ID: 1098595876

View in Genome Browser
Species Human (GRCh38)
Location 12:72272762-72272784
Sequence CACCCTTCGCAGCCGCGATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098595873_1098595876 -8 Left 1098595873 12:72272747-72272769 CCGAGAAGAGCAGCTCACCCTTC 0: 1
1: 0
2: 4
3: 25
4: 199
Right 1098595876 12:72272762-72272784 CACCCTTCGCAGCCGCGATGGGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098595876 Original CRISPR CACCCTTCGCAGCCGCGATG GGG Exonic
904495208 1:30882566-30882588 CACCCATCACAGCCCTGATGGGG - Intronic
904834354 1:33325201-33325223 CACCCACAGCAGCCGCGATCTGG + Intronic
923430084 1:233911611-233911633 AACCCTTCGCATCTGCCATGGGG + Intronic
1074989355 10:118689239-118689261 CACCTTTGGCAGCTGTGATGGGG - Intronic
1081570866 11:44289987-44290009 CTCCCTTCACAGCCAAGATGCGG + Intronic
1091538972 12:1441583-1441605 CAGCCTTTGCAGCCCAGATGTGG + Intronic
1098595876 12:72272762-72272784 CACCCTTCGCAGCCGCGATGGGG + Exonic
1105002635 12:132701263-132701285 CAGCCTTCGCCGCCAAGATGAGG + Exonic
1107452187 13:40519760-40519782 CACCCTTCTCAGCCGTGCTGCGG + Intergenic
1116582097 14:46654688-46654710 CACACTTCGGAGGCGCGGTGCGG + Intergenic
1132731859 16:1366737-1366759 CACCCTTAGCAGGCGAGGTGAGG + Intronic
1133966848 16:10537856-10537878 CTCCCTTCCCAGCCGCCAGGAGG - Intronic
1134080508 16:11321487-11321509 CACCCTGCTCAGCCCCCATGAGG - Intronic
1147765537 17:42833334-42833356 TGCGCTGCGCAGCCGCGATGAGG - Intronic
1162107002 19:8375905-8375927 CACCCTCCGCAGCCGCTGTCCGG - Intronic
1166840393 19:45693435-45693457 CACCCTCCGCAGCCGGGCTTCGG - Exonic
1167601844 19:50459284-50459306 CACCATCCGCATCCGCGTTGTGG + Exonic
932556013 2:72825632-72825654 CTCCCTTCGCAGCCCCGACGCGG - Intronic
932625089 2:73291231-73291253 CACCCTTGTCAGCCGCGCTTTGG - Exonic
946371135 2:219281991-219282013 CACCTTCCGCAGCCCCGAGGAGG + Exonic
1174290560 20:49505655-49505677 TTCCCTTCCCAGCCACGATGAGG + Exonic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
952397078 3:32930507-32930529 CACCCTTGGCAACCTCCATGTGG + Intergenic
983690676 4:170465360-170465382 CACCCTTCGCAGCCCTGAGGAGG + Intergenic
985544449 5:502163-502185 CACCCTGAGCAACCGCGCTGGGG + Intronic
1014137598 6:117907418-117907440 CACCCTTCGCAGCCACTTCGCGG + Intergenic
1016271294 6:142293450-142293472 CACCCTTCCAACCCGCCATGAGG + Intergenic
1018662127 6:166098075-166098097 CACCCGGCGCAGCCGCCAGGGGG - Intergenic
1028307859 7:89289499-89289521 CACCCCTAGCAGCAGCCATGTGG + Intronic
1036177186 8:6550216-6550238 CACCCTTCGCAGCCACCTAGCGG - Intronic
1042267694 8:66925610-66925632 CCCCCTTCGCACCCGCGGAGGGG - Intergenic
1056638217 9:88348611-88348633 CACCATGCTCAGCCGAGATGGGG + Intergenic
1061974046 9:134059528-134059550 CACCCCTCGCAGCTGCCCTGCGG + Intronic
1191829490 X:65401221-65401243 CACCCTTGGCAGCAGCAGTGTGG + Intronic