ID: 1098595826

View in Genome Browser
Species Human (GRCh38)
Location 12:72272581-72272603
Sequence GGCCCGGGTGGCCCGCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 210}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098595813_1098595826 29 Left 1098595813 12:72272529-72272551 CCAGTCGCGCGCCCTCGGCCCGC 0: 1
1: 0
2: 0
3: 44
4: 347
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210
1098595817_1098595826 10 Left 1098595817 12:72272548-72272570 CCGCGTGAGCTCTCCGATGCCTG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210
1098595815_1098595826 17 Left 1098595815 12:72272541-72272563 CCTCGGCCCGCGTGAGCTCTCCG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210
1098595820_1098595826 -3 Left 1098595820 12:72272561-72272583 CCGATGCCTGCTCTGGCTGTGGC 0: 1
1: 0
2: 4
3: 44
4: 314
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210
1098595823_1098595826 -9 Left 1098595823 12:72272567-72272589 CCTGCTCTGGCTGTGGCCCGGGT 0: 1
1: 0
2: 3
3: 23
4: 321
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210
1098595814_1098595826 18 Left 1098595814 12:72272540-72272562 CCCTCGGCCCGCGTGAGCTCTCC 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210
1098595812_1098595826 30 Left 1098595812 12:72272528-72272550 CCCAGTCGCGCGCCCTCGGCCCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210
1098595816_1098595826 11 Left 1098595816 12:72272547-72272569 CCCGCGTGAGCTCTCCGATGCCT 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098595826 Original CRISPR GGCCCGGGTGGCCCGCCCGC GGG Intronic
900339760 1:2182456-2182478 GTCCCCGGTGCCCCGCCAGCTGG - Intronic
900437534 1:2638662-2638684 GGCCTGGGTGTCCCGCCTGGAGG - Intronic
901628204 1:10635295-10635317 GGCCCTGGTGGGCCTCCCGTGGG - Intergenic
902413995 1:16228268-16228290 GGCCCGAGTGGCCAGGCCACAGG - Intergenic
903012814 1:20343163-20343185 GGCCGGGGTGGCGGGCCTGCTGG - Exonic
903514809 1:23903105-23903127 GGCACGGGTGGCAGCCCCGCGGG - Intronic
903724627 1:25431314-25431336 GGAGCCGCTGGCCCGCCCGCCGG + Intronic
904006133 1:27364226-27364248 GGGCCGGCTTGCCCGCCTGCTGG - Exonic
904587664 1:31588963-31588985 GGCTCCAGCGGCCCGCCCGCCGG + Intergenic
904618599 1:31762888-31762910 GGCCCGGGCGCCCCTCCCCCCGG + Intronic
904744453 1:32702571-32702593 GGCCCGCGTCGCCGCCCCGCTGG - Intronic
905399564 1:37691842-37691864 GGCGGGAGTGGCCGGCCCGCGGG + Intronic
905449212 1:38046368-38046390 CGCCCGCGTGGGCCGCCCCCTGG + Exonic
905656957 1:39691554-39691576 GGCCGGCGAGGCCCGGCCGCAGG + Exonic
905862585 1:41361328-41361350 AGCCCAGGTGCCCCGCCCGCGGG - Intergenic
906711623 1:47934485-47934507 GGCCCGCCTGCCCCTCCCGCTGG - Intronic
910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG + Exonic
913130982 1:115838469-115838491 GGCCCGGGCCGCGCGTCCGCTGG - Exonic
915616975 1:157046174-157046196 GGCCGGGGTCGCCCGCGGGCCGG - Intergenic
917974228 1:180229323-180229345 GGCCGGGGAGGCCCCGCCGCGGG + Intergenic
920385678 1:205568990-205569012 AGCCCGGCCGGCCCTCCCGCGGG + Exonic
922518075 1:226223352-226223374 GGCCCGGGTGCGCGGGCCGCAGG - Intergenic
922804242 1:228377436-228377458 GGCCCTGGTGGCCCCCACCCCGG + Intronic
1070032664 10:72692362-72692384 TGCCCCGGCGGCCTGCCCGCCGG - Intronic
1071431381 10:85609645-85609667 GGCCAGGGTGGCCGGGCAGCAGG - Intronic
1072617051 10:97056897-97056919 GGCCTGGGTGTCCCCCCTGCAGG + Intronic
1073076026 10:100826415-100826437 GGCGCAGGTGGACTGCCCGCTGG - Intronic
1075112023 10:119596012-119596034 GGCCCGCGGGGCCCACCCCCGGG + Intronic
1076395860 10:130136817-130136839 GGCCTGGGCGGCCCCGCCGCGGG + Intronic
1076532530 10:131154479-131154501 AGCCCTGGTGGCCCGGCCCCAGG - Intronic
1082028770 11:47590296-47590318 GGCGCGGGCGGCCCGCGCGCAGG + Exonic
1082843918 11:57712055-57712077 GTGCCGGGTCCCCCGCCCGCAGG + Exonic
1083846078 11:65334274-65334296 GGCCCGGGCGGCCCTACGGCTGG + Intronic
1083876126 11:65525214-65525236 GGCCCGGGCAGGCCGCCCTCTGG - Exonic
1084209449 11:67614340-67614362 GTGCCGGGTGCCCCGCCCCCTGG - Intergenic
1084225191 11:67711183-67711205 CGCCCGGCTGGCCCGGCCTCTGG - Intergenic
1084810382 11:71608090-71608112 CGCCCGGCTGGCCCGGCCTCTGG + Intergenic
1085266566 11:75241055-75241077 GCCCCGGCTGTCCCGCGCGCGGG - Exonic
1085705955 11:78786973-78786995 AGCGCGGGTGGCAGGCCCGCTGG + Exonic
1090780293 11:130001947-130001969 GGGGCGGGGGGCCGGCCCGCAGG - Intronic
1090832396 11:130428418-130428440 GGCCCGCGGGGCCCGGCGGCGGG + Exonic
1092229306 12:6767728-6767750 CGCCCGTGTGGCCCTCCGGCGGG + Intronic
1092365501 12:7873298-7873320 AGCCCAGCCGGCCCGCCCGCGGG - Intronic
1095752974 12:45730344-45730366 GCGCCGGGCCGCCCGCCCGCCGG - Intronic
1096459538 12:51814586-51814608 GGCCCGGCTACCCTGCCCGCCGG + Intergenic
1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG + Intronic
1103509810 12:121466862-121466884 CGCCCGGCAGGCCCGCCCGACGG + Intronic
1103701189 12:122849510-122849532 GGCCCAGCTGGCCCGGCCGCAGG + Intronic
1103910307 12:124348480-124348502 GGCCCTGGGGGCCTGCCAGCAGG + Intronic
1104259056 12:127166130-127166152 GGGCGGGGCGGCCCGCCGGCGGG + Intergenic
1104599719 12:130144491-130144513 GAGCCGGGTGCCCCGCCTGCTGG - Intergenic
1105309097 13:19190352-19190374 GGCTCGGGAGGCCCCCCTGCTGG - Intergenic
1105528508 13:21197796-21197818 GGCTCGGGAGGCCCCCCTGCTGG + Intergenic
1105779620 13:23695371-23695393 GGCCCTGGGCGCCCGCCGGCTGG - Intergenic
1106157383 13:27171445-27171467 GGCCCGGGCGGCCCGGGCGGGGG - Intronic
1106476766 13:30105608-30105630 GGCCCGGGAGGCCTGGCTGCAGG + Intergenic
1107414412 13:40187754-40187776 TGTCCGTGTGGCCCGCCAGCTGG + Intergenic
1113082520 13:106534393-106534415 CACCCCGGTCGCCCGCCCGCGGG + Intronic
1117072418 14:52068964-52068986 GGACCGGGTGGCCGGGCGGCCGG - Exonic
1118896466 14:69949724-69949746 GGCCCGTGTGCCCCACCAGCAGG + Intronic
1121098529 14:91234084-91234106 GGCCAGGGAGGCCTACCCGCTGG - Exonic
1122901626 14:104784493-104784515 GTCCCGGGTGGCCCTCCGGCAGG + Intronic
1122983798 14:105203155-105203177 GACTCGGCTGGCCCGCCCCCTGG - Intergenic
1123028677 14:105440405-105440427 GCCCCGGGTTGCCTGCCAGCTGG - Intronic
1123787346 15:23686950-23686972 GGCCCGGCTGGGCCGCGCTCGGG + Exonic
1131153908 15:90063245-90063267 GGCCCGTGTGGCCCCACAGCTGG - Intronic
1132584606 16:700764-700786 GGCGCGGGTGGCGCGCCGGCCGG - Intronic
1132747650 16:1443658-1443680 GGCCGAGGTGGCCTGCCTGCGGG - Exonic
1133038178 16:3046268-3046290 GGCCCGGGCCGCCCTCCCCCAGG + Intergenic
1133304859 16:4802490-4802512 CGCCCCGCCGGCCCGCCCGCTGG + Intronic
1133311293 16:4848082-4848104 GGCGCGGGCCGCCCGCCCGCTGG + Intronic
1136672903 16:31874032-31874054 GGCCCGGGTGCCCCTACAGCGGG - Intronic
1137618032 16:49858284-49858306 GGCCCGGCTGGCCGGCAGGCTGG - Intergenic
1137785648 16:51135111-51135133 GACCCGAGTGGCCCGCGCCCTGG + Intergenic
1138178723 16:54928830-54928852 GGCCCGCGCGCGCCGCCCGCCGG - Intergenic
1139436796 16:66941165-66941187 GGCCCTGGTGGGCTGCCTGCGGG + Exonic
1141430510 16:83968474-83968496 GGTCCGGCCGGCCCGCCCCCCGG + Intergenic
1141621423 16:85238481-85238503 GGCCAGGGCGGCCCTCACGCAGG - Intergenic
1141742853 16:85905565-85905587 GGCACTGGTGGCCCTCCCGATGG - Intronic
1142120152 16:88383119-88383141 CGCCCGGGCCGCCCGCCCGCCGG - Intergenic
1143344877 17:6242161-6242183 GGCCAGTGAGGCCCGCCAGCTGG - Intergenic
1144434792 17:15230964-15230986 GGCCTGGGTGGCCTTCCCCCTGG - Exonic
1144769622 17:17752370-17752392 GCCCCGGGGGCCCCGCCCACAGG - Intronic
1144889999 17:18489108-18489130 GGCCCTGGTGGCCTGCTGGCTGG - Intronic
1144952949 17:19003912-19003934 GGCCCTGGTGGCCCGCGGCCGGG - Exonic
1145142217 17:20455209-20455231 GGCCCTGGTGGCCTGCTGGCTGG + Intronic
1145935237 17:28711325-28711347 GGCCCTGCTGGGTCGCCCGCGGG - Intronic
1145954049 17:28842512-28842534 GGCACGGGTGGCCCGGTCGCCGG - Intronic
1146656388 17:34637521-34637543 GGCCCGGGGAGCTGGCCCGCCGG + Exonic
1147250707 17:39151321-39151343 GGCCCGGGTGGGCCGGGGGCGGG - Intronic
1147726105 17:42567076-42567098 GCCGCAGGGGGCCCGCCCGCTGG + Exonic
1147879752 17:43646089-43646111 GATCCGGGTTGGCCGCCCGCGGG + Intronic
1150562172 17:66303188-66303210 GTCCCGGGAGTCCTGCCCGCCGG - Intronic
1151670764 17:75570555-75570577 GGGCCGTGTGGCCCCCCTGCTGG - Intronic
1151974931 17:77479436-77479458 GCCCCGGCTGGCCCGCAGGCAGG - Intronic
1155152722 18:23135602-23135624 GGCGAGCATGGCCCGCCCGCGGG + Intronic
1159045755 18:63367281-63367303 CGCCTGGGTGGCGCGCGCGCCGG - Exonic
1160100499 18:75916233-75916255 CGCGCGGCTGGCACGCCCGCCGG + Intergenic
1160708612 19:540709-540731 GGCCGGGGTGGCCAGGCCCCCGG + Intronic
1160708655 19:540820-540842 GGCCGGGGTGGCCAGGCCCCCGG + Intronic
1160810479 19:1010956-1010978 GTCCCGGGTGGGCTGCCCTCTGG - Intronic
1160902372 19:1434826-1434848 GGGTCGGGGGGCCCCCCCGCCGG + Exonic
1161041008 19:2110755-2110777 TGCCAGGATGGCCCGGCCGCAGG - Exonic
1161273991 19:3405134-3405156 GGCCCAGGCGGCCCGGCGGCAGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162755720 19:12858435-12858457 GCCCCGGGTGGCTCACCCGTAGG - Exonic
1162776613 19:12983643-12983665 GGCACGCGCGGCCCGCGCGCAGG - Intergenic
1163687442 19:18719756-18719778 GCCCCGGGTCAGCCGCCCGCAGG - Intronic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1164834563 19:31349297-31349319 GGCCCGCCTCGCCCCCCCGCGGG - Exonic
1165830031 19:38725905-38725927 TGCGCGGCTGCCCCGCCCGCTGG + Intronic
1165879472 19:39032189-39032211 GACCCGGGCGGCCCGGCCCCTGG + Exonic
1165993049 19:39826897-39826919 GGCCCGGCTCCCCCGCCCGCCGG + Exonic
1166039093 19:40191545-40191567 GGCCGGGGTGGCGCGCCCCTCGG - Intergenic
1166112210 19:40629560-40629582 GGCGCGGGTGGGCGGCCAGCGGG - Exonic
1166367343 19:42284338-42284360 GCCCCGCCTGCCCCGCCCGCCGG + Intronic
1166852773 19:45768433-45768455 GGCCCTGGTGGCCTTCCAGCGGG - Exonic
1166974935 19:46600548-46600570 GGCCCAGGGGTCCCGCCCACCGG + Intronic
1167056230 19:47112858-47112880 CTCCCGGGTGTCCCGCCCCCCGG - Intronic
1167175358 19:47860731-47860753 GGCCCGGGTGAGCCGCTCGGGGG - Intergenic
1167466056 19:49651624-49651646 AGGCCGGGCGGCCCGGCCGCCGG - Exonic
1168076389 19:53982742-53982764 GGCGCGGGTGGCGCGGGCGCGGG - Exonic
1168515157 19:57004635-57004657 GGCCGGGGTGGCGTGCCCGGTGG - Intergenic
926914344 2:17878511-17878533 GGCCCGGGGCGCCCGGCTGCGGG + Intronic
927714178 2:25341782-25341804 GGCCCGGAAGGCCGGCCCGGAGG - Intronic
927846061 2:26473504-26473526 GGCCCAGGTGGACCGGCCACGGG - Exonic
935229358 2:101082409-101082431 GGCCAGGGTGCCCAGCCTGCAGG - Intronic
935237463 2:101150989-101151011 GGCCCGGACGGCCCTGCCGCGGG - Intronic
937316975 2:120937881-120937903 GGCCTGGGTGGCCGGCGGGCTGG - Intronic
937320496 2:120957991-120958013 GGCCCGGCTGGCCCTCCCTTGGG - Intronic
938407287 2:131039658-131039680 GGGATGGGTGGCGCGCCCGCTGG - Intronic
944221759 2:197310539-197310561 CGCCCGCGCGTCCCGCCCGCCGG + Intronic
947840533 2:233204673-233204695 GGCCCTGGTGGCCCCTCCTCCGG - Exonic
949018211 2:241725427-241725449 GCTCCGCGTGCCCCGCCCGCTGG + Exonic
949032415 2:241803281-241803303 GGCCAGGGTGGCCCACCCGCGGG - Intronic
1172277204 20:33686224-33686246 GGCGCGCATGGGCCGCCCGCAGG + Exonic
1173800221 20:45890604-45890626 GCCCCGGGAGGGCCGCCCGGAGG - Exonic
1174174516 20:48636417-48636439 GGCCCCGCTGGCCCACCCACTGG - Intronic
1174404144 20:50292824-50292846 GGCCCAGGTGACTCACCCGCTGG - Intergenic
1174606965 20:51768231-51768253 GGCCAGGCTGGCCCGAGCGCCGG + Intronic
1175989264 20:62779354-62779376 GGCCCCGGGGCCCCGCCCACAGG + Intergenic
1176375886 21:6086702-6086724 GGCCCGGCTTCCTCGCCCGCTGG - Intergenic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176871317 21:14084888-14084910 GGGCGGAGTGGCCCGCCAGCTGG + Intergenic
1178314893 21:31559370-31559392 GGCCCGGGGAGATCGCCCGCAGG + Intronic
1179540981 21:42083138-42083160 GGCCCCTGAGGCCAGCCCGCTGG - Intronic
1179747589 21:43451542-43451564 GGCCCGGCTTTCTCGCCCGCTGG + Intergenic
1181046115 22:20215086-20215108 CGCCCTGGTGGCCAGCCTGCTGG - Intergenic
1181450556 22:23017282-23017304 GGCCCGGGGGGCCTGCCGGCGGG + Intergenic
1181638840 22:24186527-24186549 GGCCTGGGTGGTCCGACCTCAGG + Intronic
1183742629 22:39677334-39677356 GGCCCAGGTTGCCCACCTGCGGG - Exonic
1184473059 22:44706856-44706878 TGCCCGGCTGGCCTGCCGGCCGG + Intronic
1184656228 22:45943512-45943534 GCCCAGGGTGGCCTGCCCTCGGG + Intronic
1185255194 22:49827741-49827763 GGCTCGGGGGGCCCGGCCGGCGG + Intergenic
1185420501 22:50731916-50731938 GGCCCTAGTGGCCCGCCCTGGGG + Intergenic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
950406844 3:12810224-12810246 GGACCGGCTGCCCGGCCCGCGGG + Exonic
950632631 3:14293305-14293327 GGCCCGCGGGGTCCGCCGGCCGG - Intergenic
953705128 3:45225468-45225490 GGCCCGGGCGGCTCGGCCGCGGG + Exonic
954809363 3:53238635-53238657 GGCCAGTGGGGCCAGCCCGCAGG - Intronic
962134747 3:132722167-132722189 GGCCCGGGTCGCTGCCCCGCGGG - Exonic
963133275 3:141877122-141877144 GGCCCGGCCGGGCTGCCCGCGGG - Intronic
968729110 4:2261502-2261524 GGCCCGGGAGGCGCGGCCGCGGG + Intronic
969021523 4:4142942-4142964 CGCCCGGCTGGCCCGGCCTCTGG - Intergenic
972532983 4:39977346-39977368 GGCCCGGTGGGGCCGCCCGAGGG - Intronic
983940608 4:173531338-173531360 GGCCCGGGTGCCCCGCGGCCCGG - Intergenic
984146342 4:176065933-176065955 GGCCCGGCCGCCCCGCCCCCGGG + Intronic
985896127 5:2751011-2751033 GGCTCGGTTGGCCGCCCCGCAGG - Intronic
991913944 5:71587565-71587587 CGCCCCGGTGGCCTGGCCGCCGG + Intronic
997453993 5:134004521-134004543 GGCCCCGGCAGCCCGGCCGCGGG - Intronic
999322805 5:150625404-150625426 AGCCCGGTCGCCCCGCCCGCAGG - Intronic
1001159532 5:169300978-169301000 GGCCCCGCTGGCCCGCGGGCCGG + Intronic
1001419203 5:171573976-171573998 TGTCCGGGTGGCCCGGCTGCCGG - Intergenic
1002189893 5:177472902-177472924 GGGCCGGGCGCCCCGCCCACCGG - Exonic
1006983973 6:38165944-38165966 ATCCCGGGGGGCCCCCCCGCAGG - Intergenic
1007072058 6:39045158-39045180 GGGCCGGGTGGCCTGCTCTCAGG + Intergenic
1012399309 6:98831668-98831690 GGCCCGGTTGGCGCGAACGCCGG - Intergenic
1015625902 6:135181083-135181105 GGCCCGGGAGGCGCGCGGGCAGG - Intergenic
1016386810 6:143537229-143537251 GGCCGGGGAGGGCCGGCCGCGGG + Intronic
1016904861 6:149138275-149138297 GCCCGGGGAGGCCCGCCAGCAGG + Intergenic
1020308944 7:6854971-6854993 CGCCCGGCTGGCCCGGCCTCTGG - Intergenic
1022734367 7:33062508-33062530 GGGCCGGCTGGGCCGTCCGCTGG - Intronic
1024940493 7:54758918-54758940 GAGCTGGGTGGCCGGCCCGCGGG - Intronic
1025089690 7:56051878-56051900 GGCCGAGGTGGCCCGAGCGCAGG + Exonic
1029238705 7:99143697-99143719 GGCGCGGGTGGGCCTCCCGCCGG + Intronic
1029649270 7:101879724-101879746 GTGCCGTGCGGCCCGCCCGCAGG + Intronic
1030216039 7:107044748-107044770 GGCCCGGCTGGCCCGGCCCGCGG - Exonic
1033220487 7:139523936-139523958 GGCCCGGGAGCCCCCCTCGCGGG + Exonic
1035725713 8:1823949-1823971 GTCCCGGATCGCGCGCCCGCCGG - Intergenic
1035764087 8:2091810-2091832 GGCCCAGGTGGCCGGCACGGAGG + Intronic
1036823176 8:11955783-11955805 GGCCCTGATGGCCCCTCCGCCGG - Intergenic
1048995069 8:139789185-139789207 GGCGTGGGTCTCCCGCCCGCCGG - Intronic
1049418037 8:142504430-142504452 GGCCCTGGTGGCCCTGCCTCTGG - Intronic
1049537327 8:143188478-143188500 TGCCCGGGGGGCCCGGCAGCTGG - Intergenic
1049578892 8:143401831-143401853 AGCCAGGATGCCCCGCCCGCTGG - Intergenic
1049761447 8:144333714-144333736 GGCCGGGGCGGCACGCGCGCGGG - Exonic
1049788524 8:144462611-144462633 GGCGGGGGCGGCCCGGCCGCGGG - Intronic
1056763606 9:89431269-89431291 GCCCCGGGTGGCTCACCCGCAGG - Intronic
1057192428 9:93095453-93095475 GATCCAGGTGGCCCGCCGGCCGG - Intergenic
1057207777 9:93184013-93184035 AGCCCAGGTAGCCGGCCCGCAGG + Intergenic
1059470827 9:114504192-114504214 GGCCCGGGTGACCCACGCGGAGG - Exonic
1060700560 9:125746819-125746841 GGCCCCGGCGGGCCGCGCGCCGG - Intergenic
1060945962 9:127569290-127569312 CGCCCCTGTGCCCCGCCCGCCGG - Intronic
1061050408 9:128191633-128191655 GGCTCGGGTGGCGCGGCCGGAGG - Intronic
1061128241 9:128689831-128689853 GGCCTGGGTGGCCCGCGCCGCGG + Intronic
1061537674 9:131259771-131259793 GGTCCAGGTGGCCGGCCCCCAGG + Exonic
1061878011 9:133554566-133554588 GGCCCGGGTGGCCGAACAGCCGG - Exonic
1062277207 9:135736678-135736700 GGCCCGGGGGGCGCCCCAGCCGG + Intronic
1062375452 9:136259905-136259927 GCACGGGGTGGCCCGCCTGCTGG + Intergenic
1062375466 9:136259973-136259995 GGCCGGGGTGGCCCGGTCACAGG + Intergenic
1062491874 9:136808618-136808640 GGCCCGGCTGCCCGGCCCGGGGG + Intronic
1062507790 9:136886856-136886878 GGGCCGGGTGGGCCGCCCACGGG - Intronic
1203773697 EBV:61577-61599 GGCCCGGGCGGCCTACCTGCGGG - Intergenic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1187900837 X:24025557-24025579 GGCCCGGGAGGCCCCCCCCTCGG + Intronic
1196705932 X:118717202-118717224 GGGCCGGCTGGCCGGCCGGCCGG + Intergenic
1196911173 X:120485937-120485959 GGCCCGGCTGGCGCGCCTTCAGG + Intergenic
1198531073 X:137549917-137549939 CGCCCTCTTGGCCCGCCCGCCGG - Intergenic
1200098235 X:153674015-153674037 GGCCCGGCTGGGCCGGCCCCAGG + Exonic
1200252386 X:154560407-154560429 GGCCCGGGCGGCCAGCGAGCAGG + Exonic
1200265381 X:154644009-154644031 GGCCCGGGCGGCCAGCGAGCAGG - Intergenic
1200277786 X:154750896-154750918 GTCCCGGGGCACCCGCCCGCGGG - Intronic