ID: 1098609925

View in Genome Browser
Species Human (GRCh38)
Location 12:72444025-72444047
Sequence CTTTATATGCAAAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098609925_1098609929 30 Left 1098609925 12:72444025-72444047 CCTTCCTCTTTTTGCATATAAAG 0: 1
1: 0
2: 1
3: 57
4: 406
Right 1098609929 12:72444078-72444100 AACCAAAATGCCTTGGCCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 161
1098609925_1098609928 29 Left 1098609925 12:72444025-72444047 CCTTCCTCTTTTTGCATATAAAG 0: 1
1: 0
2: 1
3: 57
4: 406
Right 1098609928 12:72444077-72444099 AAACCAAAATGCCTTGGCCTTGG 0: 1
1: 0
2: 1
3: 38
4: 288
1098609925_1098609927 23 Left 1098609925 12:72444025-72444047 CCTTCCTCTTTTTGCATATAAAG 0: 1
1: 0
2: 1
3: 57
4: 406
Right 1098609927 12:72444071-72444093 ATAAAGAAACCAAAATGCCTTGG 0: 1
1: 0
2: 6
3: 100
4: 1245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098609925 Original CRISPR CTTTATATGCAAAAAGAGGA AGG (reversed) Intronic
902228418 1:15011843-15011865 CTTTAGGACCAAAAAGAGGAAGG + Intronic
902240818 1:15088225-15088247 CTTTATTTAGAAAAATAGGAGGG + Intronic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
909132253 1:71752358-71752380 CTTTATATACAAAAATAGGTAGG + Intronic
909666823 1:78143386-78143408 CTGGCCATGCAAAAAGAGGAAGG - Intergenic
909748233 1:79125893-79125915 CTTTATTTGCAAGATGAGAATGG + Intergenic
909770166 1:79412202-79412224 ATTTTTAGGCAAATAGAGGAAGG + Intergenic
909982117 1:82115576-82115598 CTTTATCTAGAAAAAGAGAATGG + Intergenic
911119136 1:94277650-94277672 CTTTATATGCTAAAATAGAATGG - Intergenic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
911841712 1:102690215-102690237 ATTTTTAGGCAAAAAGAGGAAGG + Intergenic
911942419 1:104064390-104064412 CTATTTATGCAAAAGGAAGAGGG + Intergenic
912913437 1:113786992-113787014 GTTTATATGCAAAAATAAGTAGG - Intronic
913495468 1:119424301-119424323 CATTGTAAGCAAAAACAGGATGG + Intergenic
914871302 1:151477042-151477064 CTTTATCTGCAAACAGGGGCAGG - Intergenic
916995585 1:170295075-170295097 CTTTATGTGCCAAAAAAGAAAGG + Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
918610317 1:186482556-186482578 CTTAATATGCTAATAGAGAATGG - Intergenic
919115731 1:193278209-193278231 CTTTATGTGCAAAGACAGGAAGG + Intergenic
919173393 1:193987790-193987812 CTTTATATGCAAAAGAAATATGG + Intergenic
919477559 1:198047992-198048014 CTTTATAGGCCAAGAGAGAATGG - Intergenic
919641885 1:200053413-200053435 CTTCATATGTAAAAAGAGGTAGG - Intronic
920165658 1:204033938-204033960 CCTTATAAGTAAAAAGAGGGAGG - Intergenic
920525523 1:206663376-206663398 CTTTAGTTGCAAAATCAGGATGG - Intronic
920563502 1:206956083-206956105 CTTTATTTCCCAAAACAGGAGGG - Intergenic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
921485607 1:215712359-215712381 CTTGAGATGCTAAAAGAGGCAGG - Intronic
921540035 1:216402956-216402978 ACTTATATGAGAAAAGAGGAAGG + Intronic
921568312 1:216747880-216747902 CATTATAGGCAAAATGAGGGAGG - Intronic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924083218 1:240420893-240420915 ATTTATTTGGAAAAACAGGAAGG + Intronic
924520071 1:244798365-244798387 TTTTCTTTGTAAAAAGAGGAGGG - Intergenic
1065117386 10:22496135-22496157 CTTTTTTTACAAAAAGAGGCAGG + Intergenic
1065812263 10:29452977-29452999 TTTTCTTTTCAAAAAGAGGAAGG + Intergenic
1066169149 10:32822751-32822773 CTTTAAATGGAAAAATAGTATGG + Intronic
1066516969 10:36173361-36173383 GTCTAAATGAAAAAAGAGGAAGG + Intergenic
1066674441 10:37873724-37873746 CTTTGTCTGCATAAAGAGAAAGG + Intergenic
1067011590 10:42719244-42719266 CTTTATATGCAAAAAAAAAAAGG - Intergenic
1067723143 10:48745087-48745109 ATTTACATGTAAAAAGAAGATGG - Intronic
1068392714 10:56419334-56419356 CTTTAAAGGAGAAAAGAGGAGGG - Intergenic
1068735177 10:60406261-60406283 CTTTATTTACAAAAACAGGCAGG + Intronic
1069435369 10:68376785-68376807 CATTATGTGCAAAAAAATGAGGG + Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1071183226 10:83011059-83011081 CTGTATATTTAAAAAGAGTAAGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071827083 10:89336103-89336125 CTGTCTCTGCAAAAAAAGGAAGG + Intronic
1072723236 10:97793746-97793768 CTTTATATGAAATAAAAGAAAGG - Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073367827 10:102958396-102958418 GTTTATATTGGAAAAGAGGATGG - Intronic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1074953386 10:118363294-118363316 CTTTATTTGTAAAAATAGGTGGG - Intergenic
1075294783 10:121265279-121265301 CTTTGTATGCAAAACAAAGAAGG + Intergenic
1075449468 10:122539568-122539590 ATTTATACAGAAAAAGAGGAAGG + Intergenic
1075478891 10:122761971-122761993 CTTTCTATGTAAAAAAATGAGGG - Intergenic
1075764237 10:124879949-124879971 CTTATTATATAAAAAGAGGACGG + Intergenic
1076673375 10:132135314-132135336 CTTTATTAGCAAAAACAGGTAGG + Intronic
1076923576 10:133468337-133468359 GTTTTTAAGAAAAAAGAGGAAGG - Intergenic
1078455662 11:11472781-11472803 CCTTGTATACAAAATGAGGATGG - Intronic
1080311131 11:30893886-30893908 CTCAATATGTAAAAAGAGCAAGG - Intronic
1080810013 11:35694440-35694462 CTTTATAAGGTAAAAGATGAAGG - Intronic
1082653667 11:55825740-55825762 CTTTATATTTGAAAACAGGAAGG + Intergenic
1082901925 11:58264388-58264410 CTATAAATTCAAAAAGAGGTTGG + Intergenic
1083012532 11:59416966-59416988 TTTCTTATGCAAAAAGAGGCTGG - Intergenic
1083028583 11:59571583-59571605 CTTTAAAGGCAAAAAGCTGAAGG - Intergenic
1084241865 11:67826706-67826728 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1084602329 11:70153338-70153360 CTTTATTTGCAAAAACAGACAGG + Intronic
1084902805 11:72322242-72322264 CTTTAGCAGCAAAAGGAGGATGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1086255704 11:84873961-84873983 CTTTATATGCAAGATCAGTAAGG - Intronic
1086557516 11:88128616-88128638 CTTTATTTGCAAAAACCTGAGGG - Intronic
1086620588 11:88883382-88883404 CTTTCTATGCAAAAAGACTGTGG + Intronic
1086700079 11:89891809-89891831 GATTATATGCAAGATGAGGATGG - Intergenic
1086706091 11:89952707-89952729 GATTATATGCAAGATGAGGATGG + Intergenic
1086721349 11:90125211-90125233 CTCTATATGCAATAGGAGGCTGG - Intergenic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1088452698 11:109998748-109998770 CTTTAAATCTAAAAAGAGGAAGG - Intergenic
1090243209 11:125198309-125198331 CTTTCTATCCAAAAAGCGGATGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091145911 11:133280145-133280167 TTTTATATGCAAATCTAGGAGGG - Intronic
1091807978 12:3369605-3369627 CCTTATTTGGAAAAATAGGAGGG + Intergenic
1092914120 12:13174072-13174094 CTCTAAATGGAAAAGGAGGAAGG - Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1095828249 12:46553457-46553479 CTATAGATGCAGAAAGAAGAAGG + Intergenic
1096284784 12:50289715-50289737 CTTTATATACTAAAAGAAGAAGG - Intergenic
1096731666 12:53618457-53618479 ATTAAAATGCCAAAAGAGGAAGG + Intronic
1097292058 12:57925476-57925498 ATTTATATTTAAAGAGAGGATGG + Intergenic
1097474779 12:60039671-60039693 CGTCCTAGGCAAAAAGAGGATGG + Intergenic
1097686318 12:62694195-62694217 CTTTATATGCTTGAAGAGGGAGG + Intronic
1097753857 12:63387490-63387512 CTTCTCAGGCAAAAAGAGGAGGG + Intergenic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098395099 12:70008646-70008668 CCTTATAAGCCAAAAGAGAATGG + Intergenic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1099599180 12:84710330-84710352 CTTTCCATGAAAAAAAAGGATGG + Intergenic
1099623660 12:85037322-85037344 CTTTATATAGAAAGAGAGGCAGG - Intronic
1100447931 12:94678477-94678499 CTCTATCTGCAAAAAGAGACTGG + Intergenic
1100504567 12:95206839-95206861 ATTTTTAGGCAAAAGGAGGAAGG + Intronic
1101255665 12:102974192-102974214 CTTTCTAGGCAAGAAGGGGAAGG + Intergenic
1101392870 12:104318463-104318485 CTTTATTTACAAAAAGCTGATGG + Intronic
1102603239 12:114049270-114049292 CTTTATATGCAGAGCAAGGAAGG - Intergenic
1104003569 12:124875906-124875928 CTTTATTTACAAAAACAGGCTGG - Intronic
1104003575 12:124875946-124875968 CTTTATTTACAAAAACAGGCTGG - Intronic
1105567297 13:21563047-21563069 CTTTTTAAGCAAGAAGAGGGTGG - Intronic
1106202346 13:27550220-27550242 CTTTATTTTCAAAAAGATAATGG + Intronic
1107467328 13:40663501-40663523 CTTTGAATGCAAAAAAAGGGGGG + Intronic
1108853125 13:54760417-54760439 CTTTAAATACAAATAGAGGGTGG - Intergenic
1109444942 13:62423971-62423993 ATTTATATGGCAAAATAGGAAGG - Intergenic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1109982054 13:69922113-69922135 CTTTATATTAAAAAAAAGGAAGG - Intronic
1111905860 13:94255570-94255592 CCTTAGATAGAAAAAGAGGAGGG - Intronic
1112025256 13:95405739-95405761 GTTTATTTGGAAAAAGAGGCTGG + Intergenic
1112571849 13:100600584-100600606 CTTCATATGAAAAAAAAGGCCGG - Intergenic
1112704823 13:102055736-102055758 CTTTATTTGCAAAAATAGGCAGG - Intronic
1113077384 13:106480476-106480498 CATGATGTGAAAAAAGAGGAAGG + Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1113673666 13:112194031-112194053 GTTTATCTACAAAATGAGGAAGG - Intergenic
1114573903 14:23695313-23695335 CTCTATCTGGAAAAAGAGGGGGG + Intergenic
1114879048 14:26761097-26761119 TTTTCTATGCAAATAGAGGTTGG - Intergenic
1115100925 14:29698634-29698656 CTTTAAATGCAAGCAGATGAAGG - Intronic
1115573930 14:34693005-34693027 CTTTAGATGAGAAAAGAAGAGGG + Intergenic
1116381200 14:44270754-44270776 CTTTTTATTCAAAATGAGCATGG - Intergenic
1117806646 14:59499270-59499292 CTTCAAATGCAAAGAGAGGTGGG - Intronic
1118577851 14:67261933-67261955 TTTTAAAGGCAAAAAAAGGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118648737 14:67867587-67867609 CTCTATATGTAAAAAGAGGCTGG + Intronic
1118783504 14:69026261-69026283 GTTTATATGCTAGTAGAGGAAGG - Intergenic
1118922103 14:70158985-70159007 CTTGATCTGCAAATAGAGCACGG - Intronic
1118996467 14:70841019-70841041 CCTTATATGTAAAAAGAGCTGGG - Intergenic
1119165944 14:72492802-72492824 CTTTATTTGCAAAAACAGAATGG - Intronic
1119476637 14:74934342-74934364 CTATATACACACAAAGAGGAAGG + Intergenic
1119836116 14:77750338-77750360 CTTTATATTCAAATAGATGGGGG + Intronic
1119913235 14:78370717-78370739 CTTTACATATAAGAAGAGGAAGG + Intronic
1121647792 14:95532666-95532688 CTTTAAAGGAAAAATGAGGAGGG - Intergenic
1124849243 15:33319986-33320008 CTTTATTTGCAAATAGAGGCGGG + Intronic
1124896368 15:33780926-33780948 CTTTATTTACAAAAATAGGCAGG - Intronic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126576490 15:50202175-50202197 CTTTATTTACAAAAACAGGTGGG - Intronic
1127225802 15:56927269-56927291 CTTTATATGCAGAAAAAAGACGG - Intronic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1130927039 15:88393300-88393322 CTTTATCTGTAATATGAGGATGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1132970754 16:2687506-2687528 CTTTACTTGCAAAAACAGGCAGG - Intronic
1133353367 16:5117614-5117636 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1135129864 16:19844441-19844463 CTTTATAGGAAAGAAGAGTATGG + Intronic
1135485609 16:22862198-22862220 CTTTAGATCCTAAAACAGGAAGG - Intronic
1135633331 16:24053436-24053458 CTTTATTTACAAAAACAGGCAGG + Intronic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138127591 16:54451818-54451840 CACTATATGCAGAAAGATGAAGG + Intergenic
1138710203 16:58962442-58962464 CTTTATAGGCTACAACAGGAGGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1145405978 17:22594576-22594598 ATTTATATTTAAAAGGAGGATGG + Intergenic
1146768823 17:35549492-35549514 TTTTATGTGCAAAAAAAGCACGG + Intronic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147850386 17:43437965-43437987 CTTTATTTACAAAAACAGGATGG + Intergenic
1148059296 17:44824300-44824322 CTCTATTTGAAAAAAGAGGCCGG - Intronic
1148474531 17:47918830-47918852 CTTTATTTACAAAAACAGGCAGG - Intronic
1149277963 17:55065972-55065994 CTTTCTTTGCAAAATGAGCATGG + Intronic
1149376216 17:56046731-56046753 CTCTAGCTGCAAAAAGATGAGGG + Intergenic
1150330894 17:64293437-64293459 CTTTATATGGAAAAAGGAGCTGG + Intergenic
1151351974 17:73537181-73537203 CTTTCTATGCAAAGAGACGATGG + Intronic
1151375929 17:73689136-73689158 CTTTTTATTCACAAAGAGGGAGG - Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152978402 18:247610-247632 CATTATATTCAAAAAAAGCAAGG + Intronic
1153382181 18:4453461-4453483 CTTTATATGCAAAATGACCTAGG + Intronic
1153412469 18:4809198-4809220 CTTTATATGGTAAAACAGAAGGG + Intergenic
1155413664 18:25572640-25572662 CTTTATTTGCAGCATGAGGATGG - Intergenic
1157565885 18:48678907-48678929 CTTTATTTGCAAAAACAGGCTGG - Intronic
1158366002 18:56736780-56736802 CTTTTGATGGAAAAAGAGGAGGG + Intronic
1158938457 18:62385408-62385430 CTTTACATTAAAAAAGAGGGAGG - Exonic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1160111542 18:76036930-76036952 CTTTCTATTGAAAAAGATGATGG - Intergenic
1163023987 19:14498948-14498970 CTTTAAAAGAAAAAAGAGGCCGG + Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1167725467 19:51209864-51209886 CCTTATATTTAAAAAGAGGATGG + Intergenic
926347250 2:11958742-11958764 ACTTATATGAAAAATGAGGAGGG + Intergenic
926474002 2:13299442-13299464 CTTTATTTGCAAAAACAAGTAGG + Intergenic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927521323 2:23700169-23700191 GTTTACATGCTAAAATAGGAAGG - Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG + Intergenic
929292098 2:40204695-40204717 ATATATATGCAAAAAGATAAAGG + Intronic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
930058564 2:47270597-47270619 CTTGATAGGGAAAAAGGGGATGG + Intergenic
930987044 2:57602596-57602618 CTTTATTTACAAAAAGTAGATGG - Intergenic
931086160 2:58832821-58832843 TTTTCTATGCAATAAGAAGAGGG + Intergenic
932970497 2:76535151-76535173 CTTCATATGGTAAAAGAGGAAGG + Intergenic
935068255 2:99670818-99670840 CTTTTATTGCAAAAATAGGAAGG + Intronic
935829012 2:106979780-106979802 CTATAGAAGCAAAGAGAGGAGGG + Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
936006081 2:108890170-108890192 CTTTATAGGCCAGAAGAGAATGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937782149 2:125850811-125850833 ATTTAAATGTAAAAACAGGAAGG - Intergenic
940385055 2:153061084-153061106 ATTTATATGCATACAGATGAAGG - Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942737050 2:179126438-179126460 CTTTAAGTGCAAAAAGAGGGAGG - Intronic
943175031 2:184461460-184461482 ATCTATATGCAAAAATAGTATGG - Intergenic
943278512 2:185899830-185899852 TTTTATATGGAAAAAAAGGAAGG - Intergenic
943593702 2:189830197-189830219 CTTTATTTACAAAAACAGGAAGG + Intronic
943963592 2:194300341-194300363 ATATATAAGCAAAAAGAGGTAGG - Intergenic
945538123 2:211046074-211046096 CTTTTAATGGAAAAAGAGAATGG + Intergenic
945706267 2:213236763-213236785 CTTTATTTGAAAAAAGAACAGGG - Intergenic
946118550 2:217487796-217487818 CTTTAAATGCAAAAGAAGAAAGG + Intronic
946805776 2:223470072-223470094 CTTTGTATGCAAGAACAGAATGG + Intergenic
947368405 2:229420093-229420115 CTTTATTTGCAAAAACAGGCTGG - Intronic
948998597 2:241597892-241597914 CTTTTTCTGCAAATAGAGGGAGG - Intronic
1169634796 20:7677471-7677493 TTTTATTTACAAAAGGAGGAAGG - Intergenic
1170421995 20:16202339-16202361 ATTTTTATGGAAAAAAAGGATGG + Intergenic
1170502202 20:16986266-16986288 CTTTATAAGCAAAGAGATAATGG + Intergenic
1170529437 20:17275742-17275764 CTTGGTCTGGAAAAAGAGGAGGG + Intronic
1170651903 20:18250737-18250759 TTTCATATGTAAAAAGAGTAGGG + Intergenic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1170793960 20:19530631-19530653 ATTTATATAGTAAAAGAGGAAGG + Intronic
1170831678 20:19848017-19848039 CTTTATTTGCTAAAATAGGCAGG + Intergenic
1172246681 20:33450242-33450264 CTTTAAAAACAAAAAGAGGCTGG - Intergenic
1172305203 20:33875635-33875657 CTTTCTGTGCAAAGACAGGAGGG + Intergenic
1173202384 20:40963380-40963402 CTTTATTTGTAAAAAGGGTAAGG - Intergenic
1173984843 20:47253039-47253061 CTTTATTTGCAAACACAGGTGGG + Intronic
1174307682 20:49626008-49626030 CTTTATTTACAAAAACAGGTGGG - Intergenic
1174842052 20:53910232-53910254 TTTTAAAAGCAAAAAGAGGCCGG - Intergenic
1175107155 20:56623782-56623804 TTTTAAATGCACAAAGAGGCTGG - Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1178031082 21:28527057-28527079 CTTTATTTACCAAAAGAAGAGGG + Intergenic
1179336192 21:40457205-40457227 CTGTATTTGGAAAAAGAAGAAGG + Intronic
1179892930 21:44346133-44346155 CTTTATTTGCAAACAGATGGCGG - Intergenic
1182159011 22:28103284-28103306 CTTCATTTGCAAGAAGAGGAAGG + Intronic
1182181668 22:28355948-28355970 CTTTATACCCGAATAGAGGAGGG - Intronic
1182641246 22:31769619-31769641 CTTTAAATTCAAAAAGTGGCTGG + Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950918536 3:16669496-16669518 GTCTATATGGAAAAAGAGGAAGG - Intronic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951932229 3:27981503-27981525 CTTTATTTGGGAGAAGAGGATGG - Intergenic
952017233 3:28971902-28971924 CATTATGTGCCAAAAGAGGGTGG - Intergenic
952470647 3:33647657-33647679 TTTTATATACAAAAACAGGAGGG + Intronic
952713070 3:36451383-36451405 ATTAATCTGCAAAAACAGGAAGG - Intronic
952741109 3:36735933-36735955 CTTTCTCTCCAATAAGAGGAGGG + Intronic
954719759 3:52551444-52551466 CTTTATATGCAAAATGACAAAGG + Intronic
955005517 3:54965191-54965213 CTTTATTTACAAAAAGAGGCTGG + Intronic
955078552 3:55636751-55636773 CTTTATTTACAAAAACAGGCAGG + Intronic
955914521 3:63893378-63893400 CTTTCTTTGCTAAAAGAAGAGGG + Intronic
955945381 3:64188716-64188738 CTTTACTTACAAAAACAGGAAGG - Intronic
956178496 3:66496798-66496820 CTTAATTTGCATAAACAGGATGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956498697 3:69857483-69857505 CCTTATGTGAAAAAAGAGGAAGG - Intronic
956536435 3:70282035-70282057 CTTTATATGCAACAAGCAAAGGG - Intergenic
956904433 3:73751004-73751026 CTTTATTTACAAACACAGGAAGG + Intergenic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957587804 3:82155233-82155255 CTTTATAAGAGAAAAGAAGAAGG - Intergenic
959093697 3:101930730-101930752 ATTTATATGCAAACAAAGCAGGG + Intergenic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959721033 3:109489410-109489432 ATTTATATGCAAAAAGAAGTTGG + Intergenic
961003439 3:123389190-123389212 GTTTATCTGCAAAAACATGAGGG + Intronic
961296125 3:125886112-125886134 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
961626469 3:128267263-128267285 CTTTATAAGGACAAAGAGGGTGG - Intronic
962231593 3:133670216-133670238 CTCTCTGTACAAAAAGAGGATGG + Intergenic
964500128 3:157339747-157339769 ATTTATATTGAAAAAGAGAAGGG + Intronic
964628235 3:158779832-158779854 CTTTAAAATCAAAAAGAGGCCGG - Intronic
964851607 3:161102128-161102150 CTTTCTATGCAAAAGCAGAATGG - Intronic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965295397 3:166938920-166938942 CTATATATCCAATAATAGGATGG + Intergenic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965763262 3:172103576-172103598 CCTTAAGTGCAAAAAGGGGATGG - Intronic
967125111 3:186416230-186416252 CTTTATTTACAAAAAGTGGTGGG - Intergenic
967522555 3:190451131-190451153 ATTTGTATGCAAAAATAGGAAGG + Intergenic
968927760 4:3558867-3558889 ATTTATCAGCAAAAAGAGAAGGG + Intergenic
969753862 4:9134627-9134649 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971413504 4:26400460-26400482 CTTTTCATCCAAATAGAGGAAGG - Intronic
972048646 4:34701113-34701135 CTTTATAGGCTAGAAGAGAATGG + Intergenic
973157661 4:46977198-46977220 CTTTAGATTCTAAAATAGGAAGG + Intronic
974674643 4:65074125-65074147 CTTGAATTTCAAAAAGAGGAGGG + Intergenic
975042079 4:69758335-69758357 CTTTATATCCAAACTGAGAAGGG - Intronic
976264101 4:83173873-83173895 CTTTCAATGTATAAAGAGGAAGG - Intergenic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
977265909 4:94854001-94854023 TTTAATTTGCAATAAGAGGAAGG - Intronic
978137242 4:105276742-105276764 CATTCTATGCAAAAAGAAGGTGG + Exonic
978312923 4:107405677-107405699 CTTTCTATGGAAAAACAGGCTGG - Intergenic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
980641659 4:135587742-135587764 TTTTAAATGAAAAAAAAGGAGGG - Intergenic
980860426 4:138493084-138493106 CTTTATCTGGAACACGAGGATGG - Intergenic
981237087 4:142431129-142431151 CTTTAGATGCAAAAACAGGGAGG + Intronic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
982816159 4:159887489-159887511 CTTTTTATTCAAGATGAGGAGGG - Intergenic
983780086 4:171659166-171659188 TTTTATATGGCAAAAGAGGTAGG - Intergenic
983969703 4:173856731-173856753 CTTTATGGGCAAATATAGGAGGG - Intergenic
984064515 4:175031756-175031778 CTTTATATGCAAAAACTATAAGG - Intergenic
984207435 4:176802050-176802072 GTTTATATTCATAAAGGGGAAGG - Intergenic
986045291 5:4030944-4030966 CTTTATTTTCAAAAACAGGCTGG + Intergenic
986631112 5:9775168-9775190 CTTTGTGTGCAGAAAGGGGAGGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
988032624 5:25783714-25783736 ATTTATATTTTAAAAGAGGAAGG + Intergenic
988333360 5:29872807-29872829 CTCTATATGCAGAAAAATGATGG + Intergenic
988365035 5:30287595-30287617 CCTTATATGCAAGAAAAGAATGG - Intergenic
988719834 5:33866203-33866225 CTATAGATACAAAAAGAGCATGG + Intronic
990277882 5:54218236-54218258 CTTTCTATTCAAAAAGAGCATGG + Intronic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
990868060 5:60401487-60401509 CCTTATGTTAAAAAAGAGGATGG + Intronic
991706049 5:69359867-69359889 CTTTTTATGCGAAAAGAAAAGGG + Intronic
991954743 5:71983409-71983431 CTTTATTTGCAAGAAGTGGCAGG - Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992795886 5:80255239-80255261 GTTTATTTGCAAAGAGAGGCAGG + Intronic
993525696 5:88963228-88963250 TTTCACATGCAAAAAGAGTATGG + Intergenic
993652414 5:90537796-90537818 TTTTACATGCAAAAAGAAGGAGG + Intronic
993874769 5:93293407-93293429 TTTTATAAGCAAATAGAGGCTGG - Intergenic
994543930 5:101138609-101138631 ATTCATATGAAAAAAGAGTATGG - Intergenic
994769939 5:103968259-103968281 CTTCAAATGCAAAAACAGCAGGG - Intergenic
995411663 5:111864481-111864503 CATTATATACAAAAAGATTAAGG - Intronic
995862635 5:116658256-116658278 CTTTACTTGCAAAGAGAGGTTGG - Intergenic
996316248 5:122163899-122163921 GTTTAAATTCAAAAAGAGCAAGG + Intronic
996819085 5:127605979-127606001 CTCTATATAAAAAAAAAGGAGGG + Intergenic
997045874 5:130316981-130317003 TTCTATAGGCAAAAAGAGGCAGG + Intergenic
998627141 5:143859073-143859095 ATTCATATGCAAAAACAGCAGGG + Intergenic
999518226 5:152322259-152322281 TTTTATTTACAAAAACAGGAGGG - Intergenic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1000903957 5:166940504-166940526 CTTTATTTACAAAAACAGGCGGG - Intergenic
1001396836 5:171423728-171423750 CCTTTGGTGCAAAAAGAGGATGG + Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1003369147 6:5507989-5508011 TTTTATAGGCAAATAGAGAAAGG + Intronic
1004503516 6:16229344-16229366 CTCTATCTGGAAAAAGAGGGAGG - Intergenic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1006089550 6:31620506-31620528 GGTTATTTGCATAAAGAGGAGGG - Intergenic
1006139472 6:31919648-31919670 CCATTTATGCAAAAAAAGGAGGG - Intronic
1006279494 6:33037882-33037904 CATCATAGCCAAAAAGAGGAAGG + Intergenic
1008522706 6:52377849-52377871 CTTTATATGGAAAGAGATAAAGG + Intronic
1008546151 6:52585469-52585491 CTTTAGAAGCAAAGAAAGGAAGG + Intergenic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1009420047 6:63455439-63455461 TTTTAAATGAAAAAAGAAGAGGG - Intergenic
1009588190 6:65633783-65633805 CTTTATTTACAAAAGTAGGAAGG - Intronic
1010189630 6:73181852-73181874 CTTTATCTGCAAAACAGGGATGG + Intronic
1010415162 6:75603138-75603160 ATTTATCTGGAAAAAGAGTAAGG + Intronic
1011554258 6:88558088-88558110 CTATATATTAAAAATGAGGAAGG - Intergenic
1011834127 6:91408889-91408911 ATTTATAAAGAAAAAGAGGATGG - Intergenic
1012000631 6:93650348-93650370 CTTTATATTTACAAAGGGGAAGG + Intergenic
1013831539 6:114278738-114278760 ATTTATATTAAAAAAGACGAAGG + Intronic
1013924588 6:115455025-115455047 ATTTAAATGCAAAAAGTAGATGG + Intergenic
1014095759 6:117459053-117459075 CTTTAGATGAAAAAAAAGGTTGG + Intronic
1014686850 6:124512397-124512419 CATTAAATGTAAAAGGAGGAAGG + Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1015081848 6:129235807-129235829 CTTTTTAACCCAAAAGAGGAAGG - Intronic
1015257551 6:131196701-131196723 CTTTTTATCCAAAAACAGGTAGG - Intronic
1015427730 6:133091586-133091608 TTTTGTATGCAATATGAGGAAGG - Intergenic
1015509256 6:134021838-134021860 ATTTAACTTCAAAAAGAGGAAGG + Intronic
1016124035 6:140376654-140376676 CTTTATAAGCCAAAGAAGGAAGG - Intergenic
1016505406 6:144773346-144773368 CTTTATTGGGAAAAAAAGGAAGG + Intronic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1018410543 6:163541932-163541954 CATAAAATGCAAAAAGAGGAAGG - Intronic
1019416325 7:928357-928379 CTATCTCTGCAAAAAAAGGAAGG + Intronic
1020430898 7:8115129-8115151 CTTTTTTTACAAAAAGAGGGAGG - Intronic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1020689093 7:11332342-11332364 AGTTACATGGAAAAAGAGGATGG - Intergenic
1021063818 7:16147237-16147259 CTTTATTAGCAACATGAGGATGG + Intronic
1021546359 7:21817331-21817353 CTCTACATATAAAAAGAGGATGG - Intronic
1022850240 7:34254058-34254080 TTTTATATTCAAAAATATGAGGG - Intergenic
1023399965 7:39785533-39785555 CTTTATATAAAAAAAAAAGAGGG + Intergenic
1023733815 7:43217658-43217680 CTTTACTTGCAAAATGATGAGGG + Intronic
1023954988 7:44878033-44878055 CTTTATATTTAGAAATAGGATGG - Exonic
1024353788 7:48394245-48394267 ATTTATATTCCAAAGGAGGAGGG - Intronic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1024995941 7:55273302-55273324 CTCTATATGCTAAAAGAAGAGGG + Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026465912 7:70654402-70654424 CTTTATTTACAAAAATAAGACGG + Intronic
1027584632 7:80043552-80043574 CTTTAAATGGAAGAAAAGGAAGG - Intergenic
1027766768 7:82353808-82353830 ATTTCTATGCAAAAAGAGAAAGG + Intronic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1028326679 7:89535746-89535768 CAAAATATGCAAACAGAGGAGGG - Intergenic
1028533691 7:91866951-91866973 CTTTAAATGCCAAAAGAGGTCGG - Intronic
1028885833 7:95931623-95931645 CTTTATTTACAAAAACAGGTAGG - Intronic
1029981896 7:104886659-104886681 CTTAATATGTAAAAAGAGGCTGG - Intronic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030926682 7:115465784-115465806 CTTTCTCTGTAAAACGAGGATGG - Intergenic
1031462970 7:122074645-122074667 TTTTATATGCAATATGAGGTAGG + Intergenic
1032543290 7:132722055-132722077 CTTTATTTACAAAAACAAGAAGG + Intronic
1032682216 7:134196451-134196473 CTTTATGAGGAAAAACAGGATGG + Intronic
1032749191 7:134819967-134819989 ATGTATATGCTAAAAGAGAATGG + Intronic
1032758336 7:134913817-134913839 CTTTATTTGCAAAAACAGAGTGG + Intronic
1034708353 7:153168501-153168523 CTTTATAAGCCAAAAGAGATTGG - Intergenic
1035753850 8:2016242-2016264 CTTTACAGGCCAGAAGAGGATGG - Intergenic
1036221768 8:6927051-6927073 TTGTATATGCCAAAAGAGAAGGG + Intergenic
1037194368 8:16170051-16170073 CTTTTTATGCAAAAATAGGCCGG + Intronic
1037427231 8:18769234-18769256 CTTTAAATGAAAATAAAGGAAGG + Intronic
1037771488 8:21802893-21802915 CTAGATATCCAAAAAGATGATGG + Intronic
1037990910 8:23320609-23320631 CTTTATCTTAAAAAAGAGGCTGG + Intronic
1038179572 8:25213817-25213839 CTTTAGATGCAATAAGAGATGGG + Intronic
1038489136 8:27957149-27957171 CTATTTAAGCAAAAAGAGAAAGG - Intronic
1038792651 8:30682011-30682033 CCTTATATTCAAAAAGTCGATGG + Exonic
1038954740 8:32455331-32455353 ATTTATAGGCATAAAAAGGATGG - Intronic
1039073920 8:33671617-33671639 CTTTATTTTCAAACAAAGGAAGG + Intergenic
1041721511 8:60980487-60980509 CTTTATTTGGAAAAAGGGGCCGG + Intergenic
1041768134 8:61441994-61442016 CTTGATATACAAAAGAAGGATGG - Intronic
1041802043 8:61810881-61810903 AGTAATATGAAAAAAGAGGAAGG - Intergenic
1041846552 8:62335785-62335807 GTTTTTATGGAAAAGGAGGATGG - Intronic
1041869574 8:62617606-62617628 CTTTCTATGCAACAGGAGAAAGG - Intronic
1041973657 8:63772795-63772817 CTTTTTAGGAAAAAAGAGGAAGG + Intergenic
1042011285 8:64247832-64247854 CTTTTTATCCAGAAAGAGAAAGG - Intergenic
1042230959 8:66554051-66554073 CTTTATATGTAAAAACCGGCTGG + Intergenic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1044825865 8:96196321-96196343 ATTTATTTTCAAAAAAAGGAAGG + Intergenic
1045976569 8:108136425-108136447 CTTTAGGAGCAAAAAGAGGGAGG + Intergenic
1046089745 8:109487475-109487497 CCTTATTTGAAACAAGAGGATGG - Intronic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046596353 8:116265633-116265655 CTTTATTTGCAAAAACAGGTGGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048358464 8:133673723-133673745 CTTTATAAGCCAAATGGGGATGG + Intergenic
1050206258 9:3199508-3199530 CTTTAAGGGCAAAGAGAGGAGGG + Intergenic
1051264177 9:15295322-15295344 CTTTATTTACAAAAATAGGCAGG + Intronic
1051782994 9:20710925-20710947 CTTTATTTACAAAAAGAAGTGGG - Intronic
1052331570 9:27275202-27275224 CTTTGTAAGAAATAAGAGGAAGG + Intergenic
1052362055 9:27572661-27572683 CTTTGTATTCAGAAACAGGAGGG - Intronic
1052419026 9:28217951-28217973 CATAATTTGGAAAAAGAGGAGGG + Intronic
1053465679 9:38306708-38306730 AATTACAAGCAAAAAGAGGAAGG - Intergenic
1055407005 9:75985616-75985638 CTTTATATACAAAACCAGGCTGG - Intronic
1056022360 9:82452853-82452875 CTTTATTTACAAAAATAAGAGGG - Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057789962 9:98118369-98118391 TTTTATAGGCCACAAGAGGAAGG - Intronic
1057898494 9:98929178-98929200 CCAAATATGCAAAAAGGGGAAGG - Intergenic
1057932099 9:99202959-99202981 CTTTTTAAGAAAAAAAAGGATGG + Intergenic
1058400833 9:104617422-104617444 CTTCATATACATGAAGAGGATGG + Exonic
1058664481 9:107297764-107297786 CTTTATATCAAAAATGAGGGAGG - Intronic
1058689654 9:107508702-107508724 CTTTATTTGTAGCAAGAGGAGGG + Intergenic
1059576680 9:115496875-115496897 CTTTATCTACAAAATGAGAAGGG - Intergenic
1059780792 9:117524688-117524710 ATTTTTATGCAAAATGAGAATGG - Intergenic
1059890807 9:118800907-118800929 CTTTATATTCAAAATGAAAATGG + Intergenic
1060223335 9:121775714-121775736 CTTTAGATTCAAACAGAGGCTGG + Intronic
1061693005 9:132349909-132349931 CTTTATATCTAAAAAGAGGAGGG - Intronic
1186397182 X:9221967-9221989 GTTTATATGCAACAAGAAGCAGG - Intergenic
1186644932 X:11496461-11496483 CTTTATATTCAAATAAATGAGGG + Intronic
1186703204 X:12113584-12113606 CTTTATAAGGGAAAAGAGAAAGG - Intergenic
1186826823 X:13348819-13348841 ATTTATCTGCAAAATAAGGATGG - Intergenic
1186828506 X:13365814-13365836 CTTTATTTGCAAAAACAGGCTGG - Intergenic
1186966704 X:14794843-14794865 GTTTATATTCCAAAAGGGGAAGG + Intergenic
1187138727 X:16573074-16573096 CTTTATTTACAAAAATAGGCAGG + Intergenic
1187482398 X:19669595-19669617 ATTTATATGCAAAATAAAGATGG - Intronic
1187901217 X:24028276-24028298 CTTAAAAAGCAAAAACAGGAGGG - Intergenic
1187919557 X:24187869-24187891 CTTTAGAAGCACTAAGAGGATGG + Intronic
1187974927 X:24695450-24695472 CTATATATGAAAAAAGATCAGGG + Intronic
1188411858 X:29882650-29882672 CTTTATTTACAAAAACAGGCAGG + Intronic
1189125499 X:38441677-38441699 CTTTATATACAACAACAGGTAGG - Intronic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1193116673 X:77782446-77782468 CTTTATATGCAAATAAATTAAGG + Intronic
1193317801 X:80083889-80083911 CTTTCAATGCAAAACAAGGAAGG - Intergenic
1193668483 X:84353792-84353814 ATTTTCATGCAAAAAGAGGATGG - Intronic
1194097484 X:89660346-89660368 ATTGATATTCTAAAAGAGGAGGG - Intergenic
1194568654 X:95524550-95524572 CTTTATAGGCCAAAAGAGAGGGG + Intergenic
1197368536 X:125597880-125597902 CTATATATGCATAAAGGGAATGG + Intergenic
1197966238 X:132065325-132065347 CTTAATATTCAAAAAATGGAAGG - Intergenic
1198039288 X:132833992-132834014 CTGTATCTGCCAAATGAGGATGG - Intronic
1198143919 X:133835450-133835472 CTTTCTGTGCAGAAAAAGGATGG - Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1200450501 Y:3321720-3321742 ATTTATATTCTAAAAGAGGAGGG - Intergenic