ID: 1098582705

View in Genome Browser
Species Human (GRCh38)
Location 12:72120024-72120046
Sequence ATGCTATTATTGATAAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098582704_1098582705 -10 Left 1098582704 12:72120011-72120033 CCATTTACATTCAATGCTATTAT 0: 11
1: 238
2: 1042
3: 1931
4: 9430
Right 1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG 0: 1
1: 0
2: 5
3: 37
4: 319
1098582703_1098582705 22 Left 1098582703 12:72119979-72120001 CCACTCTATGTCTTTTGACTGGA 0: 11
1: 152
2: 441
3: 970
4: 6714
Right 1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG 0: 1
1: 0
2: 5
3: 37
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098582705 Original CRISPR ATGCTATTATTGATAAAGTA AGG Intronic
903290147 1:22306218-22306240 ATGCTATTATTGATATAGTTAGG - Intergenic
905536636 1:38727626-38727648 ATGCTATTATGGTGAAATTAGGG + Intergenic
906007094 1:42483802-42483824 ATGCTAATATTCATCAAGTTGGG + Intronic
906839972 1:49126710-49126732 ATGTTATAATTGAGAAAGTATGG - Intronic
907535210 1:55146898-55146920 GTGGTATTGTGGATAAAGTAAGG - Intronic
908175325 1:61549977-61549999 ATGTTATTATTGATAAGTAAGGG + Intergenic
908403401 1:63791416-63791438 ATGATATTAGTAATAATGTAGGG + Intronic
909157384 1:72095337-72095359 AAGAAATTATTGATAAAGTAAGG - Intronic
910366327 1:86469153-86469175 ATGCTATTTTTAAAAAAGTATGG - Intronic
910632876 1:89374504-89374526 CAGCTATTATGGAAAAAGTATGG - Intronic
910906905 1:92190997-92191019 ATGCTAATATTGGTTAAGTTTGG - Intergenic
911558798 1:99379046-99379068 ATACTATTATTGATTATATATGG - Intergenic
911780523 1:101870290-101870312 ATGATGTTATTGATGAATTATGG - Intronic
911994741 1:104751528-104751550 ATTCTATGACTGATAAATTATGG + Intergenic
912126477 1:106545167-106545189 ATGCTATTACTGATGAATTCTGG - Intergenic
912579962 1:110711640-110711662 ATGCTATAAATGTTAAAGAAAGG - Intergenic
912723156 1:112036996-112037018 ATGGTAATAAGGATAAAGTATGG + Intergenic
912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG + Intergenic
913139597 1:115927570-115927592 CTGCTATTGATGAAAAAGTAAGG - Intergenic
913199895 1:116487463-116487485 ATTCTATTTTTAATAAAGTAAGG + Intergenic
917113576 1:171578197-171578219 AAGCTATTAGAGATTAAGTAAGG + Intronic
917396377 1:174598906-174598928 ATATTGTTATTGATAAACTAAGG + Intronic
917533795 1:175859910-175859932 ATACTATTATTTTTAAAATATGG + Intergenic
917986386 1:180324225-180324247 ATGTCATTATTGATTAGGTAAGG + Intronic
918090090 1:181283823-181283845 ATGTAATTATTGATATAGTTGGG + Intergenic
918475958 1:184925409-184925431 ATGTTATTATTGATAAGTAAGGG + Intronic
918493319 1:185106826-185106848 ATGTAATTATTGATATATTAGGG - Intergenic
919439763 1:197617206-197617228 GTGCTATTATTGAAAAAAGAGGG + Intronic
920824067 1:209408456-209408478 ATGCTAATATTGAAAAGGCAAGG - Intergenic
921792960 1:219310628-219310650 ATGCTATGAATTATAGAGTAGGG + Intergenic
921802542 1:219417926-219417948 ATGGAATTCTTGATATAGTAAGG - Intergenic
924097505 1:240568473-240568495 ATGTGATTATTGATATAGTTAGG - Intronic
1063947019 10:11187524-11187546 ATGTAATTGTTGATAAAGTTTGG + Intronic
1065422453 10:25560750-25560772 ATACTATTATAGATTAAGAATGG - Intronic
1067964424 10:50893356-50893378 ATGTTCTTATTTGTAAAGTAGGG + Intergenic
1068056356 10:52016501-52016523 ATGGAATTATTGATATAGTTTGG - Intronic
1068806707 10:61203170-61203192 ATGGAATTATTGATACAGTTGGG - Intergenic
1069123049 10:64592683-64592705 ATGCAATTATTGGTATAATAGGG - Intergenic
1069647343 10:70011156-70011178 ATGTGATTATTGATATAGTTGGG - Intergenic
1070142651 10:73749845-73749867 CTGCTCTTCTTGAGAAAGTAAGG - Intronic
1071331080 10:84561605-84561627 ATGCTATAAGTGATAATGTGGGG - Intergenic
1072385131 10:94917130-94917152 ATCTTATTTTTGATAAAATAAGG - Intergenic
1072711432 10:97718114-97718136 ATGCTTTTCTGGATAAAGTTTGG + Exonic
1073876186 10:107923930-107923952 ATGTTATTATTGAAATAGTTGGG - Intergenic
1074226682 10:111491358-111491380 TTGTTATTATTGATAAGGAAAGG + Intergenic
1075880804 10:125849074-125849096 ATGCTATTAATGATTAAGCTGGG - Intronic
1076210429 10:128638009-128638031 ATTATATTAATGATAAAGAAAGG + Intergenic
1077666769 11:4117783-4117805 AAGAGATTATTGATAGAGTAAGG + Intronic
1079171473 11:18100136-18100158 CTACAATTATTGATAAATTATGG - Intronic
1079433971 11:20426503-20426525 ATGTTATTCTTGATAAAATTTGG + Intronic
1079927631 11:26514574-26514596 ATGCTATAAATGAAAAAGCATGG - Intronic
1080128813 11:28769073-28769095 ATGTTATTATTGATATTGTAAGG - Intergenic
1080221896 11:29915678-29915700 ATGATATTATTGACAAAGGCAGG - Intergenic
1082103612 11:48195736-48195758 ATGGTAGTATTGATACAGTTGGG - Intergenic
1085757203 11:79211668-79211690 ATGTTATTTATGTTAAAGTAAGG + Intronic
1088944253 11:114493315-114493337 ATGTTATTATTGATAAGCAAGGG + Intergenic
1090991599 11:131822003-131822025 GAGCTTTTATTGATAAAGGAAGG - Intronic
1092305833 12:7299767-7299789 ATGGTATTATTGATCCAGAAAGG - Intergenic
1092688685 12:11081854-11081876 AAGCTCTTATTTATAAAGTAAGG - Intronic
1093498932 12:19787698-19787720 AGGCTAATATTGATAATGTGAGG + Intergenic
1094360196 12:29622147-29622169 AGGCTATTATTAAGAAAGTCAGG + Intronic
1094766724 12:33604550-33604572 ATGTGATTACTGATAAGGTAGGG - Intergenic
1096482106 12:51949281-51949303 TTGTTAGTATTGATAAAATATGG - Intergenic
1097040124 12:56151374-56151396 GTGTTATTATTGGTAAAATAGGG - Intergenic
1097143920 12:56926461-56926483 ATGCTTTGATTGCTATAGTAGGG - Intronic
1097424529 12:59427019-59427041 ATACTGTTAATGAGAAAGTATGG + Intergenic
1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG + Intronic
1098731886 12:74045864-74045886 ATTATATTACTGAAAAAGTAAGG + Intergenic
1100369294 12:93951638-93951660 ATGTAATTATTGATAACATAGGG - Intergenic
1101450438 12:104772539-104772561 ATGTAATTATTGATATAGTTAGG + Intergenic
1103182909 12:118929529-118929551 ATGCTATTATAGCTTAAGTTGGG - Intergenic
1105036570 12:132928202-132928224 ATGGTATAATAGAAAAAGTAAGG + Intronic
1107756346 13:43627270-43627292 ATGCAATTATTGATATGTTAGGG + Intronic
1108032387 13:46247264-46247286 ATTATATTATAGAGAAAGTATGG - Intronic
1108598046 13:51966632-51966654 ATGCAACTATTGATACAGCATGG + Intronic
1109011447 13:56952107-56952129 ATGTAATTATTAATAAAGTTGGG + Intergenic
1109238793 13:59857493-59857515 ATGCTCTTAATGGTAAAATATGG + Intronic
1109250788 13:60017805-60017827 TTGCTATTATAGTTAAGGTAAGG + Intronic
1109656885 13:65404169-65404191 ATGATTTTATTAATAAAATAAGG + Intergenic
1109729239 13:66389121-66389143 ATGATTTTATTCATAAAATAAGG - Intronic
1111800218 13:92971908-92971930 ATGCTTTGGTTGATAAAATAAGG - Intergenic
1113195649 13:107802424-107802446 ATCATATTATTTATAAATTATGG + Intronic
1114957347 14:27840066-27840088 ATGTTATTATTGTTACATTAGGG - Intergenic
1115184790 14:30674246-30674268 ATACTATTAATGATAAAGTAGGG + Intronic
1116197739 14:41751264-41751286 ATGCTCTTGTTAATAAAGTTCGG + Intronic
1117666819 14:58064749-58064771 ATGATATTGTTGATCAAGCAGGG + Intronic
1118032063 14:61827582-61827604 ATGCTATTATTGTTAACCAAAGG + Intergenic
1119963404 14:78885044-78885066 ATGATCATATTTATAAAGTAGGG + Intronic
1120575988 14:86181453-86181475 ATGCAAATCTTGATAACGTAAGG + Intergenic
1121829793 14:97040567-97040589 ATGCTATAATTTATAACATATGG - Intergenic
1123883530 15:24698688-24698710 ATGACATTATTGATATAGTTGGG + Intergenic
1123958721 15:25370333-25370355 ATGCTATCTTTGAAAAAGAATGG - Intronic
1124000145 15:25751752-25751774 AAGCTATTATTGATTAATAATGG + Intronic
1126204787 15:46033616-46033638 AAGCTTCTATTGATAAATTAAGG + Intergenic
1126490126 15:49227635-49227657 ATGTTATTATTGATATGGGAGGG + Intronic
1127156121 15:56126550-56126572 ATGTAATTACTGATAAAGTAAGG - Intronic
1127182069 15:56431424-56431446 ATGCAATTATTGAAGAAGAAAGG - Exonic
1127571403 15:60245857-60245879 AAACTATTATTGATATAGTTGGG - Intergenic
1127687112 15:61358205-61358227 ATGTAATTATTGATAAGGTTAGG + Intergenic
1132387871 15:101413531-101413553 ATGTAATTATTGATACATTAGGG - Intronic
1135743127 16:24993849-24993871 ATGCAAATATAAATAAAGTAAGG - Intronic
1138839803 16:60486362-60486384 ATGCTACTATTCAGAAAGTAAGG + Intergenic
1139249844 16:65484694-65484716 CTGCTATTAAGAATAAAGTAGGG + Intergenic
1140082012 16:71757107-71757129 TTGATATTATTGACCAAGTATGG - Intronic
1140852721 16:78949877-78949899 CTGCTACTATTAAGAAAGTAGGG - Intronic
1145097125 17:20039941-20039963 ATGTAATTATTGATAAGTTAGGG + Intronic
1146459204 17:33032107-33032129 ATGCAATTTTTGATATAGTTCGG + Intronic
1149488011 17:57059452-57059474 AAGCTATATTTGTTAAAGTAGGG + Intergenic
1149635624 17:58166688-58166710 ATGGTATTATTCATGAAGTAAGG + Intergenic
1149811194 17:59674194-59674216 CTGCTATTATTGAAAAAGTTGGG + Intronic
1150253359 17:63722923-63722945 AATCTATTATTAATAAACTAAGG + Intronic
1150903570 17:69312150-69312172 ATGCTATTAATGATTAAACAAGG - Intronic
1151117447 17:71753470-71753492 ATGCTAAGATTGGCAAAGTATGG - Intergenic
1155188533 18:23409385-23409407 ATTCAATTATTGATAAATTGGGG - Intronic
1156038306 18:32791187-32791209 AAGCTATATTTAATAAAGTATGG - Intergenic
1157632357 18:49111484-49111506 ATACTATTTATGATAAATTAGGG + Intronic
1157900439 18:51510238-51510260 ATGTTATTATTGCTATAGTTGGG + Intergenic
1158479815 18:57811855-57811877 ATGCTATTATTTATAATTGAAGG - Intergenic
1158902556 18:61979455-61979477 ATTCTATTTTTGATAGATTAAGG - Intergenic
1159089256 18:63828964-63828986 ATTCAATTGTTGATTAAGTATGG + Intergenic
1159502142 18:69287057-69287079 ATGTAATTATTGATAGAGTTGGG - Intergenic
1159712519 18:71779040-71779062 GTGCTATAATTGAGAAAATATGG - Intronic
1160582650 18:79894741-79894763 ATGTTATGATTGATATAGTTGGG + Intronic
1160582708 18:79895553-79895575 ATGTTATGATTGATATAGTTGGG + Intronic
1162467260 19:10849761-10849783 ATGCTATTATTGAAAACTGATGG + Intronic
1164109466 19:22141708-22141730 ATGCCAGTATTCATATAGTATGG - Intergenic
1167632892 19:50636926-50636948 ATGCAGTTATTAATAAAGTGAGG + Intronic
926408843 2:12581105-12581127 ACTGTATTATTGACAAAGTAGGG - Intergenic
927324842 2:21792228-21792250 ATGCCTTTATTTATAAAGTAAGG - Intergenic
927331572 2:21870708-21870730 ATGCTAAGATTTAAAAAGTAAGG + Intergenic
927658693 2:24973365-24973387 CTGTTATGATTGATTAAGTATGG + Intergenic
929618264 2:43329315-43329337 ATGCTTTTAGGGAGAAAGTAAGG - Intronic
930291579 2:49500272-49500294 ATGGTATTTTTGATAACGTATGG - Intergenic
931015478 2:57974840-57974862 ATGGCATTATTCATCAAGTAAGG - Intronic
931193588 2:60028687-60028709 AGGCTTTTGTTGATAAAGGATGG + Intergenic
931803988 2:65787137-65787159 ATGCTATTATTATTAAGGTAAGG - Intergenic
932427555 2:71649497-71649519 ATTTTATTATTGCTACAGTAGGG + Intronic
933346934 2:81099199-81099221 ATGCTATTATTGGTAATATTGGG + Intergenic
934479935 2:94627788-94627810 ATGTTATTATTGTTACATTAGGG + Intergenic
937279531 2:120707840-120707862 ATGCCAGAATTGAGAAAGTAGGG + Intergenic
938402987 2:131008527-131008549 ATGTGATTATTGATATAGTTGGG + Intronic
938622423 2:133070196-133070218 ATACTATTTTTCATTAAGTAAGG - Intronic
938705844 2:133925641-133925663 ATGATATTCTTTATAAAATAAGG - Intergenic
939998759 2:148946465-148946487 ATGATATTACTGATAAGGCAAGG + Intronic
940334097 2:152506671-152506693 ATGCTATGACTGAAAAAGTTTGG - Intronic
940541015 2:155018077-155018099 ATGTGATTATTGATATAGTTTGG + Intergenic
941194341 2:162428990-162429012 ATGCAATTATTGATATATTTGGG + Intronic
941275807 2:163489401-163489423 ATGCAATTATCGATAGTGTAAGG - Intergenic
941520174 2:166532326-166532348 CTGCTATAATTGAAAGAGTAGGG - Intergenic
941655489 2:168139641-168139663 ATGCTATTTTACATAGAGTATGG - Intronic
943662807 2:190577213-190577235 ATGCTATTATTTGGAAAGTGGGG + Intergenic
944272475 2:197798874-197798896 ATACTATAATTTATAAAGGAAGG - Intergenic
944391005 2:199219541-199219563 ATGTTATTATTGATAATAAAAGG - Intergenic
947425450 2:229979187-229979209 ATACTATTATTGTTAAATAATGG - Intronic
948734541 2:239993105-239993127 ATGCTATAATTGATACACTATGG + Intronic
1169290567 20:4347347-4347369 ATGTGATTATTGATATAGTTGGG + Intergenic
1170580420 20:17695152-17695174 ATTCTGTTATTTAAAAAGTAAGG + Intronic
1171129499 20:22637509-22637531 ATGCTATAATTGCTATAGTTGGG + Intergenic
1171145785 20:22781103-22781125 ATCCTATTTTAAATAAAGTATGG - Intergenic
1171390156 20:24796227-24796249 ATGCTATTAATTATTAAATAAGG + Intergenic
1174016627 20:47493829-47493851 ATGTTAATAATGATAATGTATGG - Intergenic
1174091154 20:48048884-48048906 ATGCAATTTTTGAAAAAGGAAGG - Intergenic
1174981544 20:55401074-55401096 ATGCAATTATTGATATGTTAGGG - Intergenic
1176702767 21:10077053-10077075 ATGCTAATATTGATGAATTTTGG + Intergenic
1177060398 21:16366703-16366725 ATTCTATTATTCATAAAGCATGG - Intergenic
1177124826 21:17182496-17182518 AAGCCATTATTGATAACTTAAGG + Intergenic
1177276423 21:18918360-18918382 ATGATAATAATGAAAAAGTAGGG - Intergenic
1179421041 21:41237035-41237057 ATGCTGTTCATGATAAAGAATGG + Intronic
1180610920 22:17097339-17097361 ATTATATTATAGATACAGTAGGG - Intronic
1183758850 22:39797362-39797384 AGGTTATTATTGATAATGTGAGG + Intronic
949231120 3:1752233-1752255 ATGCTATAATTGTTACAGTGGGG + Intergenic
949561015 3:5202744-5202766 TTGCTCTTATTAATAAAGCAAGG + Intronic
949978554 3:9483263-9483285 ATGCTTTTCTTGATAAGGTCAGG + Intergenic
951675252 3:25232757-25232779 ATGATTGTATAGATAAAGTACGG - Intronic
952567078 3:34671869-34671891 ATGTTATTATTGATGAGTTAAGG - Intergenic
952798768 3:37268538-37268560 ATGCTAATAATGTTAAAGTGGGG + Intronic
953160987 3:40419112-40419134 AGGGTATGATTGATAAATTATGG - Intronic
955128315 3:56137312-56137334 CTGGTATTATTGACAAAATATGG + Intronic
955298946 3:57758600-57758622 ATGCTATAATTGACAGAATAGGG - Intronic
956599116 3:71000125-71000147 ATGGAATTATTGTTAAAATATGG + Intronic
957469896 3:80645867-80645889 ATGCTATTATTTGTAAAATAAGG + Intergenic
957950907 3:87125240-87125262 ATGCTATTCTTCCTAAAGAATGG + Intergenic
957975959 3:87445309-87445331 ATGTTATTATTGATAAGGAATGG + Intergenic
958709709 3:97702900-97702922 ATGCTATTGATGATAAAATGGGG - Intronic
958880853 3:99667295-99667317 ATGCTATTTTTTATTACGTATGG - Intronic
959586420 3:108029277-108029299 ATGCTGTTTTTGTTAAAGTAAGG + Intergenic
960397886 3:117159485-117159507 ATGCTATTATTGGCATAATATGG + Intergenic
960515302 3:118596181-118596203 ATGGTAGTATTGATACAGGAGGG - Intergenic
961175119 3:124828953-124828975 ATAATAGTATTGATAAAATAGGG + Intronic
961523305 3:127480748-127480770 ATGCTTCTTTTGATAAAGAAGGG + Intergenic
962193823 3:133339099-133339121 ATGTTATTATTGATAAGTAAGGG - Intronic
962693470 3:137924906-137924928 ATGATATTATTAATGAGGTAAGG - Intergenic
962885757 3:139625327-139625349 ATGTGATTATTGATATAGTTAGG + Intronic
963308676 3:143683410-143683432 ATGCTATTATTGAGAAAATTGGG - Intronic
963323173 3:143832013-143832035 ATGCTATACTTGAAAAGGTAAGG - Exonic
963788048 3:149555338-149555360 ATGCAATTAGTAATAAAATATGG + Intronic
964398215 3:156270283-156270305 ATGTTATTATTAATAAATAAGGG + Intronic
965870760 3:173261754-173261776 ATGTTTGCATTGATAAAGTAAGG + Intergenic
965978431 3:174655808-174655830 ATGTTAAAACTGATAAAGTAAGG - Intronic
965996855 3:174893857-174893879 ATGTTATTATTAATAAGTTAGGG - Intronic
966032919 3:175372722-175372744 ATTCTATTAATGAAGAAGTAAGG + Intronic
966109051 3:176374985-176375007 ATTATATTAAAGATAAAGTATGG + Intergenic
967706548 3:192657765-192657787 ATGGTTTTATTGATAAATTTGGG - Intronic
968004635 3:195233368-195233390 ATGTTATTATTGATTAAGTAAGG + Intronic
968834932 4:2956255-2956277 AGGCTGGAATTGATAAAGTAGGG + Intronic
971447250 4:26764229-26764251 ATTATATTATTGATGAAGTCGGG + Intergenic
973761803 4:54124207-54124229 CTGCAATCATTGATAAAGTATGG + Intronic
974219925 4:58954764-58954786 ATGCGATTATTGATAAAGTTAGG + Intergenic
974396599 4:61344140-61344162 TTGCTATGATTTATTAAGTACGG + Intronic
975074082 4:70182912-70182934 ATGCTATTATTGGTGCACTAGGG - Intergenic
975875631 4:78833634-78833656 ATTCAATTAGTGATAATGTATGG + Exonic
975945447 4:79700520-79700542 ATGTTATCATTGGTAAAGTCAGG - Intergenic
975956209 4:79842376-79842398 ATGTTATTATTGCTACAGTTGGG + Intergenic
976855021 4:89593731-89593753 ATGTTATTATTGATATAGTTGGG + Intergenic
976951063 4:90831197-90831219 ATGCCATTATGGAGAAAGGAAGG + Intronic
977642612 4:99374225-99374247 ATGTTATTATTGATAAGTAAGGG + Intergenic
977814551 4:101399401-101399423 ATGATATTGTTGATAAATTCTGG + Intergenic
978083842 4:104625580-104625602 ATACAAATATTGACAAAGTATGG - Intergenic
978724379 4:111953151-111953173 ATGCATTTATTGATTGAGTATGG - Intergenic
978800250 4:112749291-112749313 GTGATATCATTGGTAAAGTATGG + Intergenic
979089337 4:116460701-116460723 GTGTTACTATTGATAAAGTGTGG - Intergenic
980374955 4:131933431-131933453 ATGCTAATATTGATGAATTTTGG + Intergenic
980631801 4:135446888-135446910 TTGTAATTATTGATGAAGTAGGG + Intergenic
981603041 4:146512587-146512609 ATACACCTATTGATAAAGTAGGG - Intronic
982074006 4:151720575-151720597 ATACTATTATTGATATAGATAGG + Intronic
982579002 4:157154334-157154356 ACGTAATTATTGATATAGTAAGG + Intronic
983532054 4:168820927-168820949 ATACTATTATTTATTAAGTGAGG + Intronic
984686705 4:182677139-182677161 ATGGTTTTAGTGTTAAAGTAGGG + Intronic
984751121 4:183276315-183276337 ATGCTATTATTGATATATTTGGG + Intronic
985085871 4:186311876-186311898 ATTCTATTACTGATAGAGTTAGG - Intergenic
985772715 5:1823200-1823222 ATGCAATTATTGATATGTTAGGG + Intergenic
986044418 5:4023329-4023351 ATGATATTATTGATTCAGAAAGG + Intergenic
986234759 5:5896907-5896929 ATATTATTATTATTAAAGTATGG + Intergenic
988171608 5:27664275-27664297 AGGACATTTTTGATAAAGTAGGG + Intergenic
989215233 5:38898599-38898621 ATGTTATTATTGATAAGTAAGGG + Intronic
989594110 5:43140276-43140298 CTGCCATTATTCATCAAGTAAGG - Intronic
990066694 5:51724883-51724905 ATTGTATTGTTGTTAAAGTAAGG + Intergenic
990234179 5:53749183-53749205 ATGCCAGTATTGATATAGTTAGG - Intergenic
992451155 5:76877244-76877266 ATGCTTTTATTTATAAAATTGGG - Intronic
993330187 5:86590049-86590071 AGGCTATGATAGATAAAGGAAGG + Intergenic
993761755 5:91803978-91804000 AAGCTTTTATTGATCATGTATGG + Intergenic
994946599 5:106401499-106401521 ATGCAATCATTGATACAGTCAGG + Intergenic
994958678 5:106568497-106568519 AGGCTATTATTGTGAAAGGATGG + Intergenic
995268427 5:110192531-110192553 ATGTTATTATTGATAAGTAAGGG + Intergenic
995457034 5:112362618-112362640 TTGCTATTAATGATAAAGTGAGG - Intronic
995905942 5:117123170-117123192 ATGCTAGTATTTAAAAACTAAGG - Intergenic
999070571 5:148739493-148739515 ACGGTATTCTTGATAAAATAGGG + Intergenic
999550502 5:152681591-152681613 ATGGGATTACTGATAAGGTAAGG - Intergenic
1000501022 5:162050193-162050215 AGGCTATTATGAATAAAATAAGG - Intergenic
1002377762 5:178800410-178800432 ATTCTATTATTGAGGAAGGAAGG - Intergenic
1003788841 6:9519269-9519291 ATGCTATTACTTATAAATTAGGG - Intergenic
1004295921 6:14410437-14410459 ATGTGATTAATTATAAAGTAAGG + Intergenic
1005457865 6:26038767-26038789 ATGCAATTATTGATATCTTAGGG - Intergenic
1005898987 6:30201158-30201180 ATACTATTAATGATTATGTATGG + Intronic
1009755032 6:67927347-67927369 ATGTTATTAATGACATAGTAAGG - Intergenic
1009927695 6:70139804-70139826 ATGATTTTATAGATAAAGAAAGG + Intronic
1010775647 6:79881811-79881833 ATGTTATTATTCATAAAGTAGGG - Intergenic
1011813829 6:91164824-91164846 ATGCCATTATAAATAAAGGATGG - Intergenic
1011846485 6:91569739-91569761 ATAATATTATCTATAAAGTAAGG + Intergenic
1011939895 6:92829980-92830002 ATACTATTATTGTTAAATTTTGG + Intergenic
1012018402 6:93883208-93883230 ATTCTATTATTCATTAAGGAGGG - Intergenic
1012242895 6:96894341-96894363 GGGCTATTCTTGGTAAAGTAAGG - Intronic
1012882698 6:104810146-104810168 ATGATATTATTCATAAATTCAGG + Intronic
1014053375 6:116983607-116983629 ATGCGATTATTGTTATAGTAGGG + Intergenic
1014190027 6:118484983-118485005 ATTTTAGGATTGATAAAGTATGG + Intronic
1014512093 6:122335546-122335568 ATAATATTATTGAAAAAGTAAGG + Intergenic
1014843684 6:126250129-126250151 ATGCTATTATAGAATAAGAAGGG + Intergenic
1016872636 6:148834018-148834040 ATGCTGTTATTGAAACAATATGG + Intronic
1017933945 6:158987463-158987485 GTGTTATTATTGATAAAGCAAGG + Intronic
1018498990 6:164382421-164382443 ATGCTATTAGTGATGAGGTAGGG + Intergenic
1018700400 6:166421840-166421862 ATATTAATATTGATTAAGTAAGG + Intronic
1020743001 7:12045812-12045834 ATGCTATTATTTATGAAGGAAGG - Intergenic
1021387484 7:20049898-20049920 ATGAAATAATTGCTAAAGTAAGG + Intergenic
1021780242 7:24098393-24098415 AGGTTATTATTGATAAATAAAGG + Intergenic
1023141099 7:37103292-37103314 TTGCTTTTTTTGGTAAAGTAAGG + Intronic
1024409041 7:49017433-49017455 ATGATGTTATTGATATATTATGG - Intergenic
1024440819 7:49415644-49415666 AATCTATTATTAATAAAGGATGG - Intergenic
1024730200 7:52245196-52245218 ATTCTACTATTGATATAGTTTGG - Intergenic
1025264961 7:57449320-57449342 ATGCTATTCTTGTGATAGTAAGG - Intergenic
1027008152 7:74715234-74715256 ATGCAAATATTGATAAGGTCAGG + Intronic
1028042100 7:86065520-86065542 ATGATGTTATTTATAAAGTTGGG - Intergenic
1028206960 7:88029088-88029110 ATGTTATTATTGATAAATAAGGG + Intronic
1028778720 7:94709719-94709741 ATGATATTATTGTGGAAGTAAGG - Intergenic
1029624338 7:101710407-101710429 ATGCAATTATTTATTAAGTATGG - Intergenic
1030759934 7:113337819-113337841 ATGCTAGTATTGTTAATGAAGGG + Intergenic
1031566234 7:123300179-123300201 ATGTTATTATTGATAAATAAAGG - Intergenic
1032308882 7:130763602-130763624 ATGCCATTATGGAAACAGTATGG - Intergenic
1032596727 7:133248306-133248328 CAGCTATTATTACTAAAGTATGG - Intergenic
1033434979 7:141325062-141325084 ATGCTCTTAGTGATAAGGGAAGG + Intronic
1033577735 7:142702210-142702232 GTGCTATTATTATTCAAGTATGG - Intergenic
1033665844 7:143439720-143439742 ATGGAATTCATGATAAAGTATGG + Intergenic
1034741767 7:153480593-153480615 AAGCTATTCTTCATAAATTAAGG + Intergenic
1036051303 8:5201462-5201484 ATGACATTATTTATAAGGTAAGG - Intergenic
1036957385 8:13202992-13203014 AAGCTAATTTTGATAAAGAAAGG - Intronic
1037233814 8:16692739-16692761 ATGCCATTATTTAAAAAGAATGG + Intergenic
1037293558 8:17376886-17376908 TTACTATTATTGATAATTTAGGG - Intronic
1038365763 8:26932217-26932239 ATCCTATTGTTGATAAAGTTGGG - Intergenic
1039186596 8:34924087-34924109 TTACACTTATTGATAAAGTAGGG + Intergenic
1040542070 8:48368489-48368511 AAGTAATTATTGATACAGTAGGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040850406 8:51895904-51895926 ATACTAACATTAATAAAGTATGG - Intronic
1041534549 8:58911482-58911504 ATACTATTTTTAATAATGTAAGG + Intronic
1041814948 8:61959812-61959834 ATGCTATAATTGATCAGATAGGG + Intergenic
1042202738 8:66296790-66296812 ATGCAATTATTGATACATTATGG + Intergenic
1042517176 8:69671687-69671709 ATTCTATCTCTGATAAAGTAGGG + Exonic
1042849113 8:73198288-73198310 ACGCGATTACTGATGAAGTAGGG + Intergenic
1043839249 8:85082890-85082912 AAACTATAATTGATGAAGTATGG - Intergenic
1044165160 8:88973218-88973240 ATTCAATTATTTCTAAAGTATGG + Intergenic
1046516614 8:115270549-115270571 ATGCTGTTTTTGGTAATGTAAGG - Intergenic
1047591476 8:126331633-126331655 ATTCTGTCATTGATAAAGTCAGG + Intergenic
1047988835 8:130264543-130264565 TTGCTAGTATTGATCAAGAAAGG - Intronic
1048248522 8:132836471-132836493 ATGTTATTTTTCATAAAGAAAGG - Intronic
1048710646 8:137206480-137206502 AGCCTATCATTGATAATGTAAGG - Intergenic
1050962845 9:11758544-11758566 ATGCAATTATTGACAAAGGCAGG - Intergenic
1051056136 9:12989041-12989063 TTTTTATTTTTGATAAAGTAAGG + Intergenic
1052424421 9:28285996-28286018 TTGCCTTTATGGATAAAGTATGG - Intronic
1053193403 9:36094593-36094615 ATGTAATTATTGATACAGTTGGG - Intronic
1053639968 9:40063775-40063797 ATGCTAATATTGATGAATTTTGG + Intergenic
1053677906 9:40456012-40456034 ATGTTATTATTGTTACATTAGGG - Intergenic
1053766165 9:41401708-41401730 ATGCTAATATTGATGAATTTTGG - Intergenic
1053927821 9:43083843-43083865 ATGTTATTATTGTTACATTAGGG - Intergenic
1054285823 9:63168943-63168965 ATGTTATTATTGTTACATTAGGG + Intergenic
1054290979 9:63291538-63291560 ATGTTATTATTGTTACATTAGGG - Intergenic
1054320719 9:63660090-63660112 ATGCTAATATTGATGAATTTTGG + Intergenic
1054389000 9:64596085-64596107 ATGTTATTATTGTTACATTAGGG - Intergenic
1054506718 9:65920286-65920308 ATGTTATTATTGTTACATTAGGG + Intergenic
1054544781 9:66312863-66312885 ATGCTAATATTGATGAATTTTGG - Intergenic
1054824339 9:69557121-69557143 ATACTATTATTCATAAAACATGG + Intronic
1054960909 9:70968207-70968229 GTGCTTATATTGATAAATTAAGG + Intronic
1055818412 9:80233560-80233582 ATTTTATAATTGAAAAAGTAGGG + Intergenic
1056267448 9:84913038-84913060 ATGCAATTATTGATATGTTAGGG + Intronic
1057296140 9:93843110-93843132 ATGTTATTATTGATTAAATGTGG + Intergenic
1057714239 9:97477417-97477439 ATGCTATTCTTCAAAAAGTCAGG - Intronic
1058342747 9:103919031-103919053 ATCATATTTTTGATTAAGTAGGG + Intergenic
1058444990 9:105046916-105046938 ATGCTAATAAAAATAAAGTACGG + Intergenic
1059016596 9:110523500-110523522 ATGTAATTATTGATATGGTAGGG - Intronic
1059249263 9:112873594-112873616 ATGATATTTTTGATAATGTAAGG + Exonic
1059614880 9:115938704-115938726 ATTCTATTACTAATAAAGGAAGG - Intergenic
1059869148 9:118551704-118551726 ATGCTTTTAATAATAAAGGAAGG - Intergenic
1060125263 9:121038586-121038608 ATGCTTTTGTTTAAAAAGTAGGG - Intronic
1202787788 9_KI270719v1_random:47161-47183 ATGCTAATATTGATGAATTTTGG + Intergenic
1187618333 X:21022278-21022300 ATGTTATTATTGATAAGTAAGGG - Intergenic
1187909147 X:24094238-24094260 ATGCTAACATTGATACAGTCAGG + Intergenic
1188211852 X:27435116-27435138 ATTTTATTTTTGATAAAGCAGGG + Intergenic
1188638588 X:32467984-32468006 GTGCTATTATATATAAAATATGG - Intronic
1188749822 X:33891523-33891545 ATGGTAATATTGGAAAAGTAGGG + Intergenic
1188765665 X:34088369-34088391 AAGCTGTCATTGATAAATTAAGG + Intergenic
1189563126 X:42211507-42211529 ATGCTATTAAAGATAAAAAATGG - Intergenic
1189621223 X:42840622-42840644 ATGCTATAAATGATAAAAAATGG - Intergenic
1190457076 X:50637020-50637042 ATACTAGTATTGATAATATAGGG + Intronic
1191949057 X:66568800-66568822 ATGTTATTATTGATAAGTAAAGG + Intergenic
1193298133 X:79855915-79855937 ATGCTATCAGTGATAAAGTGAGG - Intergenic
1193511458 X:82405313-82405335 AAGCCATTATGGAAAAAGTATGG - Intergenic
1194158431 X:90422029-90422051 ATGCTATTATTGTTAAGTTTTGG - Intergenic
1194227091 X:91274258-91274280 AAGCTGTTAATGATAATGTATGG - Intergenic
1194264735 X:91740387-91740409 ATGTTATTATTGATAAGTAAGGG + Intergenic
1194582370 X:95691606-95691628 ATAATATAATTTATAAAGTATGG + Intergenic
1194878290 X:99218048-99218070 ATGTGATTATTGATATATTAGGG - Intergenic
1195599709 X:106731959-106731981 ATGCTATTACTTATAAATTTTGG + Intronic
1196252494 X:113478929-113478951 ATGTTATTATTGATAAGTAAGGG + Intergenic
1198143351 X:133828552-133828574 ATGTAATTACTGATAAAGTAGGG - Intronic
1200504749 Y:3998996-3999018 ATGCTATTATTGTTAAGTTTTGG - Intergenic