ID: 1098591450

View in Genome Browser
Species Human (GRCh38)
Location 12:72218765-72218787
Sequence CCTTATAAGAAGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1185
Summary {0: 1, 1: 0, 2: 24, 3: 181, 4: 979}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098591450_1098591456 -2 Left 1098591450 12:72218765-72218787 CCCTCTCCCTTCTTCTTATAAGG 0: 1
1: 0
2: 24
3: 181
4: 979
Right 1098591456 12:72218786-72218808 GGAGACTTGTTATTGGATTTAGG 0: 1
1: 7
2: 115
3: 299
4: 933
1098591450_1098591458 15 Left 1098591450 12:72218765-72218787 CCCTCTCCCTTCTTCTTATAAGG 0: 1
1: 0
2: 24
3: 181
4: 979
Right 1098591458 12:72218803-72218825 TTTAGGGCCCACCCAAAATCTGG 0: 1
1: 2
2: 13
3: 39
4: 143
1098591450_1098591457 -1 Left 1098591450 12:72218765-72218787 CCCTCTCCCTTCTTCTTATAAGG 0: 1
1: 0
2: 24
3: 181
4: 979
Right 1098591457 12:72218787-72218809 GAGACTTGTTATTGGATTTAGGG 0: 1
1: 7
2: 123
3: 321
4: 829
1098591450_1098591455 -9 Left 1098591450 12:72218765-72218787 CCCTCTCCCTTCTTCTTATAAGG 0: 1
1: 0
2: 24
3: 181
4: 979
Right 1098591455 12:72218779-72218801 CTTATAAGGAGACTTGTTATTGG 0: 1
1: 4
2: 66
3: 235
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098591450 Original CRISPR CCTTATAAGAAGAAGGGAGA GGG (reversed) Intronic
900607086 1:3528606-3528628 CCTTATAAGAGGGAGGCAGGAGG + Intronic
900761406 1:4473962-4473984 CCTTATAAGAAGAGGAGACTAGG - Intergenic
900901714 1:5521158-5521180 CCTTATAAGAAGAGGAGATTTGG - Intergenic
901395867 1:8981151-8981173 CCTTATAAGAGAAAAGCAGACGG - Intergenic
901473564 1:9473909-9473931 GCTTATAAGAAGAGGAGACATGG - Intergenic
901765809 1:11499333-11499355 CCTTAGAAGAAGAAAGCTGATGG - Intronic
902246701 1:15125334-15125356 CCTTATAAGAAGAGGCGATTTGG - Intergenic
902574218 1:17367146-17367168 CCTTATAAGGGGGAGGCAGAGGG - Intergenic
902666180 1:17940259-17940281 CCTTATAAGAAGGAGGCAGGAGG - Intergenic
902753238 1:18532017-18532039 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
902981824 1:20128884-20128906 CCTTATGAGAAGAAGAGATCAGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903690918 1:25172990-25173012 ATTTATAAGAAGAAAGGTGAAGG + Intergenic
904252236 1:29233339-29233361 CCTTGAGAGAAGAAGGAAGAAGG - Intergenic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
904968559 1:34400551-34400573 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
904974308 1:34444081-34444103 CCATATTAGAGGAAGGCAGAGGG - Intergenic
904982816 1:34521281-34521303 CCTTATAAGAGGAAGGCAAGAGG - Intergenic
905475963 1:38228240-38228262 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
906042650 1:42800409-42800431 CCTCTTAGGAACAAGGGAGAAGG + Intergenic
906192622 1:43907705-43907727 CCTGAGAAGGTGAAGGGAGATGG - Intronic
906301723 1:44687257-44687279 CCTTATAAGAAGAGGTGACTAGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907547495 1:55274910-55274932 CCGTACAAGAAGTAAGGAGAGGG + Intergenic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
908859151 1:68463813-68463835 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
908886165 1:68791369-68791391 CCTTATAAGAAGAGGAGATGAGG + Intergenic
909287256 1:73836081-73836103 CCTAAGGAGAAGAAGAGAGAAGG + Intergenic
909471498 1:76033941-76033963 CCTTATAAGAAGAGGAGACATGG + Intergenic
909771224 1:79424689-79424711 TCTTATAAGAAGGAGCCAGAAGG - Intergenic
909808484 1:79901703-79901725 CATTATAAGAGGAAAGGAGGAGG + Intergenic
910498164 1:87856728-87856750 CCTTATAAGAGGAAAGCAGAGGG - Intergenic
910502343 1:87907219-87907241 CCCTATAAGAAAAAGGCAAAGGG - Intergenic
910504320 1:87932428-87932450 CCTTCTAGGAAGAAGCCAGAGGG + Intergenic
910551565 1:88481329-88481351 CCTTATAAGAAGAGGAGATGAGG + Intergenic
910918314 1:92315224-92315246 CCTGAGAAGAGGAAGCGAGATGG + Intronic
912477130 1:109945971-109945993 CCTTATAAGAGGAAGGCAGGGGG - Intergenic
912668713 1:111606378-111606400 TTTTATAAGAAGAAGGTAGCTGG + Intronic
913965068 1:143370059-143370081 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914059444 1:144195661-144195683 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914119706 1:144770710-144770732 CTTTATAACAAGAGGAGAGAAGG - Intergenic
914324176 1:146595336-146595358 TGTTATAGGAAGAAGTGAGAGGG - Intergenic
914334424 1:146701531-146701553 CCTTATATGAGGGAGGCAGAGGG - Intergenic
914776172 1:150737552-150737574 CCTTATAATATGCAAGGAGAAGG - Intronic
914825196 1:151134442-151134464 CCATCTATGAAGAAGGGACAGGG + Exonic
915075249 1:153302847-153302869 GCGTATAAGCAGAAGGGAAAGGG + Intronic
915607161 1:156959822-156959844 GATTAGAAGGAGAAGGGAGACGG + Intronic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
916181691 1:162089661-162089683 CCTTACAAGAGGGAGGGAGGGGG + Intronic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916512293 1:165482968-165482990 CCTTATAAAAAGAAGAGATGAGG + Intergenic
916632888 1:166636002-166636024 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
916757108 1:167782755-167782777 CCTTAGAAGAGGGAGGCAGAAGG + Intronic
916801885 1:168223572-168223594 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
917616768 1:176753888-176753910 CCATAAAATAAGAAGGAAGAAGG + Intronic
917853719 1:179085477-179085499 CCTTAGAATAAGAAGCCAGAGGG - Intronic
917902322 1:179554907-179554929 CCTTATAAGAGGGAGGCAAATGG + Intronic
918269481 1:182883339-182883361 CCAAATACAAAGAAGGGAGATGG - Exonic
918706304 1:187667036-187667058 CCTTATAAGAAGAAGAAATTTGG - Intergenic
918743909 1:188173770-188173792 CCTTATAAGAGGGAGGCAGATGG + Intergenic
918768967 1:188528570-188528592 CTTTATAAGAGGAAGGCCGAGGG - Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
919410096 1:197232037-197232059 CCTTATAAGAGAAAGGTAGGAGG + Intergenic
920236652 1:204511439-204511461 CCTCATAAGAAGAGGGGATTAGG + Intergenic
920282976 1:204858218-204858240 CCTTATAAGAAGAGGAGATTAGG - Intronic
920334433 1:205235141-205235163 CCTTATATGAAGCAGGCAGAGGG + Intronic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
920989591 1:210923978-210924000 CCTTATAAGAAGAGAAGAGATGG + Intronic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
921612754 1:217231650-217231672 CCTTGTAAGAAGAAGAGATTTGG + Intergenic
921777900 1:219124213-219124235 CCTTTAAATAAGAAGGGAGGAGG + Intergenic
921892500 1:220367249-220367271 CCTTTTAAGAAGAGGTCAGAAGG - Intergenic
922135713 1:222824063-222824085 TCTTATAACAAGTTGGGAGATGG - Intergenic
922597148 1:226822914-226822936 CCTTATAAGAGGGAGGCAGGAGG - Intergenic
922881646 1:228985650-228985672 CCTTATAAGAAGAGGAGATGAGG - Intergenic
923064192 1:230503217-230503239 CCTTACAAGAAGAAGAGATTAGG + Intergenic
923123115 1:231012514-231012536 CCTTATAAGAAAGAAGCAGAGGG - Intergenic
923374767 1:233350055-233350077 GCTAATTAGAAGAGGGGAGAGGG - Intronic
923773906 1:236961358-236961380 CCTTATAAGAGGGAGGCTGAGGG - Intergenic
923889507 1:238196815-238196837 CCTTATAAGGAGAGGGGATTTGG + Intergenic
924322681 1:242865460-242865482 CCTTATAAAAAGGAGAGAGTAGG + Intergenic
924513680 1:244749105-244749127 CCTTATAAGAAGAGGGGATTAGG + Intergenic
924849648 1:247812994-247813016 CATTATAATAAGAAGGGACTTGG + Intergenic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1062957675 10:1551119-1551141 CCTTATAAGAAGAGGAGATGAGG + Intronic
1063477859 10:6344364-6344386 GCTTATAAGAACCAGGGAGGAGG + Intergenic
1064447895 10:15412768-15412790 CCTTATAAGAAAAGGAGATAAGG - Intergenic
1064884315 10:20092775-20092797 CTTTATAAGAGGAAGGGAAAGGG + Intronic
1065002802 10:21352444-21352466 CCTTATAAGAAGAGGAGACTAGG - Intergenic
1065111837 10:22448050-22448072 TCTTAAAAAAAGAAGGGAGTGGG - Intronic
1065341652 10:24712259-24712281 CCTTACAAGAGAAAGGCAGATGG + Intronic
1065350902 10:24794970-24794992 CCTTATAAGAAGAAGAGATTAGG - Intergenic
1065620496 10:27576207-27576229 CCTTATAAGAGGTAGGCAGAGGG - Intergenic
1065694969 10:28371351-28371373 TCTTATAAGAGGGAGGCAGAGGG - Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066147375 10:32575621-32575643 CCTTGTTGGAAAAAGGGAGAAGG + Intronic
1066657313 10:37708285-37708307 CCTTATAAGAAAGAGGCAGAGGG + Intergenic
1067201862 10:44179821-44179843 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1067244048 10:44521460-44521482 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1067278032 10:44851732-44851754 CCTTGTAAGAAGAGGAGATAAGG - Intergenic
1067549045 10:47220416-47220438 CCTTATAAGAAGAGGAGACTGGG + Intergenic
1067658796 10:48218146-48218168 CCTTATAAGAAGAAGAAATTTGG - Intronic
1068820301 10:61368666-61368688 CCTTATTAGAAGGAGGCAGGAGG - Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069565999 10:69463972-69463994 CTTTATAAGAGAAAGGCAGAGGG + Intronic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069902083 10:71712175-71712197 CCTTACAAGAGAAAGGCAGAGGG - Exonic
1070629443 10:78074475-78074497 CCTTATAAGAAGGAGGCAGGAGG + Intergenic
1070974934 10:80599114-80599136 CTTTTTAAGAAGAAAGGAAATGG - Intronic
1071070672 10:81689868-81689890 CCTTACAAGAGAAAGGCAGAGGG + Intergenic
1071381268 10:85062707-85062729 CCTAAAAAGAAGAAGAAAGACGG - Intergenic
1072326896 10:94307685-94307707 CCTTATGAGAAGAGGGGATTAGG - Intronic
1072918263 10:99553826-99553848 CCTCATAAGAAGAGGGGATCGGG - Intergenic
1073474219 10:103742376-103742398 TCTTATAAGAGAAAGGCAGAAGG - Intronic
1073857830 10:107697631-107697653 CATTAAAAGAGGAAGGGAGGAGG - Intergenic
1073885660 10:108036880-108036902 CCTTATATGAATAAGGCAGAGGG - Intergenic
1074472744 10:113742224-113742246 CCTTACAAGAGGGAGGGGGAAGG - Intergenic
1074657349 10:115607865-115607887 CCATATACGAAGAAGGAATAGGG - Intronic
1074714823 10:116208532-116208554 CCAGATAAGAACAAGGGAGGAGG + Intronic
1074912827 10:117927247-117927269 CCTTATAAGACGGAGGCAGAGGG - Intergenic
1074984117 10:118642217-118642239 ACTGCTAAGAGGAAGGGAGATGG + Intergenic
1075086897 10:119419707-119419729 CCTTCTCAGCAGATGGGAGAAGG - Intronic
1075512600 10:123084428-123084450 CCTTATAGGAGGGAGGGAGAGGG + Intergenic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1075955112 10:126516938-126516960 CCTTACAAGAGGGAGGAAGAAGG - Intronic
1076074646 10:127523455-127523477 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1076327507 10:129637723-129637745 CCTTATAAGAAGAGGAGATTAGG + Intronic
1076565267 10:131394249-131394271 CCTCATAAGAGGGAGGCAGAAGG - Intergenic
1077336368 11:2006675-2006697 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1077363228 11:2150308-2150330 GCTTGAAAGAAAAAGGGAGAGGG - Intronic
1077933545 11:6758721-6758743 CCTTATAAGAGGGAGGTAGCAGG - Intergenic
1078320894 11:10333571-10333593 CCTTATAAGAAGAGGAGATTAGG + Intronic
1078428178 11:11268018-11268040 CCTTAGAAGAAGAAGAGATTTGG + Intergenic
1078437182 11:11335026-11335048 AATTATAACATGAAGGGAGAAGG - Intronic
1078479999 11:11667433-11667455 TCTTACAAGAGGAAGGCAGAGGG - Intergenic
1079448936 11:20582476-20582498 CCTTATGAGAACATGGCAGAAGG + Intergenic
1079653332 11:22958580-22958602 CCTTATAATATGAAGAGAGTTGG - Intergenic
1080063277 11:27980567-27980589 CCTTATAACAAGAAGAGGGCTGG - Intergenic
1080181912 11:29435680-29435702 CCTTATAAAAAGGAGGCAGGAGG - Intergenic
1080473046 11:32564693-32564715 CCTTACAAGAGGGAGAGAGATGG - Intergenic
1080525904 11:33117303-33117325 CATTATAAGAAAAAGGGATCTGG + Intronic
1080617822 11:33960291-33960313 CTTCATAAAGAGAAGGGAGAGGG + Intergenic
1080687834 11:34530132-34530154 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1080934021 11:36842776-36842798 CCTTATAAGAAAGAGGCAGAGGG - Intergenic
1081208978 11:40308559-40308581 CCTTATAAGAGAAAGGCAGGAGG + Intronic
1081370940 11:42302239-42302261 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1082727384 11:56752418-56752440 CCTTACAAGAGGGAGGCAGAGGG + Intergenic
1082919936 11:58482049-58482071 ACTTATAAGAAGTAGGAAGCTGG + Intergenic
1082952632 11:58833497-58833519 CCTTCTAAGAGGGAGGCAGAGGG + Intergenic
1083178831 11:60971472-60971494 TCTTCTAAGAAGAAGGGAAGTGG - Intergenic
1083396202 11:62393964-62393986 CCTCATAAGAAGAGGGGATTAGG - Intergenic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084052648 11:66610460-66610482 CCTTGTAAGAGGGAGGCAGAAGG - Intergenic
1084706983 11:70821243-70821265 CCTTATAAGAAGAGGCGATGAGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1085773850 11:79348078-79348100 TCTTATCAAAAGAAGTGAGAGGG - Intronic
1086037299 11:82432068-82432090 CCTTATAAGAGAAAGGCAGAGGG + Intergenic
1086926029 11:92641603-92641625 CCTTATAAGAGAAAGGCAGAGGG - Intronic
1087141728 11:94770598-94770620 CATTTTAAAAAGAAGGGGGAGGG - Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087211295 11:95448101-95448123 CCTTCTAAGACAAAGGGACATGG - Intergenic
1087464794 11:98490710-98490732 CCCTTTTAGAAGAAGGGTGAAGG + Intergenic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1087980218 11:104603377-104603399 GCTTAAGAGAAGAAGGGTGAGGG + Intergenic
1088141805 11:106625826-106625848 TCTTATAAGAGGAAGGCAGGAGG - Intergenic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1088363073 11:109011436-109011458 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088433093 11:109779918-109779940 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088536014 11:110862265-110862287 CCTGATAAGAGGAAAGGAGCTGG + Intergenic
1088879364 11:113961518-113961540 CCTTATTAGAGGAAGGCAGAAGG - Intergenic
1088903823 11:114138989-114139011 CCTTGTAAGAGGAAGGGAGTAGG - Intronic
1089576742 11:119449765-119449787 CCTTATAAGAAGAGGAGATTTGG + Intergenic
1090285983 11:125499798-125499820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090634412 11:128681697-128681719 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1090681080 11:129057851-129057873 CCTTACAAGAAGAAGGGATTAGG + Intronic
1091269829 11:134300268-134300290 CCTTATAAGAAGAGGAGATTAGG - Intronic
1202819352 11_KI270721v1_random:61857-61879 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1091439791 12:503802-503824 ACTTTTAAGAAGAAGGCAGTAGG - Intronic
1091936392 12:4437978-4438000 CCTTAAAAGAAGAACAGAAATGG + Intronic
1092096478 12:5846756-5846778 CCCTATAAGAGAAAGGCAGAAGG - Intronic
1092850685 12:12623858-12623880 CCTTATAAGACTAAGGTAGAGGG + Intronic
1092907189 12:13112053-13112075 CCTTATGAGAGGGAGGCAGAGGG + Intronic
1093378596 12:18461996-18462018 CCTTATAAGAGGGAGGCAGATGG - Intronic
1093404888 12:18792273-18792295 CCTTCTAAGAGGAAGGCAGGAGG - Intergenic
1094083288 12:26561105-26561127 CCTTATAAGAAGAAGGGATTAGG + Intronic
1094145674 12:27226149-27226171 GCGTATAGGAAGAAGGGAGAAGG + Intergenic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1095309806 12:40685241-40685263 CCTTATAAGAAGGAGGCAATGGG - Intergenic
1095375821 12:41527385-41527407 CCATATTAGAAGAAGTGTGATGG + Intronic
1095494733 12:42772499-42772521 CCTTACAAGAAGGAGGCAGAGGG - Intergenic
1096625399 12:52892392-52892414 CATTACTAGAAGAAGGGGGAAGG + Intergenic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1097054007 12:56239374-56239396 CCTTTTAAGAAGGAGGGATAAGG - Exonic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1097596985 12:61645999-61646021 ACTTAGAAGAAACAGGGAGAAGG - Intergenic
1097712603 12:62933245-62933267 CTTTATAGGATGATGGGAGAAGG + Intronic
1097725184 12:63067070-63067092 GCTTGAAAGCAGAAGGGAGAAGG - Intergenic
1097922076 12:65086633-65086655 ACTTGGGAGAAGAAGGGAGAGGG + Intronic
1098036553 12:66308701-66308723 TCTTATAAGAAGAAGAGATTAGG - Intronic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1098569677 12:71974509-71974531 CCTTATCAGAGGGAGGCAGAAGG - Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098815798 12:75160181-75160203 CCTTATAAGAAGAAGAAATTTGG + Intronic
1098909890 12:76198251-76198273 CCTTACAAGAGGGAGGCAGAGGG - Intergenic
1098936089 12:76480976-76480998 CCTTATAAGAGGAAGCAAGAGGG + Intronic
1098975758 12:76900254-76900276 CCTTACAAAAGGAAGGGAAATGG - Intergenic
1099360170 12:81690937-81690959 CCTTATAAGAAGGAGGCAAAAGG - Intronic
1099613269 12:84903706-84903728 CCTTATAGGAAAGATGGAGAGGG - Intronic
1099724246 12:86404480-86404502 TCTTATAAGAGGGAGGGAGAGGG + Intronic
1100434062 12:94555484-94555506 CCTTATAAGAAGAGAGGGCATGG - Intergenic
1100660075 12:96687174-96687196 CCTTATAAGAGAAAGGCAGGAGG - Intronic
1100930137 12:99599076-99599098 CCTTATAAGAAGGAGACAGAGGG - Intronic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1101039854 12:100744466-100744488 CCTTATAATAAGAAGCCAGAGGG - Intronic
1101054296 12:100896285-100896307 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1101319807 12:103663647-103663669 CCTTATAAAAAGAGGAGAGGTGG - Intronic
1101552378 12:105774688-105774710 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1101586327 12:106088923-106088945 CCTGATAAAATGAAGGGGGAAGG + Intronic
1101738149 12:107479008-107479030 CCTTATGGGAAGGAGGGAAAAGG - Intronic
1102325478 12:111978632-111978654 CCTTATAAAAAGACATGAGAGGG + Intronic
1102448180 12:113019816-113019838 CCTTATAAGAGGGAGGAAGTGGG - Intergenic
1102485062 12:113249930-113249952 CCATTTCAGAAGAAGGGTGATGG - Intronic
1102598387 12:114010796-114010818 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1102731263 12:115112731-115112753 CCTTATAAAGAAAAGGCAGAAGG - Intergenic
1102919558 12:116781645-116781667 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1103027712 12:117587308-117587330 CCTTATAAGATGGAGGGAGGAGG + Intronic
1103644676 12:122381927-122381949 CCCTATAAGAAGAAGTGACCAGG + Intronic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1103963759 12:124625227-124625249 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1104042555 12:125139960-125139982 CCTCATAAGAGGAAGTAAGATGG - Intronic
1104096592 12:125563742-125563764 TCTTATCAGAAAAAAGGAGAGGG + Intronic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1104288286 12:127445389-127445411 ACTTATAAGAAGAGGAGAGTAGG - Intergenic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104337786 12:127916556-127916578 CCTTATTAGAAGGAGGAAGGAGG + Intergenic
1104389004 12:128375544-128375566 CCTTATAAAAAGAAAGGAGAGGG - Intronic
1104404546 12:128506641-128506663 CATTTTCAGAGGAAGGGAGACGG - Intronic
1104479528 12:129095658-129095680 CCTTTTAAGAAGAAGAGATCGGG + Intronic
1104485490 12:129148416-129148438 CCTTAAAAGAAGGAGGCAGGAGG + Intronic
1106260516 13:28062445-28062467 CCTTATAAGAAGAGGAGGCAGGG + Intronic
1106423715 13:29605686-29605708 CCTTAGAAGAAGAAGAGATTAGG + Intergenic
1106490040 13:30212948-30212970 CCTTATAAGAAGAAGCGGTTAGG + Intronic
1106717660 13:32407949-32407971 CCTTAGCAGGAGATGGGAGAGGG + Intronic
1107631829 13:42350621-42350643 CCTTATAAGAGGGAAGCAGAGGG + Intergenic
1107634632 13:42379850-42379872 CCTTATAAGAAGAAGAGATAAGG - Intergenic
1107679497 13:42833664-42833686 TCTTATAAGAGGAAAGTAGAGGG + Intergenic
1107778687 13:43875955-43875977 CCTTATAAGAGAAAGGTAGAGGG + Intronic
1107950331 13:45455562-45455584 CCTTATAAGACACAGGCAGAGGG - Intergenic
1107990807 13:45817561-45817583 CCTTATACGAGGGAGGCAGAGGG + Intronic
1108121280 13:47189909-47189931 CCTTACAAGAGGTAGGCAGAGGG + Intergenic
1108133427 13:47328832-47328854 CCTTATTATAGGAAGGCAGAAGG - Intergenic
1108219650 13:48220170-48220192 CCTTATAAGAGAGAAGGAGAGGG + Intergenic
1108476053 13:50818858-50818880 GCTTATAAGAAGAAGGCAAAGGG - Intronic
1108529605 13:51316652-51316674 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1108623504 13:52206114-52206136 CCTGAAAAAAAGAAGGGTGAGGG - Intergenic
1108663212 13:52604930-52604952 CCTGAAAAAAAGAAGGGTGAGGG + Intergenic
1109278412 13:60327665-60327687 CATTTTGAGAAGAAGGGATACGG - Intergenic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1109894365 13:68664794-68664816 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1110441985 13:75536539-75536561 CCTTATAAGAGGGAGGAAAAAGG + Intronic
1110464247 13:75782814-75782836 CCTTATGAGAGGGAGGAAGAGGG - Intronic
1110605528 13:77427569-77427591 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG + Intergenic
1110830611 13:80026211-80026233 CCTTATAGGAGGAAAGCAGAGGG + Intergenic
1110968852 13:81735603-81735625 CCTTGTAAGAGAAAGGTAGAGGG + Intergenic
1111621009 13:90725943-90725965 CCTTAGAAAAAGAATGCAGAGGG + Intergenic
1111643218 13:90996902-90996924 CCTTATAAAAGAAAGGCAGAGGG + Intergenic
1111820616 13:93209346-93209368 CCTTATAAGAAGGAAGTAGGAGG - Intergenic
1111906363 13:94260521-94260543 CCTTATAAGAAGAAGAGATTAGG - Intronic
1112094594 13:96118266-96118288 CCTTATAAGAAGTAGAGATTAGG + Intronic
1112175848 13:97023216-97023238 CCTTATAAGAGGGAGGCAGCAGG + Intergenic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1113097198 13:106678486-106678508 CCTCATAACAAAAAGGGAGATGG + Intergenic
1113106187 13:106773917-106773939 CCTTTTAAGAGGGAGGGAAAGGG + Intergenic
1113816680 13:113176463-113176485 CCTTATAAGAGGAAGAGAGCCGG + Intergenic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1114573456 14:23692219-23692241 CCTTATAAGAAGAAGAGATTAGG - Intergenic
1115936156 14:38555059-38555081 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1116233936 14:42253769-42253791 CCTTATAAGAGAAATGCAGAGGG - Intergenic
1116236679 14:42287145-42287167 CCTTGTTAAAAGAAGGCAGAAGG - Intergenic
1116479971 14:45385622-45385644 CCTTTCCAAAAGAAGGGAGATGG + Intergenic
1116539529 14:46082169-46082191 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
1117410844 14:55449574-55449596 CCTTATATGACAAAGGCAGAGGG + Intronic
1117626861 14:57649456-57649478 CTTTATAAGAAGCAGGCAGGAGG - Intronic
1117707652 14:58488281-58488303 CCTTTTAAGAAAAAAGGTGAAGG - Intronic
1117868244 14:60171479-60171501 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1117873545 14:60225612-60225634 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1118406764 14:65432108-65432130 AGTTATAAGGAGAAGGGAGGAGG - Intronic
1118790855 14:69091367-69091389 CCATTTCAGAAGAAAGGAGAGGG - Intronic
1118926289 14:70192696-70192718 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1119042305 14:71286050-71286072 TCTTATAAAAAGGAGGCAGAGGG - Intergenic
1119109206 14:71955898-71955920 CCCCATAAGAAAAAGGAAGATGG + Intronic
1119153476 14:72387245-72387267 CCTTATAAAAAAAAGGGAGAGGG + Intronic
1119677673 14:76568001-76568023 CCTTATAAGAGAAAGGCAGGAGG + Intergenic
1119684799 14:76623058-76623080 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
1119689604 14:76661263-76661285 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
1119864447 14:77961546-77961568 CCTTCTAGGAAGGAAGGAGAGGG + Intergenic
1119881980 14:78106839-78106861 CCTTATAAGAAGAAGAGATTTGG + Intergenic
1119942802 14:78659129-78659151 CGTTATAAGAAGGAGTGATAAGG + Intronic
1120039659 14:79738279-79738301 CCTTATAAGAGTGAGGCAGAGGG + Intronic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120747087 14:88162137-88162159 CCTAATAAAAAAAAGGGAGGAGG + Intergenic
1120838263 14:89060479-89060501 TCTTAGAAGAGGGAGGGAGAGGG - Intergenic
1120878131 14:89393239-89393261 TCTTATAAAAAGAAGAGAGGAGG - Intronic
1121497456 14:94403974-94403996 GCTTAGAATAAGAATGGAGAAGG + Intergenic
1121561958 14:94882501-94882523 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1121612389 14:95290429-95290451 CTTTATAAGAGGAAGACAGAGGG + Intronic
1121615358 14:95310385-95310407 CCTTATAAGAAGGAAGCAGGAGG - Intronic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121902223 14:97704081-97704103 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
1121944070 14:98102544-98102566 CCTTATAAGACAAAGGCAGAGGG - Intergenic
1122483064 14:102060242-102060264 CCTTATAAGAGAAAGGCAGAAGG + Intergenic
1122837806 14:104438607-104438629 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1122907731 14:104809862-104809884 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1124901587 15:33828239-33828261 CCTGAGGAGAAGGAGGGAGATGG - Intronic
1125033597 15:35097637-35097659 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1125057514 15:35379158-35379180 CCTTAGAAGAAAGAGGCAGAAGG - Intronic
1125214824 15:37259550-37259572 CCTTACAAGAGGGAGGCAGAAGG - Intergenic
1125270411 15:37932801-37932823 TCTTTCAGGAAGAAGGGAGATGG + Intronic
1125408995 15:39385010-39385032 CCTTATAAGAAGAAGGGACTAGG + Intergenic
1125427941 15:39568329-39568351 CCTTATAAGATGAGGGGATTTGG - Intergenic
1126083393 15:44987432-44987454 CCTTATAAGAGGGAGATAGAGGG - Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127263457 15:57343097-57343119 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1127715559 15:61645775-61645797 CCTTATAAAAGAAAGGCAGAGGG + Intergenic
1127805931 15:62520360-62520382 TCTTCTAAGAAGCATGGAGATGG - Intronic
1127907138 15:63384251-63384273 TCTTTAAAGGAGAAGGGAGAGGG - Intergenic
1128633532 15:69288284-69288306 CCTTTTAAGAAGGAGGCAGGAGG - Intergenic
1129118934 15:73383183-73383205 CCTTATAAGAGGGAGACAGAGGG + Intergenic
1129702934 15:77778239-77778261 CCATATAAGAGGGAGGCAGAGGG - Intronic
1130643482 15:85701943-85701965 TCTTATAAAAAGAAGGGGGTAGG + Intronic
1130905524 15:88238033-88238055 CCTTATAAGAAGAGGAGATTAGG + Intronic
1130977311 15:88787372-88787394 CCTTATAAGAGAGAGGTAGAGGG - Intergenic
1131258645 15:90877243-90877265 CCTTAGTGGAAGAAAGGAGAAGG - Intronic
1131327261 15:91459883-91459905 CCTTATAAGAGGAGGGGATCAGG - Intergenic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1132331420 15:101014708-101014730 CCTTATAAGAAGAGGAGATTAGG - Intronic
1132345773 15:101107894-101107916 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1132906162 16:2283846-2283868 CCTTATAAGAGAAATGCAGAAGG + Intronic
1133278001 16:4649565-4649587 TCTTAACAGAAGAAAGGAGAGGG - Intronic
1133361349 16:5176352-5176374 CCTTATAGGAAGAGGAGAGTAGG + Intergenic
1133703266 16:8329241-8329263 CTTTATAGGAGGAGGGGAGATGG + Intergenic
1133856106 16:9550719-9550741 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1134299951 16:12981805-12981827 CCTTATAAGAAGAGGAGATTAGG + Intronic
1134433910 16:14237356-14237378 TGTTTCAAGAAGAAGGGAGAGGG + Intronic
1134652451 16:15920800-15920822 CCCCAGAAGAAGAATGGAGATGG - Intergenic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1136276285 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1137513611 16:49123303-49123325 CCTTATAAGAAGAGGAGACTTGG - Intergenic
1137604050 16:49775538-49775560 CATTATAAGGACAAGTGAGAGGG - Intronic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1137941911 16:52696198-52696220 CCTTCTAAGAATGAGGCAGAGGG - Intergenic
1138624753 16:58241909-58241931 CCTTACAAGAGGGAGGCAGAAGG - Intronic
1139280294 16:65764774-65764796 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1139509656 16:67419876-67419898 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1139999194 16:71009701-71009723 CCTTATATGAGGGAGGCAGAGGG + Intronic
1140009382 16:71115509-71115531 TGTTATAGGAAGAAGTGAGAGGG + Intronic
1140186066 16:72773537-72773559 ACTTATAAGAAGAAGAGATAGGG - Intergenic
1140422992 16:74836052-74836074 CCTTCTAAGAAGGAGGCAGGAGG - Intergenic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1141007251 16:80363812-80363834 CCTTTATAGATGAAGGGAGAGGG - Intergenic
1141070724 16:80952182-80952204 CCTTATCAGAAAGAGGCAGAGGG + Intergenic
1141277784 16:82603836-82603858 CCTTCTAAGAAGGAGGAAAAGGG + Intergenic
1141476032 16:84274115-84274137 CCTTATAAGAAGGAGGGCAATGG - Intergenic
1141650725 16:85391599-85391621 CCTTATAAAAAGAGGGGAATTGG - Intergenic
1141923571 16:87152723-87152745 TCTTATTAGAGGGAGGGAGAGGG - Intronic
1142080666 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1142104956 16:88297698-88297720 CCTCATAAGAGGGAGGCAGAGGG - Intergenic
1142112158 16:88338709-88338731 CCTTATCAGAAGGGGGGATATGG + Intergenic
1143297512 17:5882592-5882614 CCTTATAAGACGGGGGCAGAGGG - Intronic
1143366362 17:6411172-6411194 CCTTATAAGACGGAGGCAGAAGG + Intronic
1143968595 17:10775412-10775434 CCCTATAAAAAGAAAGGAGTGGG - Intergenic
1144003383 17:11076333-11076355 CCTTATAAGAAGAAAATATATGG - Intergenic
1144335699 17:14267302-14267324 CCTTATATGAGAAAGGTAGAGGG - Intergenic
1144837668 17:18165524-18165546 CCTCATAAGAGGAAAGCAGAAGG - Intronic
1145889172 17:28402946-28402968 CTTTATAAGAGGAAAGCAGACGG + Exonic
1145950289 17:28812139-28812161 CCTTGTAAGAAAAGGGGAAATGG - Intronic
1146133029 17:30294704-30294726 CCTTATAAGAAGTTGTGAAAGGG - Intergenic
1146299551 17:31677584-31677606 CCTTATAAGAAGGAGCCAGGAGG - Intergenic
1146315042 17:31800215-31800237 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1146406116 17:32539643-32539665 CCTTATAAAAGAAAGGTAGAGGG - Intronic
1146426656 17:32746382-32746404 TCTTATAGGAAGAAGTGGGAAGG - Intronic
1146482002 17:33212294-33212316 CCTTGTAAGAGGGAGGCAGAAGG + Intronic
1146510988 17:33448477-33448499 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1146653441 17:34621374-34621396 ACTTATAAGAAGAAGAGATGAGG - Intronic
1146959914 17:36965386-36965408 CCTTATAAGAGGAAGGCAATAGG - Intronic
1147020498 17:37528321-37528343 CCTTATAAGGGGAAGGTAGGAGG - Intronic
1147035694 17:37678650-37678672 CCTTATAAGAGGGAGGAAGAGGG + Intergenic
1147383096 17:40067202-40067224 CCTTGTAAGCTGAAGGGCGAGGG - Intronic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1148972778 17:51498818-51498840 CCTCTTAATAAGAAGGAAGAGGG - Intergenic
1149518694 17:57301693-57301715 CCTTAAAAGAAGAAAAGACAAGG - Intronic
1150050261 17:61955168-61955190 TCTTATAAGAAGGAGGCAGAAGG - Intronic
1150206840 17:63415441-63415463 GCTGAGAAGAAGAAGGGAGTGGG + Intronic
1150507953 17:65718716-65718738 CATTACAAGAAGAAAGGAAAGGG + Intronic
1150838178 17:68583498-68583520 CCTTATATGAGGAATGCAGAAGG - Intronic
1151114797 17:71723878-71723900 CCTTATAAGAAGATAAGAGATGG + Intergenic
1151193771 17:72417181-72417203 TCATATAAGAAGGAGGCAGAGGG + Intergenic
1151271844 17:73002918-73002940 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151577861 17:74961989-74962011 CCTTGTAGGAGGAAGGGGGAGGG + Exonic
1151807485 17:76415121-76415143 CCTGAGAACAAGAAGGGAGTCGG + Intronic
1151959351 17:77397353-77397375 CCTTATAGGAGAAAGGCAGAAGG - Intronic
1152154933 17:78626796-78626818 CCTTATCAGAGAAAGGCAGAGGG + Intergenic
1153195403 18:2590568-2590590 CCTTATAAGATAGAGGCAGAGGG - Intronic
1153300296 18:3586248-3586270 CCGTATAACAACATGGGAGATGG - Intronic
1153300305 18:3586310-3586332 CCGTATAACAACATGGGAGATGG - Intronic
1153302598 18:3604345-3604367 TATTAAAAGAAGAAGGGAAATGG - Intronic
1153304577 18:3620169-3620191 CCTTATAAGAGGGAGGCAGGAGG + Intronic
1153663717 18:7349589-7349611 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1153780518 18:8491430-8491452 CCTTATGAGAGGAAGGCAGGAGG + Intergenic
1154055540 18:11009805-11009827 CCTTGTAAGAAGAGGAGAGTAGG + Intronic
1154088095 18:11327064-11327086 CCTTATAAGAAGGAGGCAAAAGG + Intergenic
1154129608 18:11725276-11725298 CCTTATAAGAAGAGGAGATTAGG + Intronic
1154394537 18:13974958-13974980 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1155337937 18:24784489-24784511 CCTTATAAGAAGAGGTGATAAGG - Intergenic
1155347473 18:24872930-24872952 CCTTATAAAAAGAAGAGATTAGG - Intergenic
1155491128 18:26402990-26403012 CCTTATAAGAGGAGGAGATAAGG + Intergenic
1155552450 18:26979605-26979627 TCTTAGAAGAAGAAGAGAGATGG - Intronic
1155783831 18:29873955-29873977 CCTTAGAGGTAGAAGGGAAAGGG - Intergenic
1156022643 18:32617426-32617448 CCTTATAAGAAGCAGTGATCAGG - Intergenic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1157029591 18:43889667-43889689 GTCTATGAGAAGAAGGGAGAAGG + Intergenic
1157053800 18:44200387-44200409 CCTTATAAGCAGAAGAGATTGGG + Intergenic
1157245097 18:46046636-46046658 GCTTATAAGAAGAAGAAAGCAGG + Intronic
1158492012 18:57918601-57918623 CCTTACAAGAGGAGGGCAGAGGG - Intergenic
1158592868 18:58792152-58792174 ACATATAAGAAGGAGGGAGGGGG - Intergenic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1158873411 18:61710359-61710381 CCTTATCACAGGAAAGGAGAAGG - Intergenic
1159150538 18:64517641-64517663 CCTCATAAGAAGAGGGGATTGGG - Intergenic
1159180083 18:64891973-64891995 CCTTACAAGAGGAAGGCAGGGGG + Intergenic
1159200473 18:65177387-65177409 CCCCATAAGAAGAATGGATATGG + Intergenic
1159703886 18:71663159-71663181 CCTTATAAGAAAAAGACAGTGGG + Intergenic
1160886254 19:1350044-1350066 CCTTATAAGAGGAAGAGGCATGG + Intergenic
1162037677 19:7950892-7950914 CCTTATAAGAAGCAGAGATTGGG + Intergenic
1162494046 19:11013367-11013389 CCTTCTAAGAAGAAGAGATGAGG - Intronic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1164782199 19:30901888-30901910 GCTTAGATGAGGAAGGGAGATGG + Intergenic
1164811386 19:31159299-31159321 CCTTAAAAGTAGAAGAGGGATGG - Intergenic
1165590990 19:36969709-36969731 CCTTAAAAGAGGAAGGCAGGAGG - Intronic
1166277665 19:41766161-41766183 CCTTGTGGGAAGAAGAGAGAAGG - Exonic
1166441000 19:42815338-42815360 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166459447 19:42973304-42973326 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166460474 19:42983944-42983966 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166476769 19:43133349-43133371 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166581516 19:43904024-43904046 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1166919050 19:46216031-46216053 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1167582756 19:50356126-50356148 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1167800327 19:51736460-51736482 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1168050444 19:53825760-53825782 CTTTATAAGAAGAAGACAGGAGG + Intergenic
1168275343 19:55274812-55274834 CCTGATAAGAAGAAGAGATGAGG + Intronic
1168325041 19:55534248-55534270 CCTTATAAGAAGAGGAGATCAGG + Intronic
1168514750 19:57002023-57002045 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1168526077 19:57089828-57089850 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1202698846 1_KI270712v1_random:147548-147570 CTTTATAACAAGAGGAGAGAAGG + Intergenic
925055053 2:850919-850941 CCTTATAAGAAGAGGAGATGAGG - Intergenic
925550590 2:5069837-5069859 CTTTATAAGAAGAGGGGATGAGG - Intergenic
926149046 2:10414498-10414520 CCTTATAAGAAGAGGAGATGAGG - Intronic
926228755 2:10986925-10986947 CCATGTAGGAAGAAGGCAGAGGG + Intergenic
926304439 2:11627922-11627944 ATTAATAAGATGAAGGGAGAGGG + Intronic
926366659 2:12139618-12139640 CCCTTTAAGAAGAGGGGACAGGG - Intergenic
926736567 2:16077964-16077986 TCTTATAAGAAGAAGAGATTAGG + Intergenic
926814236 2:16784476-16784498 CCTTATAAGAAGAAGAAACGTGG + Intergenic
926820996 2:16851735-16851757 CCTTATAAGAGGCAGGCAGAAGG - Intergenic
926839442 2:17062816-17062838 CCTTGTAAGAAGGAGGCAGGAGG - Intergenic
926909959 2:17843361-17843383 CATGAGAAGAAGACGGGAGAGGG + Intergenic
927123058 2:19986682-19986704 CCTGAGAAGGTGAAGGGAGATGG + Intronic
927435858 2:23065548-23065570 CCTTATAAGAAGAGGAGATGAGG + Intergenic
927454905 2:23241022-23241044 CTTTATAAGAAGAAGAGATTAGG - Intergenic
927460916 2:23297606-23297628 CCTTATAAGCAGAGGGGATTAGG - Intergenic
927987195 2:27420333-27420355 CCATGTAAGAGGAAGGCAGAGGG - Intergenic
928285045 2:29982795-29982817 CCTTGTAAGTGGAAGAGAGAAGG + Intergenic
928600241 2:32897354-32897376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929373028 2:41249934-41249956 CCTTATAAGAAGAAAAAATATGG + Intergenic
929861242 2:45679672-45679694 ACTTACAAGAAGAGGGGATATGG + Intronic
930149474 2:48044034-48044056 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
930322462 2:49873853-49873875 CCTTATAAGAAAGAGGCAGAAGG + Intergenic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931766694 2:65463207-65463229 CCTTATAAGAAGAAGTGACTAGG + Intergenic
932484074 2:72070632-72070654 CCTTATAAGAGGCAGGCAGAGGG + Intergenic
932598425 2:73108378-73108400 CCTTATCAGGATGAGGGAGAAGG + Intronic
932911886 2:75814996-75815018 CTTTATAAGAGGAAGACAGAGGG - Intergenic
933150536 2:78909669-78909691 CCTTATAAGAGGGAGGTACAAGG + Intergenic
933203791 2:79481799-79481821 CTTTAAAAGAAGAAGACAGACGG + Intronic
933429473 2:82157237-82157259 CCTTATAAAAGGAATGCAGAAGG + Intergenic
933500841 2:83109316-83109338 CCTTATAAGAAGGAGACAGAGGG - Intergenic
933597925 2:84301332-84301354 CCTTATAAGAAGAAGAGATTAGG + Intergenic
933884982 2:86711093-86711115 CCTGTGAAGAAGAAGGAAGAAGG - Intronic
934032870 2:88064259-88064281 CCTTATAGGAGGAAGGCAGGAGG - Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
934169794 2:89531024-89531046 CTTTATAACAAGAGGAGAGAAGG + Intergenic
934280096 2:91605332-91605354 CTTTATAACAAGAGGAGAGAAGG + Intergenic
935095631 2:99941708-99941730 CCTGATAGGAAGGAGGAAGAAGG - Intronic
935609502 2:105006314-105006336 CCTTATAAGAAGAGGAGATTAGG - Intergenic
935727709 2:106038087-106038109 CCTTATAACAGGGAGGCAGAGGG + Intergenic
936004056 2:108866236-108866258 CCTTATAAAAGGGAGGCAGAAGG - Intronic
936068394 2:109349315-109349337 CTTGATAAAAGGAAGGGAGAAGG - Intronic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
937086664 2:119176360-119176382 CCTTATAAGAAGAGGTGATTAGG - Intergenic
937342018 2:121097132-121097154 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
937678405 2:124617543-124617565 CCTTGTAAGAAGAAAAGAAATGG - Intronic
938594723 2:132776471-132776493 ACTTATGAGAAGAACTGAGATGG + Intronic
938757234 2:134391984-134392006 GTCTATAAGAAAAAGGGAGAAGG - Intronic
939748153 2:146003978-146004000 CTTTATCAGAAGAAAGGACAGGG - Intergenic
940541817 2:155029946-155029968 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
940781634 2:157939652-157939674 CTTTATAGGAGGGAGGGAGAGGG + Intronic
940991260 2:160098943-160098965 CCTTATAAGAAGAGGAGATTAGG - Intergenic
941031071 2:160512336-160512358 CCTTATAAGAGAAAGGCAAAGGG - Intergenic
941238468 2:163006587-163006609 CCTTATAAGAAGAGGAAATATGG - Intergenic
941671035 2:168292580-168292602 CCTTAAATGTAGAAGGGATACGG - Intergenic
941805556 2:169708560-169708582 CCTTATAAGAAAGGGGCAGAGGG - Intronic
941811781 2:169762572-169762594 CCTTATAAGAGTTAGGCAGAGGG - Intronic
941984814 2:171499968-171499990 CCTTATAAGAAGAGGAGATTGGG - Intergenic
942074310 2:172342563-172342585 TCTTATAAAAAGGAGGGGGAGGG - Intergenic
942136354 2:172930067-172930089 CTTGTTAAGAAGAAGGGAAAGGG + Intronic
942270439 2:174268872-174268894 CCTTATAAGAAGAGGAGATTAGG + Intergenic
942389415 2:175476667-175476689 CCTTATAAGAAGAGGCGATTAGG - Intergenic
942985304 2:182134028-182134050 CCTTAGAGGAAGAAGGGACAGGG + Intergenic
943213563 2:185001008-185001030 GCTTATTAGAAGCAGGGACATGG + Intergenic
943695679 2:190927692-190927714 CCTTAAAAGCAGAAGGGATGAGG - Intronic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
944191621 2:197009985-197010007 CCCTTTAAAAAGAAGGAAGAAGG + Intronic
944248398 2:197556721-197556743 CCTTGTAAGAGGAAGTCAGAAGG - Intergenic
944662876 2:201935757-201935779 CCTTATAAGAGGAAAACAGAGGG + Intergenic
944727494 2:202485844-202485866 CCTTATAAGATAAAGGCAAAGGG - Intronic
944840613 2:203620458-203620480 CCTTGTAAGAGAAAGGCAGAGGG + Intergenic
944922349 2:204428710-204428732 CCTTATAAGAGGAAGGCAAGAGG + Intergenic
944922932 2:204434359-204434381 CCTTATAAGACAAAGGCAGGTGG + Intergenic
944931908 2:204528512-204528534 CCTTATAAGAGGGAGGCAGGGGG + Intergenic
945029208 2:205648203-205648225 CCTTATAAAAAGAAGAGATTAGG - Intergenic
945387520 2:209220564-209220586 CTTTATAAGAGGAAGTCAGAGGG + Intergenic
945487235 2:210411031-210411053 CCTGATAAGAAGGAGAGAGATGG + Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
945754797 2:213832556-213832578 TCTTCAAGGAAGAAGGGAGAAGG - Intronic
945773949 2:214081465-214081487 CATAAAAAGAAGAAGGGACAGGG + Intronic
946128228 2:217583292-217583314 CATTAGACGAAGAAGGGTGAAGG + Intronic
946467593 2:219925788-219925810 CCTTGTAAGAAGAAGAAAGTTGG + Intergenic
946711733 2:222513662-222513684 CATTATAAGAAAAAAGCAGAGGG + Intronic
946893992 2:224304242-224304264 CCTTTTAAGAGGGAGGCAGAGGG + Intergenic
947029716 2:225780188-225780210 CCTTATAAGAAAAAGTCAGAAGG - Intergenic
947260834 2:228220185-228220207 CCTTATAAGAAGAAGAGATTAGG + Intergenic
947295745 2:228628303-228628325 TCTTATAAGAATGAGGCAGAGGG + Intergenic
947521093 2:230846654-230846676 CCTTATAAGAAGAGGAGATTCGG - Intergenic
947529421 2:230899285-230899307 CCTTATGGGGAGATGGGAGAGGG - Intergenic
947944537 2:234090311-234090333 CCTTATAAGAAGATGAGATTAGG + Intergenic
947955307 2:234184724-234184746 CCTTACAAGAAGAAGGAAATTGG + Intergenic
947979052 2:234393306-234393328 CCTTGTAAGAGGGAGGAAGAGGG - Intergenic
948115183 2:235490207-235490229 CCTTATACGAGGAAGGCAGGAGG - Intergenic
948154557 2:235770976-235770998 CCTTATAATAGGGAGGGAGAAGG + Intronic
948790248 2:240373071-240373093 CCTTGTAAGAAGAGGCCAGAGGG - Intergenic
949061104 2:241957905-241957927 CCTTATAAGAGAAAGGAAGAGGG - Intergenic
1168881809 20:1212602-1212624 CCTTATAAGAGGTAGACAGAGGG - Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1168959505 20:1859249-1859271 CCATGTAGGAAGAAGGGAAAGGG - Intergenic
1168959651 20:1860145-1860167 CCATGTAGGAAGAAGGGAAAGGG + Intergenic
1169489965 20:6063058-6063080 TCTTATAAGAGGGAGGAAGAGGG + Intergenic
1169570264 20:6898533-6898555 CATGAAAAGAAGGAGGGAGAGGG + Intergenic
1169805870 20:9558668-9558690 CCTTGGAGGAAGAAGAGAGAGGG - Intronic
1170111620 20:12809846-12809868 CCTCATCAGATGAAGGAAGAAGG + Intergenic
1170167031 20:13370744-13370766 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1170354533 20:15477833-15477855 CCTTATATGAGGAAGGCAGGAGG + Intronic
1170534092 20:17323252-17323274 CCTTATAAGAAGAGGAGATTAGG + Intronic
1170613920 20:17934405-17934427 CCTTACAAGAAGAAGCGGGCGGG - Intergenic
1172465038 20:35149885-35149907 CCTTATAAGAGAAAAGCAGAAGG - Intergenic
1172475899 20:35237413-35237435 CCTTATAAGAGGAAGGCAGGGGG - Intronic
1173291545 20:41719380-41719402 CCTTATAAGAAGGACAGAGAAGG - Intergenic
1173540133 20:43844772-43844794 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1174073662 20:47916677-47916699 CCTTGTAAGAAGGAGGCAGGAGG + Intergenic
1174075652 20:47934146-47934168 CCTTATAAGAGGACGGAAGGAGG - Intergenic
1174633391 20:51978035-51978057 CCTTATAAGAAGAGAAGACATGG + Intergenic
1174883943 20:54310860-54310882 CCTTATAAGAAGAGGAGATAAGG - Intergenic
1175172490 20:57090345-57090367 CCTTATAAGACGGAGGTAGGAGG + Intergenic
1175507513 20:59496246-59496268 CCTTATCCGAAGGAGGCAGAGGG - Intergenic
1175518549 20:59584862-59584884 CCTTATATGAAGAAGAGATTTGG - Intronic
1175931112 20:62494170-62494192 CCTTATAAGAGACAGGCAGAGGG - Intergenic
1176513564 21:7766809-7766831 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1176701132 21:10051651-10051673 CCTTATAAGAGTGAGGGAGAGGG - Intergenic
1176975870 21:15321185-15321207 GCTGAAAAGAAGAGGGGAGAGGG - Intergenic
1177112520 21:17045817-17045839 GCAAATAAGTAGAAGGGAGAGGG - Intergenic
1177207380 21:18025793-18025815 CCGTGGAAGATGAAGGGAGAAGG - Intronic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177606265 21:23381468-23381490 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1177707388 21:24724820-24724842 CCTTATACTAAGATGGGAAATGG + Intergenic
1177853528 21:26376875-26376897 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1178072970 21:28989655-28989677 CATAATTTGAAGAAGGGAGAAGG - Intronic
1178484661 21:33011093-33011115 CCTTATAAGAGGAAGAGATTAGG - Intergenic
1178484977 21:33013398-33013420 CTTTATAAGAGAAAGGCAGAGGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178642357 21:34355349-34355371 CCTTATAAGAAGCAGGCAGGGGG + Intergenic
1178647677 21:34397333-34397355 CCTTGTAAGAGGGAGGCAGAGGG + Intronic
1178898343 21:36579136-36579158 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1178952666 21:36998058-36998080 CCTCATAAGAAAAAGGCGGAAGG - Intergenic
1179032402 21:37732023-37732045 TCTTAGATGAGGAAGGGAGATGG + Intronic
1179186597 21:39089706-39089728 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1179225363 21:39448107-39448129 CCTTATAAGAAGACAAGACAGGG - Intronic
1179272868 21:39865248-39865270 CCTTATAAGAAGAATAGATTAGG - Intergenic
1179279021 21:39917924-39917946 CCTTATAAGAAGAAGAGATGAGG + Intronic
1179364096 21:40739546-40739568 CCTTATAAGAAGAGGAGATTAGG - Intronic
1179398020 21:41059158-41059180 CCTTATAGGAAGAAAGTAGGAGG - Intergenic
1179430837 21:41319966-41319988 CCTTATAAGAAGAGGAGATGAGG + Intronic
1179502777 21:41820471-41820493 CCTTATAAGAAGATGAGATTGGG + Intronic
1179593669 21:42428044-42428066 CCTTATAAGAAGAGGGGATGAGG + Intronic
1179787538 21:43738222-43738244 CCTTGTAAGAAGAAGAGATGAGG + Intronic
1179942991 21:44651613-44651635 CCTTATCAGAAGGAGGGAGGAGG - Intronic
1180106726 21:45623501-45623523 CCTTAGAGGAAGAAGGGATGAGG + Intergenic
1180738172 22:18034407-18034429 CCTTAAAAGAAGGCTGGAGAGGG + Intergenic
1180937227 22:19633678-19633700 TCTTATAAGAAGAAGAGATTAGG + Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1181884128 22:26005790-26005812 CTTTACAAAAAGAAGGGAGTGGG + Intronic
1181967370 22:26666669-26666691 CCTTAAAAGGTGAGGGGAGAAGG - Intergenic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1182096442 22:27629214-27629236 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1182106316 22:27692304-27692326 CCTTGTAAGAGGAAGGCAGGAGG + Intergenic
1182191890 22:28469543-28469565 CCTTATAAGAGGGAGGCAGAGGG + Intronic
1182192217 22:28473807-28473829 CTTTATAAGAAGAAGAGATTAGG + Intronic
1182592459 22:31392298-31392320 CCTTTTAAAAAGAAGAGACAGGG - Intergenic
1182820771 22:33214302-33214324 CCTTATAAGAAGAAGAGACGAGG - Intronic
1182878016 22:33708989-33709011 CCCTATAAGAAGAAGAGATTAGG - Intronic
1182892868 22:33833412-33833434 CCTTATAAGAAGAGGAGATAAGG + Intronic
1182910300 22:33978656-33978678 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1182922483 22:34092859-34092881 CCTTATAAGAAGAAGAGATGAGG + Intergenic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
1184119056 22:42438497-42438519 CCCTACAAGGAGGAGGGAGAGGG - Intergenic
1184304530 22:43587603-43587625 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1184364359 22:44040485-44040507 CCTTATGAGAAGGAGGCAGGAGG + Intronic
1184413121 22:44337268-44337290 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1184417677 22:44361702-44361724 CCTTATAAGAAGAGGAGACTGGG + Intergenic
1184529254 22:45044040-45044062 CCTTATGAGAGGGAGGCAGAGGG + Intergenic
1184826513 22:46956281-46956303 CCTAATAAGAAGAAGAGATGTGG + Intronic
1185208828 22:49555329-49555351 CCTTATAAAAAGAAGGAAACTGG + Intronic
949645891 3:6093558-6093580 ACTTAGAAGAAAAAGGCAGATGG - Intergenic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
949832799 3:8233970-8233992 CCTTTTAATCAAAAGGGAGATGG + Intergenic
949911526 3:8913800-8913822 CATTAGAAGAAGATGGGTGATGG + Intronic
950817140 3:15716963-15716985 CTTTTTAGGAGGAAGGGAGATGG - Intronic
950837942 3:15938554-15938576 CCTTATAAGAAGAAGAGCCATGG + Intergenic
951040673 3:17985998-17986020 CCTAATAAGAGAAAGAGAGAGGG - Intronic
951172766 3:19561536-19561558 CCTTATAAGAAAGAGGAAAAAGG + Intergenic
951569992 3:24051983-24052005 ACATAATAGAAGAAGGGAGATGG - Intergenic
951927155 3:27921013-27921035 CCTTATAAGAAGAAAAGATTAGG + Intergenic
952804104 3:37330503-37330525 CCTTTTAGGTAGAAGGGTGAGGG + Intronic
952809770 3:37391414-37391436 TCTTTTAAGAAGAAAGGAGAAGG + Intronic
953236697 3:41113306-41113328 CCTTATAAGAAGAGGAGATTAGG + Intergenic
953469996 3:43158345-43158367 ACTTAGAAAAAGAAGTGAGATGG - Intergenic
953536703 3:43782475-43782497 ACTTAGCAGAAGAAGAGAGAAGG - Intergenic
953659480 3:44881331-44881353 CCTTACCAGAAGGAAGGAGAAGG + Intronic
954516291 3:51180572-51180594 CCTTATAGGACAAAGGCAGAGGG - Intronic
955155394 3:56412096-56412118 CCTTATAGGAGAAAGGTAGAGGG + Intronic
955766694 3:62351579-62351601 CCCTATTAGAACAAGGGGGAGGG + Intergenic
955860391 3:63323355-63323377 CCTTATGGCAAAAAGGGAGAGGG + Intronic
955892875 3:63668759-63668781 CTTTATAAGAAAGGGGGAGAGGG + Intronic
956032155 3:65050266-65050288 CATTGTAAGAGGGAGGGAGAGGG - Intergenic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
956187675 3:66578049-66578071 CATTTTATGAAGAAGGGAGGAGG - Intergenic
956417165 3:69045003-69045025 CACCAAAAGAAGAAGGGAGATGG + Intronic
956568734 3:70670247-70670269 CCTTATAAGAAGAGGAAATATGG - Intergenic
956585970 3:70865397-70865419 TCTTGCAAGAAGAAGGCAGAAGG - Intergenic
956922133 3:73940874-73940896 CCTTAGAAGACACAGGGAGAAGG - Intergenic
957107822 3:75913218-75913240 CCTTAGATGAAGTAGAGAGAAGG - Intronic
957219496 3:77363745-77363767 TCTTCAAGGAAGAAGGGAGAAGG + Intronic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957572909 3:81971023-81971045 CCTGAGAAGAGGATGGGAGATGG - Intergenic
957632003 3:82727925-82727947 CATTATAAGAAGAAGAGATGAGG - Intergenic
957682858 3:83460141-83460163 CCTTATAAGAGACAGGCAGAGGG + Intergenic
957691277 3:83573487-83573509 GGTAATAAAAAGAAGGGAGAGGG + Intergenic
957748920 3:84386145-84386167 CCTGATAAGAATAAGGAAGTAGG + Intergenic
957884080 3:86260644-86260666 CCTTATAAGAGGGAAGCAGAGGG - Intergenic
958118509 3:89254642-89254664 CGTTATAAGGATAAGGGAGTGGG - Intronic
958186024 3:90120144-90120166 CTTTATAAGAGGGAGGCAGAGGG - Intergenic
958979570 3:100705668-100705690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
959010889 3:101074629-101074651 TCTTATAAGTAAAAGGCAGAGGG + Intergenic
959149965 3:102596532-102596554 CCTTATAAAAAAGAGGTAGAGGG - Intergenic
959231546 3:103660105-103660127 CCTTATAAGAGAAAGGCAGCGGG + Intergenic
959872574 3:111345336-111345358 CCTTATGAGAAGCAGGCAAAGGG + Intronic
960321741 3:116245146-116245168 CTTTATAAGAAGAGGAGACAAGG + Intronic
960745539 3:120883939-120883961 CCTATTAAGAAGAAAGAAGAGGG + Intergenic
961427735 3:126861410-126861432 CATTATGAGAAGAAATGAGATGG + Intronic
961738012 3:129014486-129014508 CCTTCTAAGAAGAGGGGATTAGG - Intronic
962215440 3:133516929-133516951 CCTTATAAGAAGAGGAGATTAGG - Intergenic
962254086 3:133858572-133858594 CCTTATAAGAAGAGGAGATGAGG - Intronic
962485234 3:135835996-135836018 TCTTATAGGAAAAAGTGAGATGG + Intergenic
962877684 3:139548313-139548335 CCTTGGAAGAAAAGGGGAGATGG + Intergenic
962901657 3:139766975-139766997 CCTTATAAGAAAGAGGGGAATGG - Intergenic
962946548 3:140176300-140176322 CCTTAGAAGAAGAAGAAACAAGG - Intronic
963260504 3:143187066-143187088 GTTTTTAGGAAGAAGGGAGATGG + Intergenic
964465380 3:156985924-156985946 CCTTATAAGAGGAAGCAAGAGGG + Intronic
964670387 3:159219006-159219028 CCTTCTAAGAGGAAGGCAGAGGG - Intronic
964777455 3:160293791-160293813 CCTCTTGAGAAGAAGGGAGCTGG + Intronic
964928713 3:161988991-161989013 CATTATAAGTGGAAGGCAGAAGG - Intergenic
965171321 3:165268285-165268307 CTTTGTAAGAGAAAGGGAGAGGG - Intergenic
965424981 3:168511458-168511480 CTTTATATGAAGAAAAGAGAAGG + Intergenic
965489213 3:169316282-169316304 CCTTTTAACAAGATGTGAGAGGG - Intronic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966335861 3:178867488-178867510 CCTTACAAGAGCAAGGCAGAGGG + Intergenic
966433956 3:179862189-179862211 CCTAATAAGAGTAAGGCAGACGG - Intronic
966480158 3:180398980-180399002 CCTTACAATAAAAGGGGAGAGGG + Intergenic
966733169 3:183167560-183167582 CCTTATAAGAAGAGGAGATTAGG - Intergenic
966990442 3:185224836-185224858 CCTTATAAGAGGGAAGCAGAAGG - Intronic
968076018 3:195816496-195816518 CCTTGTAAGGAGAAGGGCGGAGG - Intergenic
968745802 4:2359504-2359526 CCTTATAAGAAGAGGAAATATGG + Intronic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969051583 4:4377066-4377088 CCCTATAAGAAGAAGGGACATGG - Intronic
969174666 4:5389514-5389536 CCTTATAAGAAGAGGAGAGTAGG - Intronic
969322714 4:6422674-6422696 CCTTATAAGAAGAGGAGATTAGG - Intronic
969342741 4:6552592-6552614 CCTTATAAGAGGGAGGTAGGAGG - Intronic
969482878 4:7456114-7456136 CCTTATAAGAAGAGGAGATCAGG - Intronic
969515600 4:7646466-7646488 CCTTATAAGAAGAGGAGATCAGG + Intronic
969605674 4:8201196-8201218 GGTTGGAAGAAGAAGGGAGAGGG - Intronic
970376461 4:15462605-15462627 CCTTATAAGAGAAAGAGAGCAGG + Intergenic
970456568 4:16228357-16228379 CCTTTTAAATAGAAGAGAGAGGG + Intergenic
970580033 4:17466689-17466711 CCTTATAAAAGGGAGGCAGAAGG + Intronic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971379731 4:26085703-26085725 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
971384591 4:26131680-26131702 CCTTATAAGAGAAAGACAGAGGG + Intergenic
971526866 4:27630572-27630594 CCTTATAAGAATAAGGGATAAGG - Intergenic
971586764 4:28414515-28414537 ACTAATAAGAAGAAGAAAGAAGG - Intergenic
971701062 4:29977214-29977236 CCTTATAAAAAGAAGAGATTAGG - Intergenic
971893803 4:32563159-32563181 CTTTATAAGAGGAAGGTAGTGGG - Intergenic
972156917 4:36174729-36174751 CATCATGTGAAGAAGGGAGATGG - Intronic
972180620 4:36460457-36460479 CCTTCTAAGAAGAAAGCAGGAGG - Intergenic
972247930 4:37265726-37265748 CCTTATAAGAGGGAGGCATAAGG - Intronic
972383713 4:38543339-38543361 CCTGAGGAGAAGGAGGGAGATGG + Intergenic
972589867 4:40474870-40474892 CATCATAATGAGAAGGGAGAAGG + Intronic
972662157 4:41126791-41126813 CCTTATAAGAAGAAGAAATTAGG - Intronic
972881153 4:43424645-43424667 CCTTCTAAGAAGAGGAGATAAGG - Intergenic
973116575 4:46467572-46467594 CCCTATAAGAGGGAGGTAGAAGG + Intronic
973127493 4:46605840-46605862 CTTTATAAGAGAAAGGTAGAGGG + Intergenic
973208604 4:47589044-47589066 CCTTATAAGAAAGAGGCAGAGGG + Intronic
973838588 4:54837343-54837365 CCTTATAAGAAGAGGAGATTAGG + Intergenic
973839511 4:54846593-54846615 CCTTATAAGAAGAGGAGATTAGG - Intergenic
974093285 4:57334916-57334938 CCTTATGAGAGGGAGGCAGAAGG + Intergenic
976096423 4:81513087-81513109 CATAATAAGAGGAAGGGAAAGGG - Intronic
976179447 4:82385178-82385200 GCTTTGAAGATGAAGGGAGAAGG + Intergenic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
976441798 4:85084338-85084360 CCTTAAAGGAAGAAAGGAGGTGG + Intergenic
976496313 4:85733751-85733773 CCTTATAAGAAGAAGAAATTAGG - Intronic
976663846 4:87569107-87569129 CCTTATAAGAAGAGGAGATTAGG - Intergenic
976796456 4:88939379-88939401 CCTTATAAGAATGGGGTAGAGGG - Intronic
976802121 4:89004561-89004583 CCTTATGATTAGAAAGGAGAAGG - Intronic
976888656 4:90016773-90016795 CCTTATAAGAAGAGGAGATTTGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977036264 4:91957579-91957601 ACTTATAAGAAGCAAGGAGCTGG + Intergenic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
977303885 4:95299193-95299215 CCTTATAAGAAGAAGAAATTTGG + Intronic
978395259 4:108272285-108272307 CCTTAAGAGAAGAAGGCTGAGGG - Intergenic
978580759 4:110229157-110229179 CCTTATAAGAAGAGGCGACTAGG - Intergenic
979682430 4:123476668-123476690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
979829176 4:125279497-125279519 TCTTATACACAGAAGGGAGATGG + Intergenic
980373283 4:131907974-131907996 CCTTATAAGAGTGATGGAGAGGG - Intergenic
980405489 4:132349809-132349831 ATTTATTAGAAAAAGGGAGATGG - Intergenic
980548434 4:134301580-134301602 CCTTATAAGAAGAAGAGATTAGG - Intergenic
980582946 4:134776013-134776035 ACTTAGAAGAAGAAAGGAGCTGG - Intergenic
980806476 4:137821273-137821295 CCTAATGAGAAGGAGAGAGAAGG - Intergenic
980812546 4:137901407-137901429 CCTTATAAGAAGAGGAGACCCGG - Intergenic
981968476 4:150635496-150635518 CCTGGTAGGAAGAAGAGAGATGG - Intronic
983866450 4:172772877-172772899 CCTTATAAGAGGGAAGAAGAGGG + Intronic
984049050 4:174841360-174841382 CCTTATAAGAAGAGGAGATTAGG - Intronic
984196155 4:176660314-176660336 CCTTATAAGGCAAAGGCAGAGGG - Intergenic
984541075 4:181037615-181037637 CCCTCTCAGAAGAAAGGAGAAGG - Intergenic
984587291 4:181578771-181578793 CCTTATAAGAAGAAGAGATTAGG - Intergenic
984599140 4:181706203-181706225 CCTTATAAGAAGAGGAGATTTGG - Intergenic
985010813 4:185580412-185580434 CCTTATAAAAAGAAGTGATTGGG - Intergenic
985243362 4:187954746-187954768 CCTTATAAGAGAAAGTCAGAAGG + Intergenic
985724448 5:1508446-1508468 CCTTATAAGAAGAGGAGATGAGG + Intronic
985771537 5:1814940-1814962 CCTTATAAGAAGAGGGGATGAGG - Intronic
985816837 5:2133698-2133720 CCTTATAAGAAGAGGAGAAGAGG - Intergenic
986051980 5:4098705-4098727 CCTTATAAGAAGAAGAGATTAGG + Intergenic
986113514 5:4746092-4746114 CTTTATAAGAAGAGGGGATTAGG - Intergenic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986367145 5:7043731-7043753 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
986408401 5:7450012-7450034 CCTGAGAAGAGGGAGGGAGATGG - Intronic
986704483 5:10443856-10443878 CCTTGGAAGAAGGAGGCAGAGGG - Intronic
986708906 5:10473331-10473353 CCTTAAAAGAGAAAGGCAGAGGG + Intergenic
986776947 5:11024555-11024577 CCTTATAAGAAAAAGGAAAAAGG - Intronic
986987057 5:13512135-13512157 CCTTCTAAGAAGAGGAGAGCAGG - Intergenic
987150882 5:15038537-15038559 CCTCATAAGAGGAAGGTAGGAGG - Intergenic
987180975 5:15368148-15368170 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
987188063 5:15445235-15445257 CCTTATTAGAGGAAGGCAGGAGG + Intergenic
987253404 5:16123296-16123318 CCTTATAAGAAGAGGAGATTAGG + Intronic
987692330 5:21283127-21283149 CCACATAAGAAGAAGCGAGGTGG - Intergenic
988014711 5:25539477-25539499 CCTTATAGGAAGAGGAGAAATGG + Intergenic
988208412 5:28171076-28171098 ACTTATAAGAAGCAAGGAGCTGG - Intergenic
988593549 5:32569891-32569913 CCTTATAAAAAGGAGGAAGAGGG + Intronic
988709965 5:33763290-33763312 CCTTATAAGAGGAAGGCAAGAGG + Intronic
988787551 5:34578745-34578767 CTTTATAAGAGGGAGGCAGATGG - Intergenic
988884650 5:35542958-35542980 CATTTTAAGAGGAAGGCAGAGGG + Intergenic
988921244 5:35944947-35944969 CCATGTAAGAAGCAGAGAGAAGG + Intergenic
988998902 5:36740997-36741019 CCTTATAAGAAGAAGAAATTAGG - Intergenic
989620978 5:43384170-43384192 CATTATAAAAATAAGAGAGATGG + Intronic
989705252 5:44322071-44322093 CCTTATACACAGAAGTGAGATGG + Intronic
990220191 5:53579814-53579836 CCTTATAAGAAGGATGCAGGTGG + Intronic
990232232 5:53725851-53725873 CCTTATAAGAGGGAAGCAGACGG - Intergenic
990374094 5:55152010-55152032 CCCTGTAAGAGGAAGGCAGAGGG + Intronic
990412487 5:55554655-55554677 CCTTATAAGTGGGAGGCAGAGGG + Intergenic
990741460 5:58916474-58916496 CCTTATAAGACAAAGGCAGGTGG + Intergenic
991039883 5:62164114-62164136 CCTTATAAAAGGAAGGCAGAGGG + Intergenic
991261330 5:64671572-64671594 CTTTATAAGAGAAAGGCAGAGGG + Intergenic
991278665 5:64883570-64883592 AATTCTAAGAAGAAAGGAGAAGG + Intronic
991433218 5:66569466-66569488 CCTTATAAGAGGGAGGCAGAAGG + Intergenic
991494309 5:67212551-67212573 CCTTATAAAAAAGAGGCAGAAGG - Intergenic
991748030 5:69766923-69766945 CCACATAAGAAGAAGCGAGGTGG + Intergenic
991799609 5:70346771-70346793 CCACATAAGAAGAAGCGAGGTGG + Intergenic
991828988 5:70663267-70663289 CCACATAAGAAGAAGCGAGGTGG - Intergenic
991891968 5:71346200-71346222 CCACATAAGAAGAAGCGAGGTGG + Intergenic
992077701 5:73206389-73206411 GCTTTGAAGATGAAGGGAGATGG - Intergenic
992092051 5:73326107-73326129 CCTTATAAGAAGGAGAGATTAGG - Intergenic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
992318750 5:75588820-75588842 CCTTATAAGAAGGAGGCAGGAGG - Intronic
992387118 5:76295330-76295352 CCTTATAAAAAGAGGTGCGAGGG - Intronic
992591827 5:78303533-78303555 CCTTAAAAGAGGAAGGCAGAAGG - Intergenic
992767111 5:80011444-80011466 ACTAAAAGGAAGAAGGGAGAAGG + Intronic
992855167 5:80852753-80852775 CCCTATAAGAACAAGGGAGATGG - Intronic
993081843 5:83310780-83310802 CCTTATTAGAGGGAGGAAGAAGG + Intronic
993558225 5:89368272-89368294 CCTTATAAGATGGAGGCAGAAGG - Intergenic
993858179 5:93101086-93101108 CCTTATAAGAGGAAGACAGGAGG + Intergenic
993874327 5:93288743-93288765 CCTTATAAGAAGAGGAGATAAGG - Intergenic
994881596 5:105504932-105504954 CCTTCCAAAAAGAAGTGAGAGGG - Intergenic
994911984 5:105921644-105921666 CCTTACAAGCAGAAGTGAAAAGG + Intergenic
995495931 5:112743218-112743240 TCTTTTAAGAAGGAGGCAGAAGG - Intronic
995686625 5:114779544-114779566 CCTTAGATGAAGAGGGGATATGG - Intergenic
995820045 5:116219466-116219488 CCTTATAAGAGAGAGGCAGAGGG + Intronic
995837060 5:116409574-116409596 CCTTATAAGAAGAGGGGATTAGG + Intronic
996810841 5:127515045-127515067 GCTTATAAGAGAAAGGCAGAAGG + Intergenic
997053669 5:130413777-130413799 CCTTATAAAAGGGAGGCAGAGGG - Intergenic
997254453 5:132417711-132417733 CCTTATAAGAGGGAGGCAGGGGG - Intronic
997343061 5:133161689-133161711 CCTCATGAGAAGGAGGCAGAGGG + Intergenic
997664853 5:135622042-135622064 CCATAAAAGAAGAACGGAGAAGG + Intergenic
997901006 5:137764255-137764277 CCTTATAAGAAGAGCCCAGAGGG + Intergenic
998408066 5:141885766-141885788 ACTTCCAGGAAGAAGGGAGAGGG - Intergenic
998728012 5:145041264-145041286 CCAAATAAGAAGAAGCGAGATGG + Intergenic
998906436 5:146910207-146910229 CCTAATAACAAGAAGGTAGCAGG + Intronic
999446011 5:151639967-151639989 CCTTATAAGAGGTGGGTAGAGGG - Intergenic
999497945 5:152118548-152118570 CCTTATGAGAAAAGGGCAGAGGG + Intergenic
999551724 5:152694887-152694909 CCTTTTAACAAAAATGGAGAAGG - Intergenic
999660977 5:153862563-153862585 CCTTATAAGACAGAGGCAGAGGG - Intergenic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000041281 5:157486918-157486940 CCTCATAAGAAGAGGAGAGTTGG + Intronic
1000397926 5:160795687-160795709 CCTTATAAGAGAAAGGCAGAGGG + Intronic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1000788841 5:165580010-165580032 CCTTACAGGAGGGAGGGAGAGGG + Intergenic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001154715 5:169263038-169263060 CCTTATTAGAAGAGGAGACAGGG + Intronic
1001179181 5:169502725-169502747 CCTTATAAGAAGAGGTGATTAGG + Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001581688 5:172802829-172802851 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1002458809 5:179362224-179362246 CCTTATGAGGAGGAGGCAGAGGG - Intergenic
1002565293 5:180109646-180109668 CCTTATAAGAGGACGGCAAAGGG + Intronic
1002871182 6:1168586-1168608 CCTTACGAGAAGAAGGCAGGAGG + Intergenic
1002939018 6:1699651-1699673 CCTTATAGGAGGAAGGCAGGAGG - Intronic
1002981157 6:2140216-2140238 CCTTATAAGAAACAGGCAGTGGG + Intronic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003073250 6:2960892-2960914 CCTTCTAAGAGGGAGGGAGGGGG + Exonic
1003331116 6:5129540-5129562 TCTTCTAAGAGGAAGGCAGAGGG - Intronic
1003368125 6:5496668-5496690 CCTTACAAGAAGAAGAGATTAGG - Intronic
1003442441 6:6155689-6155711 CCTCAAAAGAAGCAAGGAGAGGG - Intronic
1003487631 6:6593325-6593347 CCTTACAGGAAGGAGGCAGAGGG - Intronic
1003671990 6:8168005-8168027 CCTTATAAGAGAAAGACAGAGGG - Intergenic
1003682478 6:8269566-8269588 TCTTACAAGAGGAAGGGAGAGGG + Intergenic
1003747106 6:9014857-9014879 CCTTACAAGAGGGAGGTAGAGGG + Intergenic
1003854763 6:10262111-10262133 CATTATAAGAGGAAGGCAGTGGG - Intergenic
1003970654 6:11296058-11296080 CCTTATAAGAAGAGGAGATGAGG + Intronic
1004062215 6:12208676-12208698 CCTTAGAAGAAGAGGAGAGGGGG + Intergenic
1004088991 6:12480131-12480153 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1004218371 6:13723303-13723325 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1004222401 6:13758105-13758127 CCTTATAAGAGAGAGGGAGGAGG + Intergenic
1004310310 6:14539798-14539820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1004389563 6:15198666-15198688 TCTTTTAAAAAGGAGGGAGATGG + Intergenic
1004884057 6:20035171-20035193 CCTTGTAAGAAGAAGAGATGAGG + Intergenic
1005004013 6:21270182-21270204 CCTTATAAAAGAAAGGCAGAAGG - Intergenic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1005805099 6:29467383-29467405 CCTTATAAGAAGACGAGATTAGG + Intergenic
1005901092 6:30216794-30216816 CCTCAGATGAAGGAGGGAGAAGG - Intergenic
1006046133 6:31300335-31300357 CCTTGTTAGCAGATGGGAGAGGG - Intronic
1006858750 6:37155066-37155088 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1007655516 6:43449045-43449067 CCTTAGAGCAAGAAGGGAGCAGG + Intronic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1008964292 6:57298642-57298664 CCTCATAATATGGAGGGAGAGGG - Intergenic
1009197057 6:60699422-60699444 CCTTATAAGGAGGAGGCAAAGGG - Intergenic
1009868559 6:69428573-69428595 CCCTATAACTAGAAGGAAGAAGG + Intergenic
1010009828 6:71037070-71037092 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1010371434 6:75113904-75113926 CCTTCTAAGGAGAAGTCAGAAGG - Intronic
1010623138 6:78101514-78101536 CCTTTTAAGAAAAAGGCAGATGG + Intergenic
1010729960 6:79380831-79380853 CCTTATAAGAAGAGGGGGTTAGG - Intergenic
1010832856 6:80552312-80552334 CCTTATGAGAATCAGGGAGGTGG + Intergenic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1011083812 6:83516820-83516842 TCATATAAGAAGGAGGCAGACGG - Intronic
1011272468 6:85593578-85593600 CCTGTTAAGAAGCAGGGAGGCGG + Exonic
1011304398 6:85910677-85910699 CTTTATAAGAAGAAAAGAAAGGG + Intergenic
1011476673 6:87755444-87755466 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1012205745 6:96458354-96458376 CCTTATAAGAGAGAGGCAGAGGG + Intergenic
1012346889 6:98199268-98199290 TCTTATAAGAAAAAGAGAAATGG - Intergenic
1012848727 6:104422346-104422368 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1013055384 6:106577745-106577767 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1013233435 6:108176362-108176384 GGTGAAAAGAAGAAGGGAGAGGG - Intronic
1013993586 6:116281085-116281107 TCTTATAAGAAGGAGGCAGGAGG + Intronic
1014084456 6:117327227-117327249 CCTCATAAGAGGCAGGGAAAGGG + Intronic
1014577260 6:123089018-123089040 CCTTATAAGAAGAACTTATAAGG - Intergenic
1014660013 6:124158251-124158273 CCTTATAAGAAGAGGTGATTAGG - Intronic
1014742146 6:125158071-125158093 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1015287050 6:131497715-131497737 CCTTTTAAGAAGAAGAGATTAGG - Intergenic
1015498003 6:133900940-133900962 CCTTATAAGAGAAAGGGAGAGGG + Intergenic
1016285659 6:142469844-142469866 CCTTAGAAGAGGGAGGGAGAGGG - Intergenic
1016516387 6:144897157-144897179 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1016551320 6:145283399-145283421 CCTTATCAGAAGAGGAGAAAAGG + Intergenic
1016740997 6:147528436-147528458 CCTTATAAGAAGAGGAGATTAGG - Intronic
1017144219 6:151219432-151219454 CCTTAATAGAAGGAGGGAGGAGG - Intergenic
1018615013 6:165678949-165678971 CATTATTAGATGAAAGGAGATGG + Intronic
1018754692 6:166838884-166838906 CCTCATAAGAGGAAGGCAGCAGG + Intronic
1018830478 6:167438725-167438747 CCTTAGAAGAGGGAGGCAGAGGG - Intergenic
1020108594 7:5434910-5434932 CCTTATAAGAAGAGGAGATTAGG - Intronic
1020361892 7:7335651-7335673 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1020677842 7:11201825-11201847 CCTTAGGAGAAGAGGGGAGTGGG + Intergenic
1021066382 7:16179471-16179493 CCTTATAAAAGGGAGGTAGATGG + Intronic
1021144044 7:17063649-17063671 TCTAATAAGGAGAAGAGAGAAGG + Intergenic
1021551082 7:21871786-21871808 CTTTATGAGAAGAAGGGATTAGG - Intronic
1021629337 7:22629115-22629137 CCTTCTAAGAAGGAGGTAAAAGG + Intronic
1021774974 7:24044663-24044685 CCTCATAAGAAAGAGGTAGAGGG + Intergenic
1021782900 7:24123066-24123088 GCGTGTAAGAGGAAGGGAGATGG + Intergenic
1021897734 7:25253002-25253024 TCTTATAAGAGGAAGGCAGAAGG + Intergenic
1022619829 7:31971758-31971780 CCTTGGAGGAAGAAGGGAGTGGG - Intronic
1022657702 7:32335619-32335641 CCTTATGAGAAGAAGAGATTAGG - Intergenic
1022867796 7:34440683-34440705 CATTAAAAATAGAAGGGAGAGGG + Intergenic
1024281468 7:47722817-47722839 CCTTATAAGAAGAGGAGATTAGG - Intronic
1024472714 7:49779885-49779907 CCTTATAAGAAGAGGAGATGTGG - Intronic
1024527498 7:50361172-50361194 CTTTAAAAGGAGAAGGGAAAGGG - Intronic
1024866769 7:53912133-53912155 CCTTCTAAGAAGGAGGTAAAGGG - Intergenic
1024896672 7:54268824-54268846 CCTACTAAGAAAAAGGAAGAAGG - Intergenic
1025041348 7:55648704-55648726 GCTTCTAAGAACAAGAGAGATGG + Intergenic
1025171191 7:56758526-56758548 CCTTATCAGAAGAAAACAGAGGG + Intergenic
1025209585 7:57013167-57013189 CATTAAAAGATGAAGGCAGACGG - Intergenic
1025213405 7:57034660-57034682 CCAAATAAGAAGAAGTGAAAAGG - Intergenic
1025234334 7:57223846-57223868 TTTTATAAGAAGAAAGGAGTAGG + Intergenic
1025658548 7:63542164-63542186 CCAAATAAGAAGAAGTGAAAAGG + Intergenic
1025662366 7:63563683-63563705 CATTAAAAGATGAAGGCAGACGG + Intergenic
1025700682 7:63816966-63816988 CCTTATCAGAAGAAAACAGAGGG - Intergenic
1025988023 7:66473080-66473102 CCTTTTAAATAGAAGAGAGAGGG - Intergenic
1026154692 7:67816864-67816886 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1026299456 7:69084379-69084401 CCTTATAAAAAAAAAGGAGCTGG - Intergenic
1026512789 7:71040898-71040920 CCTTATGAGAAGGTGGTAGATGG + Intergenic
1026884977 7:73935484-73935506 CCTTATAAGAAATAGGCAGAGGG + Intergenic
1027979116 7:85194871-85194893 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1028086557 7:86644290-86644312 CCTTATAAGAGGGAGGGTGGGGG + Exonic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1029180255 7:98695504-98695526 CCTTGTAAGGTGAAGTGAGAGGG - Intergenic
1029182254 7:98711471-98711493 CCTTATAAGAAGAAAAGATTAGG + Intergenic
1029256304 7:99271996-99272018 CCATATAAAAAGAGGGAAGATGG - Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030360034 7:108586106-108586128 ACATAGGAGAAGAAGGGAGACGG - Intergenic
1030600235 7:111583970-111583992 CCTAATAAGAAGAGGAGATAAGG - Intergenic
1030749607 7:113215197-113215219 TCTTATGGGAAGAAGGGAGCTGG - Intergenic
1031587241 7:123546977-123546999 CCTTATAAGAGAGAGGCAGAGGG + Intronic
1031878373 7:127167739-127167761 TCTGAGAAGAAGGAGGGAGATGG - Intronic
1031910406 7:127511110-127511132 CCTTCTAAGAGGAAGGCAGGAGG + Intergenic
1031914962 7:127554356-127554378 CCTTATAAGAGGAGAGGACATGG - Intergenic
1033342285 7:140501536-140501558 CCTTAGAAGAAGAAGAGATTAGG + Intergenic
1033679792 7:143583234-143583256 GCTTATATGTAGAATGGAGAAGG - Intergenic
1033692043 7:143746209-143746231 GCTTATATGTAGAATGGAGAAGG + Intergenic
1033929079 7:146501796-146501818 CATTATAAGAGAAAGGCAGAGGG + Intronic
1034760897 7:153670882-153670904 CCTTATAAGAAGAGGAGATCAGG - Intergenic
1034957114 7:155341847-155341869 CCTTAGAAGAAGAGGAGATAAGG - Intergenic
1035039283 7:155915911-155915933 CCTCATAAGAAGAAGAGATGAGG + Intergenic
1035046711 7:155972677-155972699 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1035116769 7:156531471-156531493 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1035117963 7:156540754-156540776 CCCCATGAGAAGCAGGGAGAGGG + Intergenic
1035143925 7:156793999-156794021 CGTTAAAGGAAGGAGGGAGATGG - Intronic
1035700813 8:1638311-1638333 CCTTATAAGAAGAGGAGATGAGG + Intronic
1035701125 8:1639855-1639877 CCTTACATGAGGAAGGGAGGGGG - Intronic
1035947126 8:3977651-3977673 TCTTATGAGCAGAAAGGAGAAGG - Intronic
1036574573 8:10014817-10014839 CCTTATAAGAAGAGGCGATTAGG - Intergenic
1036781426 8:11650564-11650586 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1036922841 8:12874293-12874315 CCTTATTACAAGTGGGGAGAAGG + Intergenic
1037241821 8:16786076-16786098 CCTTATAAGAGAAAGGTAGGGGG + Intergenic
1037616310 8:20522309-20522331 CCTTATAAGAAGGGGAGAGGAGG + Intergenic
1037641578 8:20748953-20748975 CCTTATAAGAAAGAGACAGAGGG - Intergenic
1037671366 8:21017964-21017986 CCTTATAAGAAAAAAGGATTTGG + Intergenic
1038016794 8:23522465-23522487 CTTTATAAGAAGAGAGGAGTTGG + Intergenic
1038324314 8:26561046-26561068 CCTTGAAAGAAGCAGGGGGAGGG + Intronic
1038340124 8:26679181-26679203 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1038349255 8:26761506-26761528 CCTTATAAGAAGAAGAAATTGGG + Intronic
1038486360 8:27937827-27937849 CCTTATAGGAAGAGGAGATAAGG - Intronic
1038660603 8:29493420-29493442 TCTTACAAGAAGAAGAGAGGAGG + Intergenic
1038701828 8:29856109-29856131 CCTTATAAGAGTGAGGCAGAGGG + Intergenic
1039146736 8:34455675-34455697 CCTTATAAGAAGAAGAAATATGG + Intergenic
1039719612 8:40149291-40149313 TCTTATAAGAAGGAGTCAGAAGG - Intergenic
1039720785 8:40162018-40162040 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1040115729 8:43616606-43616628 CCTTATAAAAACAAGAAAGAAGG + Intergenic
1040870768 8:52098364-52098386 CCTTATAAGAAGAAAAGATTAGG + Intergenic
1041107251 8:54455190-54455212 TGTTATAAGAAGTAGGGGGAGGG + Intergenic
1041432302 8:57796392-57796414 CCTTAGAAGACGGAGGGAGATGG - Intergenic
1041570998 8:59336804-59336826 TCTTATAAGAAAGAGGCAGAGGG + Intergenic
1041958482 8:63583727-63583749 CCTTTTAAGAAGGAGGGGGGTGG + Intergenic
1042000056 8:64112054-64112076 CCTTATAAGAAGAGGGGATTAGG - Intergenic
1042192218 8:66198509-66198531 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1042216723 8:66435518-66435540 CCTTATAAAAGGGAGGCAGAGGG - Intronic
1042576499 8:70226240-70226262 GTTTATAATAAGAAGGAAGAGGG + Intronic
1043137231 8:76543611-76543633 AGTAATTAGAAGAAGGGAGATGG - Intergenic
1043564271 8:81530769-81530791 CCTTTTAAGAGGGAGGAAGAGGG + Intronic
1043582068 8:81725619-81725641 CCTTAAGAGAGGAAGGCAGAAGG - Intronic
1043852329 8:85229072-85229094 TCTTATAAGGAGGAGAGAGACGG - Intronic
1044586030 8:93869808-93869830 CCTGAAGGGAAGAAGGGAGAAGG - Intronic
1044704231 8:94993177-94993199 CCTTATAAGAAGAGGAGATAAGG - Intronic
1045219708 8:100186843-100186865 CCTTATAAGAAGAAGATATTTGG - Intronic
1045247607 8:100457262-100457284 CCTCATAAGATGAGGGGATAAGG + Intergenic
1045401861 8:101827244-101827266 CCTGAAAAGAAAAAGGCAGAGGG - Intronic
1045478508 8:102574293-102574315 CCTTAGAAGAGGGAGGCAGAAGG + Intergenic
1045499914 8:102737338-102737360 CCTTATGAGAAGGAGTTAGAAGG - Intergenic
1045669277 8:104529180-104529202 CCTTATAAGAAGAGGAGATCAGG + Intronic
1045710628 8:104979346-104979368 CCTTATAAAAAGAAACTAGAGGG - Intronic
1045730603 8:105234900-105234922 CCTTGTAAGATGAAGCAAGAAGG + Intronic
1046222823 8:111237730-111237752 CCCTATAAGAGGGAGGGAGAGGG - Intergenic
1046414771 8:113898585-113898607 CCTTATATGAGGGAGGGAGGAGG - Intergenic
1046490744 8:114950630-114950652 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1046571754 8:115974932-115974954 CCTGAGAAGAAGGAGAGAGATGG + Intergenic
1046778330 8:118188001-118188023 CCTAAAAAGAAGGAAGGAGAAGG + Intergenic
1046837997 8:118824611-118824633 CCTTGTAAGAAGAAGAGATGAGG + Intergenic
1046886675 8:119375181-119375203 CCTAATAAGAAGGAGGCAGGAGG + Intergenic
1047002440 8:120586540-120586562 CCTTATAAGAGGGAGGCAGGAGG - Intronic
1047063475 8:121253581-121253603 CCTTAGAAGAGGGAGGAAGAAGG - Intergenic
1047344203 8:124011245-124011267 GGTTATAAGAAGACTGGAGAGGG - Intronic
1047541572 8:125771627-125771649 CCTTATGAAAAGGAGGCAGAGGG + Intergenic
1047771786 8:128035744-128035766 CCTTATTAGAGGGAGGCAGAGGG + Intergenic
1048270113 8:133021711-133021733 CCTTATAAGAAGAGGGGGTCAGG - Intronic
1048285546 8:133138442-133138464 CCTTAAAAGTAGAAGAGGGAGGG + Intergenic
1048356228 8:133656230-133656252 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
1048429877 8:134360250-134360272 CCTTATAAGAAAGAGAAAGAGGG + Intergenic
1048455585 8:134575326-134575348 CCTTATAAAAGGAAGGCAGGAGG + Intronic
1048535354 8:135289212-135289234 TCTGATAAAAAGAAGGAAGAAGG + Intergenic
1048917817 8:139201420-139201442 CCTTATAAGAGAGAGGCAGAAGG - Intergenic
1048977872 8:139683103-139683125 CCTGATAGGAAGAAGGAAAAGGG + Intronic
1049241685 8:141540571-141540593 CCTTATAAGAAGAGGCGATGGGG - Intergenic
1049358525 8:142200647-142200669 CCTTTTAAGAGGAAGGCAGGTGG + Intergenic
1049431681 8:142568252-142568274 CCTTCTAAGAGGAAGAGAGTAGG + Intergenic
1050043917 9:1523929-1523951 CCTTATAAGAAGGAGAGATTAGG + Intergenic
1050185230 9:2965949-2965971 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1050685649 9:8165607-8165629 CCTTATAAAGAAAAGGTAGATGG - Intergenic
1050868679 9:10538379-10538401 CCTTAGATGAAGAATAGAGAGGG - Intronic
1050984186 9:12061105-12061127 CCTTATAAGAAAAAAGCAGAAGG - Intergenic
1051035065 9:12734538-12734560 CCTTATAAGCAAAAGGCAGCAGG + Intergenic
1051734966 9:20188631-20188653 CCTTACAAGAGGGAGGCAGAAGG + Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052183108 9:25555430-25555452 CCTTATAAGAGGGAGGTAGGGGG - Intergenic
1052643965 9:31208158-31208180 CCTTACAAGAGGCAGGTAGAAGG - Intergenic
1053338209 9:37297619-37297641 CCTTATAAGAAGGAGCTATATGG + Intronic
1053446598 9:38157959-38157981 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1053638277 9:40038147-40038169 CCTTATAAGAGTGATGGAGAGGG - Intergenic
1053767806 9:41427076-41427098 CCTTATAAGAGTGATGGAGAGGG + Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054319071 9:63634747-63634769 CCTTATAAGAGTGATGGAGAGGG - Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054546473 9:66338577-66338599 CCTTATAAGAGTGATGGAGAGGG + Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054728429 9:68676317-68676339 CATCAAAAGAAGCAGGGAGAAGG - Intergenic
1054983501 9:71234627-71234649 TCTTATAAGAAGAAGAGATTAGG - Intronic
1055086928 9:72323896-72323918 GCTTCTAAGAGGAAGGTAGAAGG - Intergenic
1055797479 9:79990707-79990729 CCTCATAAGAAGAAGGCAATGGG + Intergenic
1055827926 9:80349041-80349063 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1056233339 9:84568915-84568937 CCTTCTAAGAAGGAAGCAGAGGG + Intergenic
1056512089 9:87315931-87315953 TCTTATAAGAGGGAGGGAGAGGG + Intergenic
1056938986 9:90938925-90938947 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1057394251 9:94665586-94665608 CATGGTAAGAAGGAGGGAGATGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057863424 9:98660828-98660850 TCTTATAAGAAGGAGGCAGGAGG - Intronic
1058109049 9:101010511-101010533 CCTTATAAGAAGAAAAGATTAGG + Intergenic
1058154556 9:101500663-101500685 CCTTTTGAAAAGAAGGTAGATGG + Intronic
1058513145 9:105741065-105741087 CCTTATAAGAGGAAAACAGAGGG + Intronic
1058681034 9:107440422-107440444 CTTTAAAAGAGGAAAGGAGAGGG + Intergenic
1059014114 9:110495394-110495416 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1059058978 9:111015014-111015036 CCTTATAAGAGGAAGAAAGTTGG + Intronic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1059343170 9:113611054-113611076 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1059561285 9:115337059-115337081 CCTTATAAGAAGGAGGCAAAGGG - Intronic
1059856218 9:118400453-118400475 CCTTATAAGAAGACGAGATTAGG + Intergenic
1060303099 9:122387541-122387563 ACTTATAAGAAGAAGAGATTAGG + Intronic
1060490911 9:124083476-124083498 CCTTATCAGGAGTAGGGAGGTGG - Intergenic
1060541399 9:124432963-124432985 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1061374348 9:130215276-130215298 ACTCAAAAGAAGCAGGGAGAAGG + Intronic
1061723221 9:132566637-132566659 CTTTAGAAAGAGAAGGGAGATGG - Intronic
1061755751 9:132811325-132811347 CCTTATAAGAAGGAGGTAAGAGG + Intronic
1202786148 9_KI270719v1_random:21706-21728 CCTTATAAGAGTGAGGGAGAGGG - Intergenic
1185604906 X:1363074-1363096 CCTTATAAGAAGAGGAGACGTGG - Intronic
1185606251 X:1368652-1368674 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185687392 X:1940574-1940596 CTTTCTAAGAAGGAGGCAGAGGG - Intergenic
1185691136 X:2156094-2156116 CTTCATAAGAGGAAAGGAGAAGG - Intergenic
1185704699 X:2258004-2258026 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185721826 X:2388416-2388438 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185746078 X:2574575-2574597 CCTTATAAGAAGAGGAGACGAGG + Intergenic
1185758708 X:2673036-2673058 CCTTATAAGAAGAAGATATTGGG - Intergenic
1185776359 X:2805731-2805753 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185790215 X:2923651-2923673 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185791837 X:2933057-2933079 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185800670 X:3007664-3007686 CCTCATAAGAAGAAGAGATGAGG - Intronic
1185815378 X:3150282-3150304 CCTTATAAGAAGAGGAGAGGAGG - Intergenic
1185841674 X:3397884-3397906 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1185853484 X:3510707-3510729 TCTCATAAGAAGAGGGGATAAGG + Intergenic
1185921971 X:4103482-4103504 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185943338 X:4346090-4346112 CCTTATAAGAAGAGGAGAAGAGG + Intergenic
1185943607 X:4349138-4349160 CCTTATAAGAAGAGGAGATTCGG + Intergenic
1186063660 X:5738552-5738574 CCTTATAAGAAGAAGATATTAGG - Intergenic
1186186816 X:7028957-7028979 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1186371686 X:8953357-8953379 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1186410308 X:9340697-9340719 CCTTATAAGAAGAGGCGATGAGG + Intergenic
1186445239 X:9621469-9621491 CCTTTTTAAAATAAGGGAGATGG + Intronic
1186894880 X:13995736-13995758 CCTTATAAGAGGGAGGGAGGTGG - Intergenic
1187266676 X:17740018-17740040 CCTTATGGGAAGAAGTGAAAAGG + Intronic
1187295870 X:17999981-18000003 CCTTATAAGAGGAAGACAGAGGG - Intergenic
1188032884 X:25284106-25284128 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1188152485 X:26695197-26695219 TCTTATAAGAGGGAGGCAGAAGG + Intergenic
1188325874 X:28800203-28800225 CCTTATAAGAGAAAAGCAGAAGG - Intronic
1188981684 X:36732604-36732626 CCTTATAAAAGAAAGGCAGAGGG + Intergenic
1189365516 X:40384922-40384944 CCTCATAAGAGAAAGGCAGAGGG - Intergenic
1189532674 X:41902464-41902486 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1190243165 X:48673539-48673561 CCTTATAAGAAGAGACGTGATGG - Intergenic
1190395206 X:49975440-49975462 CCTTATAGGAAGAGGGTAAATGG - Intronic
1190444492 X:50509892-50509914 CCTTATAAGAAGAGGGGATTTGG + Intergenic
1190486606 X:50932491-50932513 CCTGAGAAGAGGAAGAGAGATGG - Intergenic
1190792207 X:53710970-53710992 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1191699884 X:64030326-64030348 TCCCAGAAGAAGAAGGGAGAGGG - Intergenic
1191755536 X:64588524-64588546 CCTTATAAAAAGAAGGCAGGAGG - Intergenic
1191801936 X:65091165-65091187 CCTTATAAGAGGGAGACAGAAGG + Intergenic
1191955013 X:66634746-66634768 CCATATACGAAGAAAGGAGTTGG + Intronic
1192093608 X:68186800-68186822 CCTTATAAGAAGGTGCCAGAGGG - Intronic
1192888043 X:75357960-75357982 ACTGGTAAGAAGTAGGGAGAAGG + Intergenic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1193294686 X:79820649-79820671 ACTTTTAAGAACAAGGGACATGG - Intergenic
1193319747 X:80107329-80107351 CCTTATAGGATTAAGGAAGAGGG + Intergenic
1193426575 X:81347377-81347399 CCTTATAAGGGTAAGGAAGAGGG - Intergenic
1193479985 X:82015710-82015732 ACTTATAAGAAGCAAGGAGCTGG + Intergenic
1193758120 X:85433753-85433775 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1194100496 X:89697335-89697357 CCTGAAAAGAGGGAGGGAGAAGG + Intergenic
1194216568 X:91136412-91136434 CCTTAAGAGAAAAATGGAGAAGG - Intergenic
1194265248 X:91745135-91745157 TCTTATGAGAACAAGGCAGAGGG + Intergenic
1194910185 X:99631758-99631780 GCTCATAAGAAGAAGGAAGATGG - Intergenic
1195272462 X:103245400-103245422 CCTTATAAGAGAGAGGCAGAGGG - Intergenic
1195509098 X:105693715-105693737 CCTTATAAGAGAGAGGCAGAAGG + Intronic
1195604331 X:106785444-106785466 CCTTATAAGAGGGAGAGAGAGGG + Intronic
1195664559 X:107416982-107417004 CCTTATAAGAGGGATGCAGAGGG + Intergenic
1195706671 X:107742630-107742652 CCTTTTATGAAGGAGGGTGAAGG - Intronic
1196249032 X:113436385-113436407 CCTTATAAAAAGGAAGCAGAAGG + Intergenic
1196293386 X:113970083-113970105 GCTTATAAGAAGTAAAGAGATGG - Intergenic
1196391061 X:115207881-115207903 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196391151 X:115208905-115208927 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196559986 X:117134691-117134713 CCTTATGGGAAGAAAGCAGAGGG - Intergenic
1197379050 X:125715670-125715692 CCTTATGAGAAAAAGAGATATGG + Intergenic
1197951513 X:131902506-131902528 CCTTTTAAGAAAAGGGGATAAGG + Intergenic
1197968131 X:132086537-132086559 CCTTATAAGAAGAAGAAATTTGG + Intronic
1197985603 X:132263640-132263662 CCTTATAAAAGGGAGGCAGAAGG + Intergenic
1198105601 X:133458397-133458419 CCTTATAAGAGAAAGGCGGAGGG - Intergenic
1198263113 X:134984159-134984181 TCTTCTAAGAAGAAGGGATTAGG - Intergenic
1198640931 X:138755968-138755990 CCTTATAAGAAGAAGATATTAGG + Intronic
1198959298 X:142167364-142167386 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1199228940 X:145412223-145412245 CCTTATAAGGTGAAGGCAGGAGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199402516 X:147415662-147415684 TCTTATAAGAGGAAAGGAGGAGG - Intergenic
1199524343 X:148775772-148775794 CCTTATAAGAGAGAGGCAGAGGG - Intronic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199902968 X:152195705-152195727 CCTTATAAGAATCAGGCAGAAGG - Intronic
1199950148 X:152700211-152700233 CCCTATAAGGAGAAAGGTGAGGG + Intronic
1200453451 Y:3358397-3358419 CCTGAAAAGAGGGAGGGAGAAGG + Intergenic
1200582400 Y:4965583-4965605 TCTTATGAGAACAAGGCAGAGGG + Intergenic
1200809948 Y:7473819-7473841 TCTTATAAGAAGAGGAGATAAGG - Intergenic
1201231370 Y:11867942-11867964 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201232711 Y:11880116-11880138 TCTCATAAGAAGAGGGGATAAGG + Intergenic
1201248709 Y:12033493-12033515 ACTGATAAGAAGAAAAGAGAGGG - Intergenic
1201265920 Y:12206449-12206471 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1201284097 Y:12364286-12364308 CCTCATAAGAAGAGGAGATAAGG + Intergenic
1201293616 Y:12445744-12445766 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201542416 Y:15120524-15120546 CCTTATAAGAAAAAGAGATGAGG + Intergenic
1201625064 Y:16005829-16005851 CCTTATAAGAGGAAGGCAGTAGG + Intergenic
1201728179 Y:17177348-17177370 CCTTATAAGAATAAGAGATGAGG + Intergenic