665-48859687 CAACTGTGAAGAGGCACATGGGG + Intergenic
1024399911 7:48912621-48912643 CAACTGTGAAGAGGCACATGGGG - Intergenic
1024486394 7:49925280-49925302 TCCCTGTAAAGATGAACCAGTGG + Intronic
1024907587 7:54405482-54405504 CACCTGTTAAGATAATCATGTGG + Intergenic
1026052803 7:66961173-66961195 TCCATTTGTAGATGAACATGGGG + Intergenic
1027860422 7:83571471-83571493 CACCTGTGAAGATGATCATATGG - Intronic
1030913325 7:115280102-115280124 CACCTGTGAGGGAGAACATGTGG + Intergenic
1032162408 7:129520915-129520937 TCCCTGTGAAGAGGAAGAGGAGG - Intergenic
1032289284 7:130573584-130573606 CATCTGTGAAGATGATTATGTGG - Intronic
1032884927 7:136127188-136127210 CCCCTCTGAACATGAACATAGGG + Intergenic
1033269334 7:139916556-139916578 CCCCTGAGAGGCTGAACCTGGGG - Intronic
1034448480 7:151125377-151125399 GCCCTGTGAACTTGAACCTGGGG + Intronic
1039358471 8:36847575-36847597 CCCATGTGTGGGTGAACATGTGG + Intronic
1042202153 8:66289528-66289550 ACCCTGTGAAGGTTAACGTGAGG - Intergenic
1042414639 8:68505103-68505125 CCCCTGTGAAAATCAATTTGGGG - Intronic
1043163633 8:76875720-76875742 CCCCTGTTCAGATTACCATGTGG + Intergenic
1043485241 8:80692817-80692839 TCCCTGGGAAGATGAAGAGGGGG + Intronic
1044122536 8:88415275-88415297 CCCCTATATAGATGAAAATGTGG - Intergenic
1048205765 8:132414188-132414210 CCTCTGTGATGCTGAAAATGGGG - Intronic
1048421046 8:134278764-134278786 CACCTGTGAAGGTGAACTTAGGG + Intergenic
1048424231 8:134307741-134307763 CACCTGTGAGGGAGAACATGCGG + Intergenic
1048950662 8:139494140-139494162 CCCCTGAGGAGATGAACGTTTGG - Intergenic
1051333004 9:16042317-16042339 CCCTTATGAAGAGGATCATGAGG + Intronic
1051808428 9:21023133-21023155 CACCTGTGAGGGAGAACATGTGG - Intronic
1053537225 9:38937849-38937871 CTTCTGGGAAGAGGAACATGAGG - Intergenic
1054628910 9:67426081-67426103 CTTCTGGGAAGAGGAACATGAGG + Intergenic
1055179579 9:73367830-73367852 CTCATGTGGAGATGGACATGTGG + Intergenic
1055795641 9:79972337-79972359 ACCCTGTGAAGGTTAAGATGTGG + Intergenic
1055866015 9:80815207-80815229 CACCTGTGAATGAGAACATGCGG + Intergenic
1057624174 9:96662923-96662945 CCCCTGTGAAGAGGGAAGTGAGG + Intergenic
1058680190 9:107434091-107434113 GCCATGTGAAGATGAAATTGTGG - Intergenic
1059256288 9:112934323-112934345 TCCCTCTGAATATGAACCTGGGG - Intergenic
1059334485 9:113560305-113560327 TCCCTGTGAACTTGAACCTGAGG + Intronic
1186753520 X:12646321-12646343 CTGCTTTGAAGATGAACTTGGGG - Intronic
1186995970 X:15122784-15122806 CCAAAGTGAAGAGGAACATGTGG - Intergenic
1187120851 X:16404853-16404875 AGCCTGTGAAGGTGAACCTGAGG - Intergenic
1187545374 X:20246363-20246385 CCCCTGACAAGATGAGCAGGAGG - Intronic
1188147014 X:26626398-26626420 CCCCTGGGAAGCTGACCATAAGG - Intergenic
1188567301 X:31541564-31541586 CGCCTGTGAGTAAGAACATGTGG + Intronic
1189418624 X:40835879-40835901 CCCCTTTGACGATGAAGAAGAGG + Intergenic
1192628043 X:72750380-72750402 CACCTGTGAGTAAGAACATGTGG + Intergenic
1192653666 X:72970428-72970450 CACCTGTGAGTAAGAACATGTGG - Intergenic
1194048467 X:89037395-89037417 CTCCTCTGAAGGTGAACTTGGGG + Intergenic
1194060472 X:89190478-89190500 CCCCAGTGAACATGAATTTGGGG + Intergenic
1198757614 X:139997438-139997460 CCCCTGTAAAGATGAACTGCAGG + Intergenic
1199087105 X:143640083-143640105 CCCCTGTGAAAACGAAAATGTGG - Intergenic
1199317454 X:146396877-146396899 CTCCTGTTAAGATGATCATATGG + Intergenic