ID: 1098587429

View in Genome Browser
Species Human (GRCh38)
Location 12:72170615-72170637
Sequence CTGGCTCCATAGATCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098587422_1098587429 30 Left 1098587422 12:72170562-72170584 CCACCTGGAGTGGTTGTTCAAGC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1098587429 12:72170615-72170637 CTGGCTCCATAGATCTAGGATGG 0: 1
1: 0
2: 0
3: 15
4: 134
1098587423_1098587429 27 Left 1098587423 12:72170565-72170587 CCTGGAGTGGTTGTTCAAGCAAG 0: 1
1: 0
2: 0
3: 17
4: 402
Right 1098587429 12:72170615-72170637 CTGGCTCCATAGATCTAGGATGG 0: 1
1: 0
2: 0
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098587429 Original CRISPR CTGGCTCCATAGATCTAGGA TGG Intronic
900545904 1:3229127-3229149 CTTGCTCCATGGATGCAGGAGGG - Intronic
901823292 1:11844211-11844233 CTGGCTCCTGAGGTCTGGGATGG - Intergenic
903146805 1:21378406-21378428 GTGGCACCATAAATCAAGGAAGG + Intergenic
907114401 1:51956218-51956240 CTGACTCCTTAGAGCTAGAAGGG - Intronic
907282327 1:53359341-53359363 CTGAGTGCATTGATCTAGGATGG - Intergenic
908827339 1:68146452-68146474 CTGATTCCATATATCTAGGGAGG - Intronic
912892062 1:113544157-113544179 CTGGCTCCCTGGCTCAAGGAAGG - Intronic
917173308 1:172201772-172201794 CTGGCTCGATAGCTCTGGCAGGG + Intronic
918268855 1:182875319-182875341 CTGACTCAGTAGATCTAGGGTGG - Intronic
1062933790 10:1369993-1370015 CTGTCTCCATTGATCTAACAAGG - Intronic
1064074744 10:12259643-12259665 GTGGCTACATTGATCTGGGAGGG - Intergenic
1070439394 10:76428485-76428507 CTGGATCGATGGATCTATGATGG - Intronic
1072883478 10:99251476-99251498 CTGGCTCCATAGAATTAGGGAGG - Intergenic
1074156431 10:110804269-110804291 CTTGCTCCAGAGCTCTAGGTGGG - Intronic
1074824471 10:117204629-117204651 CTGGCTCAGTAGGTCTAGAATGG - Intronic
1078083904 11:8222470-8222492 CTGGACCCTTAGGTCTAGGATGG - Intergenic
1078543421 11:12229238-12229260 GTGGCTCCCTATCTCTAGGAAGG + Intronic
1078704974 11:13734738-13734760 CTGACTCAATAGATCTGGGGTGG - Intergenic
1080943427 11:36944654-36944676 CTGTCTCCTTGTATCTAGGATGG + Intergenic
1083582327 11:63832845-63832867 CTGGCTCCAGGGAGGTAGGAAGG - Intergenic
1084668823 11:70593060-70593082 CTGGCCCCATAGTTCGGGGAAGG + Intronic
1084953532 11:72679468-72679490 GTGGCTGCATTGGTCTAGGAGGG + Intergenic
1086407197 11:86508511-86508533 CTGGCACCATATATTTAGCAAGG + Intronic
1087239708 11:95761284-95761306 CCTGCTGCATTGATCTAGGATGG - Intergenic
1095409218 12:41903945-41903967 CTGATTACATAGGTCTAGGATGG - Intergenic
1096483755 12:51961720-51961742 CTGGCTCAATAGAGCAGGGAAGG - Intronic
1098128461 12:67323484-67323506 CTGGCTCAATAGCTCTGGCAGGG - Intergenic
1098474792 12:70887879-70887901 CTGATTCCATAGTTCTAGGATGG - Intronic
1098587429 12:72170615-72170637 CTGGCTCCATAGATCTAGGATGG + Intronic
1099062274 12:77926717-77926739 CGGATTCAATAGATCTAGGATGG + Intronic
1099667748 12:85653605-85653627 CTGGCTCCATAGCTCTAAAAGGG + Intergenic
1101812143 12:108116550-108116572 CTGGCTCTATAGGTCTGGGTTGG + Intergenic
1106757795 13:32839915-32839937 CTGATTCCATAGGTCTGGGATGG + Intergenic
1107079848 13:36363036-36363058 CTGATTCAATAGGTCTAGGATGG + Intronic
1108111299 13:47076270-47076292 CTGGCCCCATAGAGTTAGGGAGG - Intergenic
1111283646 13:86061213-86061235 CTGCCTCCATAAATTTATGAAGG - Intergenic
1114539884 14:23447045-23447067 ATGTCTCAATAGATCTAGGCTGG - Intergenic
1121036157 14:90705411-90705433 CTGGCCCAACAGCTCTAGGAGGG + Intronic
1121657711 14:95609959-95609981 TTGGCTCCATCCATCTGGGATGG + Intergenic
1122317564 14:100835081-100835103 GTGGCTCCATAGAGGTAGGCCGG + Intergenic
1123513625 15:21017584-21017606 CTGGCGCCATAGCAGTAGGATGG + Intergenic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1125015270 15:34927507-34927529 CTGGCTGCAGAGAACTTGGAAGG + Intronic
1125825074 15:42669374-42669396 CTGGTTCCAGAGGTCAAGGAGGG + Intronic
1126992434 15:54395442-54395464 CTGACTCCACAGATTTGGGATGG - Intronic
1127392204 15:58515055-58515077 CTGGCTTTAAAGATATAGGAAGG - Intronic
1127531584 15:59848631-59848653 ATGACTCCATAGATGTAGGAAGG + Intergenic
1129390099 15:75216061-75216083 CTGGCACCATAGATCTCGGTGGG + Intergenic
1134012227 16:10863384-10863406 CTGGCTTCAGAGATGAAGGAAGG - Intergenic
1135594459 16:23731049-23731071 CTGACTCAATAGATCTGGGGTGG - Intergenic
1136716974 16:32289030-32289052 CTGGGTCCATGGCTCTGGGAGGG + Intergenic
1136835351 16:33495275-33495297 CTGGGTCCATGGCTCTGGGAGGG + Intergenic
1138165066 16:54793711-54793733 CTGGGTCACTAGATCTGGGAAGG + Intergenic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1203009452 16_KI270728v1_random:228757-228779 CTGGGTCCATGGCTCTGGGAGGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148758172 17:49985516-49985538 CTGCCTCCACAGAGCTAGGATGG + Intergenic
1151204835 17:72498801-72498823 CTGACTCCATAGGTCTGGCATGG + Intergenic
1151892716 17:76960161-76960183 CTGGCTCTAAAGATGCAGGAAGG - Intergenic
1152281875 17:79389658-79389680 CTGACTCCAGAGATCTGGGGTGG + Intronic
1154113336 18:11589559-11589581 CAGGCTCCACAGATCAAGGATGG + Intergenic
1154181375 18:12142558-12142580 CTGGCTCCATAGGTCTGGCGAGG + Intergenic
1154182529 18:12149026-12149048 CTGGCTCCATAGGTCTGGCGAGG - Intergenic
1157172714 18:45422700-45422722 CTGGCTCCATTGATGGAGCAGGG - Intronic
1159526510 18:69598804-69598826 CTGGGTGCATAAATCTTGGATGG + Intronic
1161069737 19:2254095-2254117 CTGGGTCCTTGGATCTTGGAGGG - Intronic
1164061516 19:21679414-21679436 CTGGCTCCATAAACTGAGGAGGG + Intergenic
1164109359 19:22140420-22140442 CTGGCCCCACAGGTCAAGGAGGG + Intergenic
1164662303 19:29986507-29986529 CTGGATTCATAGATCACGGAAGG - Intronic
1166153338 19:40891211-40891233 CTGGCACCATGGAGCTGGGAGGG + Intronic
1166679578 19:44758643-44758665 CTGGATCCAGTGAGCTAGGAGGG + Intronic
1166911703 19:46163688-46163710 CTGGCTTCATAGCTCTGGCAGGG + Intergenic
926798754 2:16640522-16640544 CTGCCTCCATAAATCTAGGCAGG - Intronic
928275052 2:29893045-29893067 ATGGCCCCATAAATCAAGGAGGG - Intronic
929726344 2:44432007-44432029 CTGGGTCCAAAAATCTTGGATGG + Intronic
929749175 2:44691938-44691960 CTGGCTCCACAAATATAGGGAGG + Intronic
931543380 2:63353964-63353986 CTGGCTCAATAGCTCTGGCAGGG - Intronic
932744737 2:74324463-74324485 CTGATTCCATAGCTCTAGGTTGG + Intronic
935490789 2:103717352-103717374 CTGGCTCCATAGCCTTAGAAGGG - Intergenic
1169829802 20:9811846-9811868 CTGACTCCATAGTTTTTGGAGGG - Intronic
1169995903 20:11556329-11556351 CTGATTCAGTAGATCTAGGATGG - Intergenic
1170164668 20:13348658-13348680 CTGGCTCCATAGGTTTATTATGG + Intergenic
1172024721 20:31940470-31940492 GTGACTCCATAGGTCTAGGGTGG + Intronic
1173806178 20:45926838-45926860 CCGGCTGCATAGATTTAGAAAGG - Intergenic
1176977069 21:15334601-15334623 CTGGCTCAATAGCTCTGGCAGGG + Intergenic
1178382646 21:32123680-32123702 CTGGCTACATAGATCTGGGGAGG - Intergenic
1179638167 21:42727740-42727762 CTCGCTTCTTAGTTCTAGGAGGG + Intronic
1179898789 21:44378162-44378184 CTGGCACCACGGATCTGGGATGG - Intronic
949842324 3:8333356-8333378 CTGATTCCGTAGATCTGGGATGG - Intergenic
951357833 3:21690752-21690774 CTGATTCCATAGGTCTAGGGTGG - Intronic
951938833 3:28054551-28054573 CTGGTTCTGTAGATCTGGGAAGG - Intergenic
955650830 3:61192097-61192119 CTGCCTTCATAGTTCTAAGATGG - Intronic
956347550 3:68297481-68297503 CTGACTCCACAGATCTAGGGTGG + Intronic
958128169 3:89384054-89384076 ATGGCTCCAAAGATCGAGGAGGG - Intronic
958616187 3:96495692-96495714 CTGCCTCCATAGATTGAGTATGG - Intergenic
960358339 3:116679947-116679969 CTGGCTCCATGGCTCCATGAAGG - Intronic
965611471 3:170548391-170548413 CTGCCTCCTTAGGTCTAGAATGG + Intronic
966913962 3:184574854-184574876 CTGGCTCAAAAGAGCTAGGGTGG + Intronic
967306141 3:188061330-188061352 CTGGCTCCATATCTGAAGGAAGG + Intergenic
969258021 4:6015777-6015799 CTGGCTCCAAAGATGAAGGCAGG - Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
970874007 4:20848591-20848613 CTGGCTCCAAAGATTAATGATGG + Intronic
972097064 4:35361231-35361253 CTGGCTTCATGGAATTAGGAAGG + Intergenic
974653084 4:64780749-64780771 CTGGGTCAATGGATCTAGGCTGG + Intergenic
975627681 4:76365790-76365812 CTGACTCAGTAGGTCTAGGATGG - Intronic
976815975 4:89148781-89148803 CATGCTCCATAGATCTTGGTGGG - Intergenic
977649541 4:99454105-99454127 CTGGCTTAATAGGTCTGGGAGGG + Intergenic
978559923 4:110022263-110022285 ATAGTTCCATAGGTCTAGGATGG + Intergenic
981335004 4:143559803-143559825 CTGGGTCCATTGCTCCAGGAAGG - Intergenic
992496290 5:77297452-77297474 CTGATTCAATAGATCTCGGATGG + Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
999585839 5:153088684-153088706 CTGGCTCTCTACAGCTAGGAGGG + Intergenic
1001709953 5:173770278-173770300 CTGGCTCTATAGTTATAGGACGG + Intergenic
1003607902 6:7581433-7581455 CTGGCTCCTTAGTTCCAAGATGG - Exonic
1008044757 6:46840364-46840386 CTGGGTCAGTAGATCTAGGGTGG + Intergenic
1008148926 6:47926525-47926547 CTGATTCAATAGATCTTGGATGG - Intronic
1012290083 6:97443630-97443652 CTGGCTCCCCAGATGTAGCATGG + Intergenic
1015331884 6:131989508-131989530 CTGGCTCCATAAATCTGAGTGGG + Intergenic
1017344971 6:153369866-153369888 CTAGCTCAATAGCTCTGGGAGGG - Intergenic
1022838175 7:34136629-34136651 CTTGTTCCACATATCTAGGAAGG - Intronic
1026205856 7:68256649-68256671 CTGACTCAATAGGTCTAGGGTGG + Intergenic
1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG + Intronic
1026743103 7:72990963-72990985 CTGGCTCCAAAGGTCTCTGAAGG + Intergenic
1026802973 7:73411416-73411438 CTGGCTCCAAAGGTCTCTGAAGG + Intergenic
1027029218 7:74875667-74875689 CTGGCTCCAAAGGTCTCTGAAGG + Intergenic
1027100632 7:75374115-75374137 CTGGCTCCAAAGGTCTCTGAAGG - Intergenic
1028083285 7:86603207-86603229 CTGACTTCATAGAGTTAGGAGGG - Intergenic
1041561803 8:59226531-59226553 CTGGCTCAATAGCTCTGGCAGGG - Intergenic
1041836340 8:62220142-62220164 CTGACTCCATTTATCGAGGATGG + Intergenic
1041952459 8:63518801-63518823 GTGGCTCCATTCATCTAGAATGG - Intergenic
1045911011 8:107409989-107410011 CTGGCTCAATAAATCTTGGATGG - Intronic
1049545654 8:143229399-143229421 CTGGCTCCAGGGATAGAGGAGGG + Intergenic
1050051374 9:1605273-1605295 CTGATTCAGTAGATCTAGGATGG + Intergenic
1051728317 9:20111630-20111652 CTGTCTCAGTAGGTCTAGGAGGG - Intergenic
1056914260 9:90730800-90730822 CTGGCTCCCCAGTTCCAGGAGGG + Intergenic
1057492198 9:95529121-95529143 CTGACTCAATAGATCTTGGCGGG - Intergenic
1058377412 9:104339318-104339340 CTGACTCTGTAGATCTAGGCAGG - Intergenic
1058754255 9:108069909-108069931 CTGTTTTCATAGCTCTAGGATGG - Intergenic
1188283902 X:28304695-28304717 CTGACTCCATCGATCTAGGTTGG + Intergenic
1190386503 X:49886849-49886871 CTGGTTCAGTAGATCTGGGATGG + Intergenic
1190788506 X:53677218-53677240 CTGATTCTGTAGATCTAGGAGGG - Intronic
1193498030 X:82238024-82238046 CTGGCTCAATAGCTCTAGCAGGG + Intergenic
1194427781 X:93761449-93761471 CTGATTCGATAGATGTAGGATGG + Intergenic
1195583254 X:106532351-106532373 CTGGCTCCATTCAACTAGGGAGG + Intergenic
1196018437 X:110964372-110964394 CTGACTCCATAGGTCTGGGGTGG + Intronic
1197158535 X:123297143-123297165 CTGATTCCATAGGTCTGGGATGG - Intronic
1197270788 X:124422973-124422995 CTGATTCAATAGATCTAGGGTGG - Intronic
1197780854 X:130158478-130158500 CTGATTCAATAGATCTGGGATGG + Intronic
1198500434 X:137239443-137239465 CTGATTCAATAGGTCTAGGATGG + Intergenic
1200361978 X:155616659-155616681 CTATCTCCATAAATCTATGAGGG + Intronic