ID: 1098611304

View in Genome Browser
Species Human (GRCh38)
Location 12:72461856-72461878
Sequence TCCCCAAGGTGGGGAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098611295_1098611304 16 Left 1098611295 12:72461817-72461839 CCTCCTCCTCTCTTTCCTGAGGC 0: 1
1: 1
2: 5
3: 84
4: 692
Right 1098611304 12:72461856-72461878 TCCCCAAGGTGGGGAAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 260
1098611299_1098611304 -6 Left 1098611299 12:72461839-72461861 CCTATGATGCATTCAATTCCCCA 0: 1
1: 0
2: 0
3: 12
4: 221
Right 1098611304 12:72461856-72461878 TCCCCAAGGTGGGGAAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 260
1098611296_1098611304 13 Left 1098611296 12:72461820-72461842 CCTCCTCTCTTTCCTGAGGCCTA 0: 1
1: 0
2: 4
3: 35
4: 357
Right 1098611304 12:72461856-72461878 TCCCCAAGGTGGGGAAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 260
1098611298_1098611304 1 Left 1098611298 12:72461832-72461854 CCTGAGGCCTATGATGCATTCAA 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1098611304 12:72461856-72461878 TCCCCAAGGTGGGGAAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 260
1098611297_1098611304 10 Left 1098611297 12:72461823-72461845 CCTCTCTTTCCTGAGGCCTATGA 0: 1
1: 0
2: 2
3: 30
4: 225
Right 1098611304 12:72461856-72461878 TCCCCAAGGTGGGGAAGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098611304 Original CRISPR TCCCCAAGGTGGGGAAGAAC TGG Intronic
900813904 1:4828623-4828645 GCCACAAGCTGGGGAAGAACTGG + Intergenic
902403211 1:16169222-16169244 TCCCAAGGGTGGGGATGCACTGG - Intergenic
902670763 1:17971723-17971745 TACCCAAGATGGGAAAGAAAAGG + Intergenic
903499028 1:23791710-23791732 TCCCCACGGTGGAGAAGGAAGGG + Intronic
904324205 1:29717238-29717260 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
904660351 1:32079508-32079530 TGCCTAAGGAGGGGATGAACTGG - Intronic
904943679 1:34183134-34183156 TTACAAAGGTGGGGAAGAAATGG + Intronic
905014410 1:34767441-34767463 TTTCCAAGGTGGGGAAAACCTGG - Intronic
906419998 1:45657642-45657664 TGCCCAAGGTGGTCTAGAACTGG - Intronic
906774803 1:48519616-48519638 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
909342835 1:74550892-74550914 TCCACAAGGCTGGGAAGACCTGG - Intergenic
910664383 1:89708671-89708693 ACTGCAATGTGGGGAAGAACTGG - Intronic
911136392 1:94445402-94445424 TCCCCATGGTGGGTAAGAAGGGG + Intronic
915485926 1:156220519-156220541 GCCCCAAGATGAGGAAAAACTGG - Intronic
917799732 1:178559841-178559863 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
920713342 1:208316502-208316524 TCCCCAAGGAGAGGAGGAAGGGG + Intergenic
921227165 1:213031807-213031829 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
923526643 1:234778017-234778039 TCCCCAAGGTGTGACAGAGCTGG + Intergenic
1065389239 10:25165428-25165450 TCCAAAAGGTCGTGAAGAACTGG + Intergenic
1065895474 10:30159428-30159450 TCCCTGAAGTGGTGAAGAACTGG - Intergenic
1066603869 10:37139423-37139445 TCTCCAGGGTGGGGATGACCAGG - Intronic
1070766582 10:79060103-79060125 TCCCCAAAGTGGGGAGAACCTGG - Intergenic
1072454042 10:95561038-95561060 TCCCCAGGGTGCGGAGGATCTGG - Intronic
1072766954 10:98102637-98102659 GCAGCAAGGTGTGGAAGAACTGG - Intergenic
1073255178 10:102146493-102146515 TCCCCAAGTTGGGGAACATGGGG + Intronic
1076711280 10:132336211-132336233 TGCCCTGGGGGGGGAAGAACAGG + Intronic
1077779166 11:5306134-5306156 TCCCCAACCTGGGAAAGATCTGG + Intronic
1078450328 11:11436176-11436198 ACAGCAAGGTGGGGCAGAACTGG - Intronic
1082690260 11:56293572-56293594 TGCCCAAGATGGGGAAGCAAAGG + Intergenic
1083065956 11:59924148-59924170 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1083167752 11:60901533-60901555 TCTTGAAGCTGGGGAAGAACAGG + Exonic
1083715920 11:64576904-64576926 TCCCCATGATGGGCAAGGACCGG - Intergenic
1083719503 11:64597448-64597470 TCCCCACGCTGGGGAAGACTTGG - Intronic
1083938097 11:65880912-65880934 TCCCCAATGTGGGGACAAAATGG - Intronic
1084458154 11:69280538-69280560 TCTCCAAGGAAAGGAAGAACAGG - Intergenic
1084563013 11:69914679-69914701 TCTCAAAGGTGAGGAGGAACAGG - Intergenic
1084591812 11:70094682-70094704 TCCCCCAGGGGAGGAAGAATGGG + Intronic
1087622057 11:100554009-100554031 TCTCCAAAGAGGGGAAGAGCCGG - Intergenic
1089664942 11:120012492-120012514 TCCCCATGGTGGAGATTAACCGG + Intergenic
1090884091 11:130861235-130861257 TCCCCAGGGTGAAGGAGAACTGG - Intergenic
1091304475 11:134528711-134528733 TCCTCAAGGGGGTTAAGAACTGG - Intergenic
1091583197 12:1800943-1800965 CACCCAAGGTGGGTGAGAACAGG + Intronic
1092077434 12:5685350-5685372 TCTCCATGGTGGGGAAGGATGGG + Intronic
1092462783 12:8700458-8700480 TTCCCAAAGTGTGGAACAACTGG - Exonic
1092650645 12:10631332-10631354 TCCCCAGGGCGGGGAAAAACTGG - Intronic
1092961406 12:13599799-13599821 TCTCCCAGGTGGGGAGGAGCAGG - Intronic
1094680122 12:32660347-32660369 GTCCCCAGGTGGGGAAGAAAGGG - Intergenic
1095185947 12:39200588-39200610 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1095913034 12:47448128-47448150 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1096450820 12:51739631-51739653 TCCCCATGGTGAGTAAGAAGGGG - Intronic
1096478422 12:51922702-51922724 GCCCCAAGGTTGGGAAGACCTGG + Intronic
1096672310 12:53207287-53207309 TCCCCAGGGTGGGGAAGATTTGG + Exonic
1096818645 12:54217315-54217337 TCCCCACGCTAGGCAAGAACTGG - Intergenic
1097380968 12:58895352-58895374 TCCCAAAGGAAGGGAAGAAACGG + Intronic
1098611304 12:72461856-72461878 TCCCCAAGGTGGGGAAGAACTGG + Intronic
1100731480 12:97475376-97475398 GCCCCAAGGTGAGAAAGAAAAGG - Intergenic
1101223801 12:102667551-102667573 TCCCCATGGTGAGTAAGAAGAGG - Intergenic
1101875352 12:108593588-108593610 GCCCCAGGGTGGGGAAGTCCTGG + Intronic
1101921327 12:108935604-108935626 TCCCCAAGGTGGTCAATTACAGG - Intronic
1102172589 12:110853397-110853419 TCCCCCAGTTGAAGAAGAACAGG + Exonic
1102492752 12:113298718-113298740 GGCCCCAGGTGAGGAAGAACTGG + Intergenic
1103828202 12:123757099-123757121 TCCCAAGGGAAGGGAAGAACTGG - Intronic
1104895858 12:132163292-132163314 TCCCACAGGTGGGGAGGACCCGG - Intergenic
1105470144 13:20686075-20686097 TCACCACAGTGGGGAAGAAGGGG - Intronic
1108639738 13:52371869-52371891 TCCCCAAGGAAGGGAAAAAATGG + Intergenic
1112241878 13:97689871-97689893 TCTCCAAAGGGGGCAAGAACAGG + Intergenic
1114531343 14:23398490-23398512 TCCTCAAGATGGGGAGTAACTGG - Intronic
1115645401 14:35365715-35365737 CCCTCAGGGTGGGGAAGCACAGG - Intergenic
1117586709 14:57214501-57214523 TGGCCAAGGTTGGGAAAAACAGG + Intronic
1119602279 14:75984256-75984278 TCAGCAAGTTGGGGAAGAAGTGG + Intronic
1120133885 14:80840974-80840996 TCCCAAAGATGGGGAAAAAAAGG - Intronic
1120879865 14:89407082-89407104 TCCCCAAGAGGGGGATGACCAGG + Intronic
1123789061 15:23701346-23701368 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1124953283 15:34342886-34342908 GAACCGAGGTGGGGAAGAACCGG - Intronic
1125342698 15:38690130-38690152 AGCCCAAGGTGGGAAAGTACTGG + Intergenic
1125723684 15:41857257-41857279 TGCCCAAGATGTGGAAGAGCAGG - Exonic
1126099986 15:45113148-45113170 TCCGCGAGCTGGGGAAGGACTGG - Intronic
1127057900 15:55151150-55151172 TTTCTAAGGTGGGGAAGAACAGG + Intergenic
1127433223 15:58932947-58932969 CCCTCAAGATGGGGAAGAAACGG + Intronic
1129300908 15:74624931-74624953 TCCGCAACGTGGGCAAGTACCGG + Exonic
1129885850 15:79036467-79036489 ACCCCAAGGTGGGAAACACCAGG - Intronic
1130350651 15:83088748-83088770 TGCCCACGGTGGGGCAGAAGAGG - Intergenic
1130710381 15:86274940-86274962 TCATCAAGGTGGGGAAGAGCAGG - Intronic
1133044645 16:3080949-3080971 TCCCCATGGTGAGTAAGAAGGGG - Intronic
1133374538 16:5273552-5273574 TCCCCAAGGTTTGGAACGACGGG + Intergenic
1136142831 16:28298253-28298275 TTCCCAAGGTGGGGCTGAGCTGG - Intronic
1136500803 16:30668958-30668980 TCACCAAGGAGGAGAAGGACAGG + Exonic
1136638360 16:31540333-31540355 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1137251964 16:46747504-46747526 TCCCCAGGGAAGGGAAGAAGCGG - Intronic
1137474779 16:48798272-48798294 TCCTGGAGCTGGGGAAGAACAGG + Intergenic
1139421732 16:66853368-66853390 TCCTCAAGATGGGGAAGTTCCGG + Exonic
1140277074 16:73519449-73519471 GGCCCAAGGTAGGGAAGAATGGG - Intergenic
1141177586 16:81730846-81730868 ACCCCAAGGTGGGGAAGCCTGGG - Intergenic
1142749152 17:1977399-1977421 CCCCGAAGGTGGGGAAGGGCAGG - Intronic
1143166144 17:4898115-4898137 CCTCCAGGGTGGGGAAGAAAGGG + Exonic
1145801020 17:27684841-27684863 TCCCCATGGTGAGAAAGAAGGGG + Intergenic
1146128212 17:30246044-30246066 TCCACAAGCTCGGGAAGACCAGG - Intergenic
1148639527 17:49176076-49176098 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1148646117 17:49220341-49220363 ACCCCACGGTTGGGAAGAAGAGG - Intronic
1151772914 17:76176970-76176992 ACCCCAATGTGGGGCAGACCTGG - Intronic
1152091403 17:78249670-78249692 TCTCCAAGGTGGGAAAGCCCTGG - Intergenic
1152938567 17:83154132-83154154 TCCCCACTGTGGGGAGGGACAGG - Intergenic
1155169407 18:23256232-23256254 CCACCAAGGTGGGGATGGACAGG - Intronic
1156400325 18:36733829-36733851 TCCCCAACGTGAAGAAGAATGGG + Intronic
1159516971 18:69470609-69470631 TCTTCAGGGTGGGGAAGAAAGGG - Intronic
1160480096 18:79232122-79232144 TCCCCCAGGTGGGACAGACCTGG - Intronic
1160851548 19:1195282-1195304 TCCGCAGGGTGGGGGTGAACGGG + Intronic
1160851972 19:1197096-1197118 TCCGCAGGGTGGGGGTGAACGGG + Intronic
1161349346 19:3783612-3783634 TCCCCAATGTGGAGATGAAGGGG - Intronic
1161581085 19:5081469-5081491 ACCCCAAGGTCTGGAAGAAAAGG - Intronic
1162198750 19:9006281-9006303 CCTCCAAGGTGGAGAAGAAGAGG + Intergenic
1162283242 19:9717329-9717351 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1162652793 19:12103651-12103673 TCCCCATGGTGAGTAAGAAGGGG - Intronic
1162679994 19:12333436-12333458 TCCCAAAAGTGGGAAAGAGCTGG - Intronic
1163424313 19:17232707-17232729 TCGCCACTGTGGGTAAGAACAGG + Intronic
1163977909 19:20869858-20869880 TTCCCAAGGTGGTGAAGGAGTGG - Intergenic
1164060901 19:21672766-21672788 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1164256818 19:23534415-23534437 TCCCCATGGTGAGTAAGAAAGGG + Intronic
1165866250 19:38941199-38941221 TCCCCATGGTGAGTAAGAAGGGG - Intronic
1166011891 19:39948900-39948922 TCCCCAAGGTGGGCAAGGGAAGG + Intergenic
1167249485 19:48392639-48392661 TCCTCAAGGTCTGGGAGAACAGG - Intergenic
925099327 2:1231991-1232013 TCCCTATGGATGGGAAGAACAGG - Intronic
925298923 2:2796213-2796235 TCCCCACGGTGGGGAGGCGCAGG + Intergenic
925898019 2:8488145-8488167 TCCCCATTGTCGGGAAGAACAGG + Intergenic
926538777 2:14148351-14148373 TCCCCAAGGGGGTGAAAAATTGG - Intergenic
927632426 2:24786105-24786127 GCCCAAGGGTGGGGAAGAACAGG - Intergenic
928362668 2:30678463-30678485 CCCCCACTGTGGGGAAGAAGAGG - Intergenic
929254966 2:39800574-39800596 TCCAGAAGGTGGGGAAGAAATGG - Intergenic
929916185 2:46137897-46137919 GCTGCAAGGTGGGGAAGAAATGG - Intronic
930824235 2:55679998-55680020 TCCCAGAGGTGTGGAAGAAGTGG - Intronic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
933251188 2:80030487-80030509 TTCCCAAGGTGAGAAAGCACTGG - Intronic
934552592 2:95271490-95271512 GCCCCAAGGTGCGGAAGAGGCGG - Intergenic
935026044 2:99277965-99277987 TCCCCATGGTGAGTAAGAAGGGG - Intronic
938467912 2:131535048-131535070 TCCCCAAGGCAGGAAAGAAAAGG + Intergenic
938755963 2:134379117-134379139 AGCAAAAGGTGGGGAAGAACAGG - Intronic
939257400 2:139761338-139761360 TCCACAAGGGGAGGGAGAACAGG - Intergenic
940311015 2:152279125-152279147 TCCCCGTGGTGAGGAAGAAGGGG - Intergenic
940394501 2:153172543-153172565 TGACCAAGGTGGAGGAGAACAGG + Intergenic
941207954 2:162598071-162598093 TCTCTAAGGTGGGGAAAAAACGG - Intronic
943679096 2:190749065-190749087 TCCTCCAGGAGGGGAGGAACTGG - Intergenic
946206529 2:218112871-218112893 TCCCCATGGTGAGTAAGAAGAGG + Intergenic
946280866 2:218664575-218664597 TCCTCAAGGTGGGGAACTACAGG + Intronic
946354078 2:219173975-219173997 TCCCAAAGGTGATGAAGAAGAGG + Intronic
1168951275 20:1803597-1803619 CTCCCCAGGTGGGGAAGAAGCGG - Intergenic
1169000941 20:2167638-2167660 TCCCCAAGATGGGGAGCAATGGG + Intronic
1169299893 20:4432838-4432860 TCCCCAAGGATGGCAAGGACAGG + Intergenic
1169589443 20:7124003-7124025 TCACCTCGGTGGGGAAGAGCAGG - Intergenic
1171229044 20:23467539-23467561 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1172170775 20:32930609-32930631 ACATCAAGGTGAGGAAGAACTGG + Intronic
1172677503 20:36684410-36684432 TACCTTAGGTGGGTAAGAACAGG + Exonic
1173075380 20:39813610-39813632 TCTCCCAGCTGGGGTAGAACTGG + Intergenic
1173564083 20:44026910-44026932 TGCCCAAGGTGGGGAGGAGGCGG - Intronic
1175695243 20:61098498-61098520 CCCCCAGGGAGGGGAAGACCAGG - Intergenic
1175800272 20:61797326-61797348 TGCCCAGGGTGGGGACGAGCAGG + Intronic
1175995819 20:62811952-62811974 TCCCCCTGGTGGGGAGGAGCTGG - Intronic
1176284771 21:5013563-5013585 TCCCCCAGGCTGGGAAGCACGGG + Intergenic
1177152843 21:17471756-17471778 TGTCCAAGGTTTGGAAGAACAGG + Intergenic
1178746428 21:35255134-35255156 ACACCAAGATGGGGAATAACAGG + Intronic
1179872410 21:44249912-44249934 TCCCCCAGGCTGGGAAGCACGGG - Intronic
1181356694 22:22301343-22301365 TCCCTCAGGTGGGCAACAACAGG - Intergenic
1182257548 22:29049699-29049721 GCACCACGGTGGGGAAGAGCAGG - Exonic
1184228567 22:43145080-43145102 TCCACAAGGACAGGAAGAACAGG + Intergenic
1184229138 22:43148967-43148989 ACCCCCAGCTGGGGCAGAACAGG - Intergenic
1184263610 22:43333930-43333952 TCAACATGGTGGTGAAGAACTGG + Intronic
1184387809 22:44186276-44186298 TGCCCAAGGTGTAGGAGAACTGG + Intronic
949875589 3:8624220-8624242 TCCACAATGAGGGGCAGAACAGG - Intronic
950354063 3:12388695-12388717 TCCCCAGGTAGGGGAAGAGCAGG - Intronic
953229655 3:41053326-41053348 TGGCCAAGGTGGTGATGAACTGG + Intergenic
953237084 3:41116527-41116549 TCTCATAGGTGGGGTAGAACTGG - Intergenic
954584640 3:51722517-51722539 TCCCCCAGGTGGCGATGAAGCGG + Intergenic
957099445 3:75809506-75809528 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
960788375 3:121399241-121399263 TCCCCATGGTGAGTAAGAAGGGG - Intronic
961323211 3:126092714-126092736 TCCCCATGGTGAGTAAGAAGGGG + Intronic
964119493 3:153167836-153167858 TCCCCTAGGTTGGGGAGAAGGGG - Intergenic
964374172 3:156033327-156033349 TCCCCAAGGTTAGAAAGAAGAGG + Intergenic
966968438 3:185019164-185019186 TCCCCATGGTGAGTAAGAAGGGG - Intronic
967686955 3:192428652-192428674 TCCCCAGTCTGGGGAAGTACGGG - Intronic
968957799 4:3728058-3728080 CCCCCACGGTGGGGAGGGACTGG - Intergenic
969390797 4:6890100-6890122 TTCCCAAGCTGGGGAGGAAGTGG + Intergenic
972080187 4:35140358-35140380 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
974669153 4:65005788-65005810 TAACCAAGGAGGAGAAGAACTGG + Intergenic
974896112 4:67941167-67941189 AGCCCAATGTGAGGAAGAACAGG + Intronic
976557003 4:86461519-86461541 TCCCCATGGTGAGTAAGAAGGGG + Intronic
977641971 4:99367667-99367689 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
979893564 4:126131355-126131377 TCCCCACGGTGAGTAAGAAGGGG + Intergenic
980195499 4:129583116-129583138 TCCTCACTGTGGGCAAGAACGGG - Intergenic
980395158 4:132203664-132203686 TCCCAAAGATGAGGAAGTACTGG + Intergenic
981393111 4:144216052-144216074 TACCCAAGGCTGGGAAGAAAAGG + Intergenic
982282081 4:153693792-153693814 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
983186520 4:164706742-164706764 ACCCCATTGTGGGCAAGAACTGG - Intergenic
985736172 5:1584762-1584784 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
985736189 5:1584865-1584887 TCCCCATGGTGTGTAAGAAAGGG - Intergenic
985736209 5:1584969-1584991 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
985923601 5:2998770-2998792 GCACCAAGGTGGGGCAGAATTGG - Intergenic
986461587 5:7978376-7978398 TCCCCACTGTGGGGAAAAATAGG - Intergenic
988446240 5:31289121-31289143 ACTCCAAAGTGGGGAAGAAGGGG - Intronic
990560313 5:56977454-56977476 TCCCCAAGGTGTGGGGGCACAGG - Intergenic
991132002 5:63133079-63133101 TCCCTAATGAGGGAAAGAACAGG + Intergenic
992447553 5:76847700-76847722 TCCTAAAGATAGGGAAGAACAGG + Intergenic
992703656 5:79365507-79365529 AGCTCAAGGTGGGGAAGAAGGGG + Intergenic
994885225 5:105551958-105551980 TCCCCAAGTTGTGGAACCACTGG - Intergenic
997249403 5:132377045-132377067 TCCCCAACCCAGGGAAGAACTGG - Intronic
997472737 5:134125689-134125711 GCCCCAAGGAGGGGGAGCACTGG + Intronic
997600035 5:135132764-135132786 TGCTCACAGTGGGGAAGAACGGG + Intronic
998105659 5:139467587-139467609 TCCACATGGTGGGGAAGGAATGG - Intergenic
999393769 5:151213622-151213644 TTCCCAAGGTAGGGAATAGCTGG - Intronic
1002584094 5:180230583-180230605 TCCCCAAGGTGGTGAGGCTCTGG + Intergenic
1002899736 6:1400621-1400643 TCTTCAAGGAGGGGAGGAACTGG + Intergenic
1003433894 6:6067979-6068001 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1005691794 6:28313557-28313579 TCCCCATCTTGGGGGAGAACAGG + Intergenic
1006847292 6:37071421-37071443 TCCCCAAAGTGGGGTCCAACAGG + Intergenic
1006921338 6:37629511-37629533 TCTCCAAGGAGAGGAAGAAGAGG + Intergenic
1007763859 6:44149873-44149895 GCAGCAGGGTGGGGAAGAACTGG - Exonic
1008093569 6:47316137-47316159 TCCCCATGGTGAGTAAGAAGGGG - Intergenic
1009865294 6:69390345-69390367 TCCCCAAGGTCGTGAAGAGCAGG - Intergenic
1010937219 6:81876653-81876675 TTCTCAAAGTGGGGAAGAGCAGG + Intergenic
1014146647 6:118005604-118005626 TTCTCAAGGAGGGGGAGAACAGG - Intronic
1014779336 6:125545095-125545117 TCCCTAAGGAGAGGATGAACAGG + Intergenic
1015967101 6:138705283-138705305 TCTCCATGGTGGGTAAGAAGTGG - Intergenic
1016299420 6:142613899-142613921 TCCCCAAAGTGGCTAAGAATTGG - Intergenic
1019368356 7:647035-647057 ACCCAGAGGTGGGGAAGAAAGGG + Intronic
1021683150 7:23155017-23155039 TCCCCAAGGAGGGAAGGATCAGG + Intronic
1022260127 7:28695814-28695836 TTCCCTAGGTGGGGAGGAAGAGG - Intronic
1024911215 7:54449460-54449482 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1025020420 7:55475755-55475777 TCCACAAGATGGGGTAGAAAGGG + Intronic
1025102278 7:56145476-56145498 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1026542777 7:71295320-71295342 TCCTCAAGGTGGGCAAGCAATGG - Intronic
1026698487 7:72618068-72618090 TCCGCTAAGTGGGGAATAACTGG + Intronic
1028780361 7:94728675-94728697 TCCCCATGGTGAGTAAGAAAGGG - Intergenic
1029128872 7:98314763-98314785 TCGCCCAGGTGGGGTAGACCTGG + Intronic
1029387441 7:100252897-100252919 TCCCCATGGGGGTGATGAACAGG + Intronic
1030141625 7:106310224-106310246 GCTCCAAGCTGGGGATGAACAGG - Intergenic
1032080884 7:128857941-128857963 TCCCCTGCCTGGGGAAGAACAGG + Intronic
1032091364 7:128913219-128913241 TCCCCTGCCTGGGGAAGAACGGG - Intergenic
1034238859 7:149594158-149594180 TTCACAGGGTGGGGAAGAATAGG + Intergenic
1034291953 7:149939940-149939962 TTTCCCTGGTGGGGAAGAACAGG - Intergenic
1034549346 7:151810471-151810493 AAGCCAAGTTGGGGAAGAACAGG + Intronic
1034814129 7:154156969-154156991 TTTCCCTGGTGGGGAAGAACAGG + Intronic
1035659494 8:1336115-1336137 TCACCAATGTGGGGAGGAACAGG - Intergenic
1036405730 8:8453714-8453736 TCCCCCAGCTGAGGAAGCACTGG + Intergenic
1036887290 8:12567713-12567735 TCCCCCAGGTTTGGAAGAATGGG - Intergenic
1036894884 8:12625814-12625836 TCCCCCAGGTTTGGAAGAATGGG - Intergenic
1037879795 8:22566959-22566981 TCCCCAAGGGGTGAGAGAACTGG + Intronic
1038617658 8:29110046-29110068 TGCCCAGGGAGTGGAAGAACGGG - Exonic
1038733813 8:30151260-30151282 TCCCCGTGGTGGGTAAGAAGGGG - Intronic
1039691656 8:39871001-39871023 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1040608886 8:48962903-48962925 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1042314089 8:67407306-67407328 ACCCCAGGGTGGTGAGGAACTGG + Intergenic
1043239411 8:77913876-77913898 CACCCAATGTGGGGATGAACAGG - Intergenic
1044251449 8:90007524-90007546 TCACCAAGGTGGGGCAGGGCAGG + Intronic
1044442339 8:92237160-92237182 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1044691259 8:94881580-94881602 TCACCAAGATTGGGTAGAACTGG - Exonic
1049418924 8:142508286-142508308 TCCCCATGCTGGAGAGGAACAGG - Intronic
1049791650 8:144475142-144475164 TCCGCAAGGTGGGGCAGGCCAGG - Exonic
1050365955 9:4873960-4873982 TCCTCAAGGTGGAAAAGAAAGGG - Intronic
1051111878 9:13648709-13648731 TCCCCAATGTAGGGAGGCACAGG + Intergenic
1052400087 9:27989106-27989128 TTCCCAAGGTGGAGAAGATTTGG - Intronic
1055573511 9:77640801-77640823 TTCCCCAGCTGGGGAAGAATTGG + Intronic
1056017929 9:82410788-82410810 TCCCAAAGGTGGGAAAGTATAGG + Intergenic
1056438736 9:86598698-86598720 TCCCCAAGTGGGGGAAAAAAAGG - Intergenic
1057286042 9:93755174-93755196 TCCCCATGGTGAGTAAGAAGCGG - Intergenic
1057297975 9:93860525-93860547 TCCCCACGCTGAGGAAGAATGGG + Intergenic
1057892623 9:98880845-98880867 GCCCCGAGGAGGGGAACAACAGG + Intergenic
1058111948 9:101040425-101040447 TCACCAAGAAGGGGAAGAAATGG - Intronic
1058757570 9:108097515-108097537 TCCCCAAGAAGGGGAGGAAGAGG - Intergenic
1061906826 9:133703295-133703317 CACCCAAGGTGGGGAACGACAGG + Intronic
1062367935 9:136220640-136220662 TCCCCAAGGTGAGGAGGAGCGGG + Intronic
1186192733 X:7082268-7082290 GACCCAAGGTGGGTGAGAACAGG + Intronic
1186874903 X:13807274-13807296 TCCCCCATGTGGCCAAGAACTGG - Intronic
1187547635 X:20268018-20268040 TGCCCAAGATGGGGAAGCCCTGG + Intergenic
1191833838 X:65443215-65443237 TCCCCATGGTGAGTAAGAAGGGG - Intronic
1193314027 X:80043262-80043284 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1200978433 Y:9238671-9238693 TCCCCATGGTGAGTAAGAAGGGG + Intergenic
1201564574 Y:15353008-15353030 GACCCAAGGTGGGTGAGAACAGG + Intergenic