ID: 1098606080

View in Genome Browser
Species Human (GRCh38)
Location 12:72391799-72391821
Sequence CTGCTACAGACATGGAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098606080_1098606084 13 Left 1098606080 12:72391799-72391821 CCAACATTCCATGTCTGTAGCAG 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1098606084 12:72391835-72391857 ATTTCTTATACCTATTGCTATGG 0: 1
1: 0
2: 1
3: 14
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098606080 Original CRISPR CTGCTACAGACATGGAATGT TGG (reversed) Intronic
900644958 1:3704816-3704838 CAGCTACACACATGGGAGGTTGG - Intronic
902184845 1:14717462-14717484 CTGCCACAGCCAAGGAATGCCGG - Intronic
903280662 1:22248126-22248148 CTGCTACAGGCTTGGAACATAGG + Intergenic
906399410 1:45494093-45494115 CTGCTACAGAAATGCAGTCTGGG + Intronic
907426793 1:54384865-54384887 CTGCTGCAGAAATGGAAAGGTGG - Intronic
907853140 1:58275745-58275767 CTGCTACAGAAATAGTATGGTGG + Intronic
910752579 1:90649914-90649936 CTACCACAGACAAGAAATGTGGG - Intergenic
915693352 1:157713264-157713286 CTTATACAGAAATTGAATGTTGG + Intergenic
916998797 1:170332163-170332185 CTGCTACAGACATGGTAAGAAGG - Intergenic
917811580 1:178663518-178663540 CTGTTCCAGACATTGAATGTTGG - Intergenic
918742587 1:188154064-188154086 CTCCTACAAGCTTGGAATGTAGG + Intergenic
923468022 1:234266457-234266479 CTTCTACTGACAATGAATGTAGG - Intronic
924904943 1:248442148-248442170 CTGCTAGAGACTTGAAATGAAGG + Intergenic
924922942 1:248649894-248649916 CTGCTAGAGACTTGAAATGAAGG - Intergenic
1063080482 10:2762989-2763011 CTCCCAAAGACATGGACTGTGGG + Intergenic
1063500643 10:6550572-6550594 ATGCTACAAACATGCAATGGAGG - Intronic
1065240903 10:23703129-23703151 CTGCTATAGTCCTGGCATGTGGG + Intronic
1066965234 10:42257748-42257770 TTTCTACAGATATGGTATGTAGG + Intergenic
1067531816 10:47079895-47079917 CAGCTTCAGTCAGGGAATGTAGG + Intergenic
1067534414 10:47098655-47098677 CTGGTACTGCCATGCAATGTGGG - Intergenic
1069760652 10:70808934-70808956 CTGCTACAAATTGGGAATGTAGG - Intergenic
1070512486 10:77174094-77174116 CTGCTACTGAAATGGCATTTTGG - Intronic
1070757173 10:79000586-79000608 CTGCTACTGATATGTGATGTTGG - Intergenic
1073641765 10:105259949-105259971 CTTCTGCATACAAGGAATGTGGG - Intronic
1076338301 10:129725368-129725390 CGGCTACTGACATGGAACTTCGG - Intronic
1078796911 11:14601312-14601334 CTACTACAGACAAGGATTTTAGG + Intronic
1081131414 11:39384698-39384720 CTGTTACAGTGATGAAATGTGGG + Intergenic
1081708885 11:45204560-45204582 CTGCTACAGAACTGAAATGCAGG - Intronic
1086980184 11:93188087-93188109 CTGCTACAAGCATGGAGAGTGGG - Intronic
1087727192 11:101734243-101734265 CTGCTACACACCTAGAATATAGG - Intronic
1088009930 11:104987185-104987207 CAGTTACAGACATAGAATTTTGG - Intergenic
1090426518 11:126610620-126610642 CTGCTTCAGACATGCACGGTTGG - Intronic
1091716284 12:2778830-2778852 ATGCTACAGTCATAGAATGGAGG - Intergenic
1092599325 12:10041386-10041408 CTGCAGAATACATGGAATGTAGG + Intronic
1092683795 12:11018116-11018138 CTGCTAGAGGCATGCAACGTGGG + Intronic
1097303722 12:58046122-58046144 CTGGTACACTCATGGAGTGTGGG - Intergenic
1098080543 12:66780406-66780428 CTGCTACAGACATGGCCCCTTGG - Intronic
1098606080 12:72391799-72391821 CTGCTACAGACATGGAATGTTGG - Intronic
1100467749 12:94862394-94862416 TTGCTACACACATGGATTGTTGG + Intergenic
1100517884 12:95345537-95345559 CTGCTATAGACACAGAATGGGGG + Intergenic
1105070123 12:133229312-133229334 CTTCTACAGACAAGTAATATTGG - Intronic
1105476943 13:20736395-20736417 CTGCTACAGAAAAGGCACGTAGG - Intronic
1107756922 13:43634587-43634609 CTGCTACAGAAATCCAGTGTTGG + Intronic
1109075128 13:57824284-57824306 CCGCAACAGGCATGGAATCTGGG + Intergenic
1113059113 13:106301830-106301852 CTGCTAAAAAAATGGAATCTGGG - Intergenic
1113786449 13:113004407-113004429 CAGCTGCAGACATGGAGTGACGG - Intronic
1115656191 14:35445903-35445925 CTGCATCAGACATGGGTTGTTGG + Intergenic
1116926812 14:50647479-50647501 GTGCTACAGACCTGAAATCTTGG - Intronic
1119356647 14:74012705-74012727 CTGCTACCATAATGGAATGTAGG + Intronic
1202847511 14_GL000009v2_random:193803-193825 CTGCTACAGATATTGATTGGTGG + Intergenic
1202916979 14_GL000194v1_random:184361-184383 CTGCTACAGATATAGATTGGTGG + Intergenic
1123468151 15:20531150-20531172 CTGCTGCAGGCATGGAAAGCAGG + Intergenic
1123649965 15:22469914-22469936 CTGCTGCAGGCATGGAAAGCAGG - Intergenic
1123728466 15:23126360-23126382 CTGCTGCAGGCATGGAAAGCAGG + Intergenic
1123740368 15:23278733-23278755 CTGCTGCAGGCATGGAAAGCAGG - Intergenic
1123746630 15:23323825-23323847 CTGCTGCAGGCATGGAAAGCAGG + Intergenic
1124278898 15:28347141-28347163 CTGCTGCAGGCATGGAAAGCAGG + Intergenic
1124303801 15:28564467-28564489 CTGCTGCAGGCATGGAAAGCAGG - Intergenic
1124532687 15:30520944-30520966 CTGCTGCAGGCATGGAAAGGAGG - Intergenic
1124765967 15:32486700-32486722 CTGCTGCAGGCATGGAAAGGAGG + Intergenic
1128591939 15:68905797-68905819 CTGCTAAAGACCTGGAATACAGG - Intronic
1129825914 15:78634919-78634941 CTGCTGCAGGCATGGAAAGGAGG - Intronic
1131647429 15:94360304-94360326 CTTCTACAGACATGGCCTGTCGG + Intronic
1135513196 16:23106432-23106454 GTGCTACAGACAGGGAAAGATGG + Exonic
1138008840 16:53359852-53359874 CTGCTGCAGGCATGGAAAGGAGG + Intergenic
1139289941 16:65848823-65848845 ATGCCATAGACATGGAGTGTAGG - Intergenic
1141523088 16:84594416-84594438 CTGGTGCAGACTTGGAGTGTGGG + Intronic
1141532220 16:84654312-84654334 CTTCTACAGACATTGACTGGAGG - Intronic
1146593809 17:34152600-34152622 CAGCTACAAAGATGGAAGGTGGG - Intronic
1148948905 17:51291413-51291435 CTGCTACTGACTTGGAATATCGG - Intronic
1149299579 17:55292682-55292704 CTGCAATAAACATGGAATGCCGG - Intronic
1149514145 17:57267294-57267316 CTGCTACTGACTTGGAACATAGG - Intronic
1150142420 17:62741468-62741490 ATGCTACTGACATGGATTGCTGG - Intronic
1153818954 18:8815953-8815975 ATGCTTCAGACATGCAATGGTGG + Intronic
1155091918 18:22520422-22520444 TTGATACAGGCATGGAATGTGGG - Intergenic
1156428243 18:37039834-37039856 ATACTACAGACGTGAAATGTAGG + Intronic
1161266818 19:3367942-3367964 CTGCAGCCGACAGGGAATGTGGG + Intronic
1163937251 19:20458532-20458554 CTGTTACAGACTGGGAATGGTGG - Intergenic
1164505519 19:28857670-28857692 TTGCTTTAGACATGGAATGTTGG - Intergenic
1164779160 19:30878769-30878791 CTCTTACAGACATGGCATGCAGG - Intergenic
1165097224 19:33416265-33416287 CTGCCACTGCCATGGCATGTCGG - Intronic
1167540310 19:50082313-50082335 CTGCTATATACATTGAATTTTGG + Intergenic
1167629394 19:50615483-50615505 CTGCTATATACATTGAATTTTGG - Intergenic
1168495191 19:56841679-56841701 CTTCTAGGGACAAGGAATGTGGG + Intergenic
1202674855 1_KI270710v1_random:33977-33999 CTGCTACAGATATTGACTGGTGG + Intergenic
925306944 2:2854514-2854536 CAGCGCCAGACATGGAAAGTTGG + Intergenic
926691396 2:15736693-15736715 CAGCTACAGACAGGGGGTGTGGG - Intronic
932366095 2:71154457-71154479 CTGCTGCAGGCATGGAAAGGAGG - Intergenic
934072380 2:88396415-88396437 CTGATACAGACTTGAAATATTGG - Intergenic
936961303 2:118077742-118077764 CTGCTGCCAACGTGGAATGTAGG - Intergenic
938031174 2:127995075-127995097 CAGATACAAACATGGAATGGGGG + Intronic
938230139 2:129651294-129651316 CTTCCACAGCCAAGGAATGTGGG + Intergenic
940249715 2:151661713-151661735 CTGCTACAGGCATGTAATCTTGG + Intronic
940404426 2:153284287-153284309 CTGCTACAGGCCTGCAATTTGGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941138880 2:161752055-161752077 CTGCTAAAGAAATGGAGGGTTGG + Intronic
942324840 2:174767198-174767220 CTCCCACAGACATAGAGTGTAGG - Intergenic
944409093 2:199419481-199419503 CTTCTAAAGTCATGGAATGCAGG - Intronic
948023071 2:234753241-234753263 CTGCTACACAGATGGAAAGAGGG + Intergenic
948378210 2:237536267-237536289 CTGCTGGACACATGGCATGTGGG - Intronic
1169707498 20:8522179-8522201 CAGATACAGAGATGCAATGTAGG + Intronic
1172191617 20:33065144-33065166 CTGATACAGGTATGGAAAGTGGG - Intronic
1176136117 20:63522701-63522723 CTGGTATAGGCATGGAGTGTTGG + Intergenic
1176637081 21:9256203-9256225 CTGCTACAGATATTGACTGGTGG - Intergenic
1179063515 21:38002861-38002883 CTGCTTGAGACATGGGATGCTGG + Intronic
1180213812 21:46312234-46312256 CCGCTAAAGACAGGAAATGTGGG - Intronic
1180713747 22:17857738-17857760 CTTCCACAGACAGGGAATCTAGG - Intronic
1184794962 22:46726817-46726839 CTGATACACAGATGGAAGGTGGG + Intronic
950104314 3:10378618-10378640 CTGCCTCAGACCTGGAATCTGGG + Intronic
952211816 3:31235665-31235687 CTGCAACAGCCCTGGAAAGTAGG + Intergenic
953232724 3:41078876-41078898 CTGCTTCAGCCATTGAATGTTGG - Intergenic
953490064 3:43342007-43342029 CTGCTACAGACACTGACTTTTGG + Intronic
954038776 3:47868552-47868574 CTGCTACAGCTAAGGAAGGTAGG + Intronic
956161532 3:66358871-66358893 GTGCTTCACACCTGGAATGTGGG + Intronic
961269472 3:125678280-125678302 TTGATACAGACATGCAATGTGGG - Intergenic
961645357 3:128389896-128389918 CTGCTACCAACATGGAAAGAAGG - Intronic
962435104 3:135359132-135359154 ATCCTACAGACTTGGAATGAGGG - Intergenic
965361288 3:167741787-167741809 CTGCCACAGACATTGAATAAGGG - Intronic
1202749813 3_GL000221v1_random:148816-148838 CTGCTACAGATATTGACTGGTGG + Intergenic
969119138 4:4894494-4894516 CTGATACAGATAAGGAATGGTGG - Intergenic
970420489 4:15901487-15901509 GGGCTACAGCCAAGGAATGTGGG - Intergenic
972310930 4:37881565-37881587 CTGCTACAGATTTGAAAGGTGGG + Intergenic
978691713 4:111520807-111520829 CTGTTAGAGACATGGATAGTTGG - Intergenic
983683137 4:170375093-170375115 CTCCTACAGACATGGAGAGGTGG - Intergenic
984171951 4:176369664-176369686 TAGCTACAGACATGGGATGTAGG - Intergenic
984191782 4:176614242-176614264 CTGCTAAATATATGAAATGTTGG - Intergenic
1202751972 4_GL000008v2_random:14630-14652 CTGCTACAGATATTGACTGGTGG - Intergenic
995899959 5:117053944-117053966 CTGCTTCAGAGATAGAATTTTGG - Intergenic
998874833 5:146588759-146588781 CTTCTACAGAAATGAACTGTGGG - Intronic
999925534 5:156371958-156371980 CTGATGGAGACATGGAATATCGG - Intronic
1000960741 5:167598002-167598024 CAGCTAAACTCATGGAATGTGGG - Intronic
1005152326 6:22766496-22766518 CTGCAACAGATATGAAAAGTAGG + Intergenic
1006045789 6:31296630-31296652 CTGCTATAAACATGGCATATAGG - Intronic
1013012368 6:106132297-106132319 ATTCCACAGACATGGAATGAAGG - Intergenic
1015937704 6:138419570-138419592 CTGCTAGACTGATGGAATGTTGG + Exonic
1022522748 7:31018568-31018590 CTGCTACAGATAGGGAAACTGGG + Intergenic
1026048845 7:66927912-66927934 CTGCTAAAGAAATGGAAAATAGG + Intronic
1027344388 7:77242225-77242247 CTGCTATAGTCATGGGATGAGGG - Intronic
1030384756 7:108855183-108855205 CAGACACAGACATGGGATGTGGG + Intergenic
1030494772 7:110285156-110285178 CTCCTAAAGACAAGCAATGTTGG + Intergenic
1031083727 7:117282273-117282295 GTGCTGTACACATGGAATGTGGG + Intronic
1031524782 7:122811050-122811072 CTGATAAACACATGGAATGAGGG + Intronic
1031529936 7:122864252-122864274 CAGCTCCAGACATGGGATGGAGG + Intronic
1032732026 7:134652925-134652947 CTGCAACAAACATGGAGTGCAGG + Intronic
1037316037 8:17600368-17600390 CTCTTCCAGACATTGAATGTTGG + Intronic
1038013530 8:23494022-23494044 ATCCTACAGTCATGGACTGTGGG + Intergenic
1038932131 8:32205700-32205722 CTGCTAAAGATATGGACTATTGG + Intronic
1039050775 8:33491233-33491255 CTGTAACACACATGGAGTGTGGG + Intronic
1039716489 8:40114893-40114915 CTGCTACAGTTATGAAATGTAGG - Intergenic
1042292713 8:67186139-67186161 CTGTTACAGAAATGAAATGATGG - Intronic
1042558687 8:70055813-70055835 TTGCTTCAGATGTGGAATGTGGG + Intronic
1045381506 8:101631965-101631987 CTTCTGCAGACAAGGAATCTTGG + Intronic
1046132169 8:109979231-109979253 CTGCTACAGAGATAGCATGATGG + Intergenic
1046151755 8:110236037-110236059 CTGATACAGAAATTGAATTTTGG + Intergenic
1047700548 8:127445385-127445407 CTGCAACAGACAAAGAGTGTTGG - Intergenic
1047806312 8:128364451-128364473 CAGATGCAGAGATGGAATGTGGG + Intergenic
1048783950 8:138030728-138030750 CTACTACAAACCTGGAATGTAGG + Intergenic
1049065919 8:140313827-140313849 CTGCTAGGGACAGGGAATGGGGG + Intronic
1049397953 8:142410514-142410536 CTATTCCAGACATGGCATGTAGG + Intergenic
1052069426 9:24064003-24064025 TTGCTTCAGACATGGTGTGTGGG + Intergenic
1052739541 9:32380267-32380289 CTGCTGCAGCCATGTAATGTAGG - Intergenic
1053796681 9:41732962-41732984 CTGATACAGAGATGTAATGATGG - Intergenic
1054148504 9:61581899-61581921 CTGATACAGAGATGTAATGATGG + Intergenic
1054185095 9:61945037-61945059 CTGATACAGAGATGTAATGATGG - Intergenic
1054468256 9:65512994-65513016 CTGATACAGAGATGTAATGATGG + Intergenic
1054653415 9:67643459-67643481 CTGATACAGAGATGTAATGATGG + Intergenic
1057767198 9:97932154-97932176 ATGCTAAAGGCAAGGAATGTAGG + Intronic
1057839757 9:98476843-98476865 CTGCTATAGACTTGGAAAGTAGG + Intronic
1060386600 9:123235185-123235207 CTACCACAGACAAGGAATGCTGG - Intronic
1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG + Intronic
1062511813 9:136910394-136910416 CTGCCACAGCCGTGAAATGTGGG + Intronic
1203718455 Un_KI270742v1:178903-178925 CTGCTACAGATATTGACTGGTGG + Intergenic
1203652665 Un_KI270751v1:142596-142618 CTGCTACAGATATTGACTGGTGG + Intergenic
1187424401 X:19164086-19164108 CTGCAAGAGACAAGGAAGGTGGG - Intergenic
1190106838 X:47567065-47567087 CTGCTGGTGACTTGGAATGTGGG - Exonic
1190690780 X:52911387-52911409 CAGGAACAGACATGGAAGGTGGG + Intergenic
1190695203 X:52944405-52944427 CAGGAACAGACATGGAAGGTGGG - Intronic
1191183414 X:57585792-57585814 ATTCTACAGACATGGAAGGCAGG + Intergenic
1194241829 X:91458474-91458496 CTGGTACAGTAGTGGAATGTGGG + Intergenic
1195557684 X:106245851-106245873 CTGCTCCATGCATGGACTGTGGG + Intergenic
1198391747 X:136182256-136182278 GTGTTATAGACATAGAATGTTGG + Intronic
1198485333 X:137081551-137081573 CTGCTTCAGGCAGGGGATGTGGG + Intergenic
1199462332 X:148098533-148098555 CTGCTACAGAAATGGAACCAAGG + Intergenic
1201172605 Y:11283754-11283776 CTGCTACAGATATTGACTGGTGG + Intergenic