ID: 1098593996

View in Genome Browser
Species Human (GRCh38)
Location 12:72249476-72249498
Sequence CTGGAGTTTCAGATCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101448
Summary {0: 2, 1: 66, 2: 2843, 3: 30443, 4: 68094}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098593985_1098593996 27 Left 1098593985 12:72249426-72249448 CCTGTAATCCCAGTTACTCTGGA 0: 147
1: 7427
2: 118072
3: 258046
4: 226170
Right 1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG 0: 2
1: 66
2: 2843
3: 30443
4: 68094
1098593987_1098593996 18 Left 1098593987 12:72249435-72249457 CCAGTTACTCTGGAGACTGAAGC 0: 1
1: 46
2: 1644
3: 29235
4: 232467
Right 1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG 0: 2
1: 66
2: 2843
3: 30443
4: 68094
1098593986_1098593996 19 Left 1098593986 12:72249434-72249456 CCCAGTTACTCTGGAGACTGAAG 0: 1
1: 75
2: 2172
3: 34907
4: 256238
Right 1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG 0: 2
1: 66
2: 2843
3: 30443
4: 68094

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098593996 Original CRISPR CTGGAGTTTCAGATCAGCCT GGG Intronic
Too many off-targets to display for this crispr