ID: 1098611918

View in Genome Browser
Species Human (GRCh38)
Location 12:72469088-72469110
Sequence ATTCCCTCACCTATGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1194
Summary {0: 1, 1: 1, 2: 13, 3: 154, 4: 1025}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098611918_1098611920 26 Left 1098611918 12:72469088-72469110 CCTTATTTCATAGGTGAGGGAAT 0: 1
1: 1
2: 13
3: 154
4: 1025
Right 1098611920 12:72469137-72469159 ACTAATGTCGCATAGCCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098611918 Original CRISPR ATTCCCTCACCTATGAAATA AGG (reversed) Intronic
900850363 1:5137659-5137681 ATTTCCTTACCTATAAAATGGGG + Intergenic
900873052 1:5318928-5318950 GTTTCCTCACCAATAAAATAAGG - Intergenic
901187218 1:7382343-7382365 ATTTCCTTATCTATGAAATCAGG + Intronic
901223182 1:7595723-7595745 ATTTCCTCATCTCTGAAACAAGG - Intronic
901270254 1:7947368-7947390 GTTTCCTCACCTGTGAAACAGGG - Intergenic
901468275 1:9437631-9437653 ATTTCCTCATCTATAAAAAATGG - Intergenic
901581032 1:10243560-10243582 ATTCCTTCATCTGTGAAATGGGG - Intronic
902094614 1:13932623-13932645 ATTTCCTCATCTATAAAATGGGG - Intergenic
902141763 1:14362704-14362726 GTTTCCTCACCTAAGAAATAGGG - Intergenic
902410574 1:16209333-16209355 GTTTCCTCACCTATAAAATGGGG - Intronic
902554034 1:17236298-17236320 ACTCCCTCACCTGTAAAATGGGG + Intronic
902936904 1:19771023-19771045 GTTTCCTCAACTATGAAATGGGG + Intronic
903271249 1:22189784-22189806 ATTTCCTCATCTGTGAAATGGGG - Intergenic
903311620 1:22462636-22462658 GTTTCCTCATCTATGAAATGTGG + Intronic
903312588 1:22471490-22471512 GTTTCCTCATCTATAAAATAGGG + Intronic
903363984 1:22794659-22794681 ATTTCCTCTTCTGTGAAATAGGG - Intronic
903413213 1:23163884-23163906 GTTCCCTCATTTATAAAATAAGG + Intronic
903422378 1:23227255-23227277 ATTTCCTCACCTATAAAATGGGG - Intergenic
903440255 1:23382729-23382751 ATTTCCTCATCTATAAAATGAGG - Intronic
903543020 1:24107507-24107529 AGTCCCTGCCCTATAAAATAGGG - Intronic
903654434 1:24940438-24940460 GTTTCCTCATCTATGAAATGGGG + Intronic
904009940 1:27383605-27383627 GTTTCCTCACCTGTGAAGTAAGG - Intergenic
904104509 1:28067900-28067922 ATTTCCTCAACTTTAAAATAAGG - Intronic
904327442 1:29736465-29736487 GTTTCCTCACCTTTAAAATAAGG - Intergenic
904404673 1:30278357-30278379 ATTTCCTCATCTGTGAAATGGGG - Intergenic
904445957 1:30573105-30573127 ATGTTCTCATCTATGAAATAGGG + Intergenic
904447421 1:30586539-30586561 ATTTGCTCACCTATAAAACAGGG + Intergenic
904458365 1:30660898-30660920 ATTTCCTCAGCTATAAAATGGGG + Intergenic
904503317 1:30930243-30930265 ATTTCCACATCTATGAGATAGGG + Intergenic
904627981 1:31818808-31818830 ATTTCCTCATCTGTCAAATAAGG - Intergenic
904836530 1:33341135-33341157 GTTTCCTCATCTATGAAATGGGG + Intronic
904885256 1:33732930-33732952 GTTCCCTCAGCTATGAAATGAGG - Intronic
904933262 1:34107473-34107495 GTTTCCTTACCTATGAAATGGGG - Intronic
905026156 1:34851279-34851301 ATATCCTCACCTGTAAAATAGGG - Intronic
905180496 1:36162561-36162583 ATTCTCTCACCTGTGAAATGGGG + Intronic
905206848 1:36347505-36347527 ATTTCCTCATCTGTGAAAAAAGG + Intronic
905280060 1:36843432-36843454 ATTTCCTCATCTATCACATAAGG - Intronic
905562693 1:38940124-38940146 ATTTCCCCATCTATAAAATAGGG + Intronic
905976635 1:42179972-42179994 ATCCCCTTACCTATAAAATAAGG - Intronic
906016792 1:42589072-42589094 ACTTCCTCATCTCTGAAATAAGG + Intronic
906096088 1:43224928-43224950 ATTTTCTCACCTATAAAATGGGG + Intronic
906423563 1:45690034-45690056 GTTCATTCACCTTTGAAATATGG - Intronic
906505677 1:46377808-46377830 ATTTCCTCATCTATAAAATGGGG - Intergenic
906808791 1:48805470-48805492 ATTTCCTCAACTATGGAACAGGG + Intronic
907189476 1:52636564-52636586 CTTCCCACACCTATGAACCAAGG - Intronic
907269126 1:53280354-53280376 GTTTCCTCACCTATAAAATGGGG + Intronic
907286227 1:53381868-53381890 ATTCCCTCATCTGAAAAATAGGG + Intergenic
907291703 1:53418062-53418084 GTTTCCTCACCTGTAAAATAGGG + Intergenic
907474234 1:54694948-54694970 GTTTCCTCATCTATGAAATGGGG + Intronic
907677133 1:56528533-56528555 ATGTCCTCATCTATAAAATAAGG + Intronic
907788733 1:57640434-57640456 ATTCCCTTACCTGTAAAAAAAGG - Intronic
907822892 1:57988378-57988400 TTTTCCTCACCTATAAAATGGGG + Intronic
907936591 1:59047240-59047262 ATTTCCTCATCTGTGAAATGGGG + Intergenic
908323757 1:63003395-63003417 GTTTCCTCACCTGTGAAATAGGG - Intergenic
908383314 1:63617073-63617095 ATTTTCTCACCTTTGAAACAGGG - Intronic
908547853 1:65179462-65179484 ATTTCCTTATCTAAGAAATAGGG + Intronic
908569437 1:65393289-65393311 ATTTCCTCAACTATAAAATGGGG - Intronic
908660832 1:66433287-66433309 ATTTCCCCATCTATAAAATAAGG + Intergenic
908714732 1:67057043-67057065 ATTTCCTCACCTGTAAAATGGGG + Intergenic
908995982 1:70154866-70154888 GTTTTCTCACCTGTGAAATAGGG - Intronic
909470842 1:76026234-76026256 ATTTCCTCATCCATGAAAAAGGG + Intergenic
909479890 1:76119834-76119856 ATTCCCAAACCTATAAAACAGGG - Intronic
910146697 1:84087900-84087922 ATTCCCTAGCCAGTGAAATAGGG + Intronic
910208324 1:84769920-84769942 GTTTCCTCACCTATAAAATGGGG - Intergenic
910357333 1:86375356-86375378 ATTTCCTCATGTATAAAATAGGG - Intronic
910418207 1:87024610-87024632 ATTTCCTTAACTATGAAATAGGG + Intronic
910528087 1:88203977-88203999 ATTTCCTTACCTATAAAATAGGG + Intergenic
910873741 1:91858078-91858100 ATTTCCTCACTTATAAACTATGG + Intronic
911053757 1:93694001-93694023 ATCTCCTCATCTATAAAATAGGG - Intronic
911313528 1:96327403-96327425 AGTTCCTCAGCTATAAAATAAGG + Intergenic
911563305 1:99432753-99432775 AATTTCTCACCTATGAAATGGGG - Intergenic
912149527 1:106840498-106840520 ATTCCCTCACCTGTACAATGAGG + Intergenic
912377745 1:109225719-109225741 ATTCCCTTACCCATTAAATAGGG - Intronic
912674756 1:111668526-111668548 ATTCCTTCACCTGTAAAATGGGG - Intronic
912909856 1:113747005-113747027 ATTCCTTCACCTATAAAAAAGGG + Intronic
913068858 1:115282260-115282282 ATTTCTTCATCTGTGAAATATGG - Intergenic
913196614 1:116461764-116461786 ATGTCCTCATCTATAAAATAAGG - Intergenic
913363747 1:118012545-118012567 ATTTCCTCATCTATAAAATGAGG - Intronic
913389261 1:118292165-118292187 ATCCCATCACCTATAAAATTAGG - Intergenic
913465419 1:119136830-119136852 ATTTCTTCACGTTTGAAATAAGG + Intronic
913589754 1:120312003-120312025 ATTTCCTCATTTATAAAATAGGG - Intergenic
913618431 1:120586363-120586385 ATTTCCTCATTTATAAAATAGGG + Intergenic
913658533 1:120984956-120984978 CTCCCCTCACCAATGAAATCCGG + Intergenic
914009900 1:143768076-143768098 CTCCCCTCACCAATGAAATCCGG + Intergenic
914254263 1:145948302-145948324 TTTCCCTCATCTGTAAAATATGG - Intronic
914371289 1:147026801-147026823 GTTTCCTCAGCTATGAAACAAGG + Intergenic
914462669 1:147899122-147899144 GTTTCCTCATCTATAAAATAAGG + Intergenic
914523146 1:148436206-148436228 CTCCCCTCACCAATGAAATCCGG + Intergenic
914571784 1:148923860-148923882 ATTTCCTCATTTATAAAATAGGG - Intronic
914601051 1:149206401-149206423 ATTTCCTCACTTATAAAATAGGG + Intergenic
914648520 1:149676737-149676759 CTCCCCTCACCAATGAAATCCGG + Intergenic
914933952 1:151961517-151961539 GTTTCCTCTGCTATGAAATAAGG + Intergenic
914981390 1:152417708-152417730 ATTTCTTCATCTATGAAATTGGG - Intergenic
915102006 1:153507492-153507514 TTTGCCTCATCTCTGAAATAGGG - Intergenic
915129586 1:153687465-153687487 ATTCATTCACCCATGAAAAAGGG + Intronic
915278274 1:154804771-154804793 GTTTCCTCATCTATAAAATAGGG - Intronic
915432833 1:155879837-155879859 GTTTCCTCACCTATAAAATGTGG - Intronic
915596558 1:156899759-156899781 GTTCCCTCACCTAGAAAATGGGG - Intronic
915790588 1:158665829-158665851 CTATCCTCACCTATAAAATAAGG - Intronic
916276483 1:162999653-162999675 TTTTCCTCACCTGTAAAATAAGG - Intergenic
916448228 1:164893740-164893762 ATTTCCTCATCTGTTAAATAAGG - Intronic
916482705 1:165229560-165229582 ATTTTCTCAGCTATGAAATGAGG + Intronic
916509598 1:165460277-165460299 ATGCTCTCATCTATGAAATATGG + Intergenic
916577099 1:166077324-166077346 GTTTCCTCATCTAAGAAATAAGG + Intronic
916767871 1:167879226-167879248 ATTCTCTAACCTATAAAATAGGG + Intronic
916816786 1:168361964-168361986 ATTTCCTCCTCTATGAAACAGGG + Intergenic
916834648 1:168531431-168531453 ATTTCTTCATCTATGAAATGAGG - Intergenic
916877734 1:168987809-168987831 ATTCCCTGACCTTTGTAAGAAGG + Intergenic
916994015 1:170276202-170276224 GTTTCCTTATCTATGAAATAGGG + Intergenic
918052354 1:180985340-180985362 GTTTCCTCACCTGTAAAATAGGG + Intronic
918215244 1:182387696-182387718 GTTCCCTCATCTATAAAATAAGG - Intronic
918492259 1:185093816-185093838 ATTTCCCCAACTGTGAAATATGG + Intronic
918549562 1:185726697-185726719 ATTTCCTCTTCTATGAAATGGGG + Intergenic
918556470 1:185806189-185806211 GTTTCCTCATCTATGAAATGGGG - Intronic
918712204 1:187745596-187745618 GTTTCCTCATCTATAAAATAGGG - Intergenic
919057615 1:192590624-192590646 TTCCCCTCACCTTTGAGATAAGG - Intergenic
919499498 1:198318195-198318217 ATTTCTTCATCTATTAAATAGGG - Intronic
919629597 1:199947377-199947399 ATTTCCTTACCTATAAAATGTGG + Intergenic
919759538 1:201088837-201088859 GTTTCCTCACCTATAAAATAAGG - Intronic
919841668 1:201613924-201613946 ATTTCCTCATCTTTGAAATAGGG - Intergenic
919877725 1:201882780-201882802 GTTCCCTCATCTGTAAAATAGGG + Exonic
920116583 1:203626053-203626075 ATTCCCTCAACTAGGAAATGAGG + Intergenic
920318528 1:205098211-205098233 ATTTCCTCATCTGTAAAATAGGG - Intronic
920332445 1:205219706-205219728 ATTTCCTCATCTGTAAAATAAGG - Intergenic
920502112 1:206491978-206492000 GTTTCCTCACCTAGGAAATAGGG - Exonic
920650520 1:207833861-207833883 ATTCTCTCATCTATAAAGTAGGG + Intergenic
920809001 1:209264597-209264619 ATTTCCTTATCTATGAAACAGGG + Intergenic
920809463 1:209268464-209268486 ATTTCCTTATCTATGAAACAGGG + Intergenic
920916007 1:210258560-210258582 GTTTTCTCACCTATAAAATAAGG - Intergenic
921260976 1:213384833-213384855 ATGTCCTCACCTATGAAATGGGG - Intergenic
921277505 1:213534418-213534440 ATTTCCTCATCTATCAAATGAGG - Intergenic
921421125 1:214949676-214949698 GTTTCCTCACCTGTAAAATAGGG + Intergenic
921651164 1:217680270-217680292 ATTCCCTCTTCTATCAAATGAGG + Intronic
921839850 1:219816871-219816893 ATTTCCTCATCTGTGAAATGAGG + Intronic
921851164 1:219933533-219933555 CTTTCCTCACCTGTGAAATAGGG + Intronic
922140206 1:222877124-222877146 ATTACCTCATCTATAAAATGGGG + Intronic
922162123 1:223085790-223085812 ATTCCCTCATCTGTAAAATGGGG - Intergenic
922294363 1:224236441-224236463 ATTTCCTCATCTATAAAATGAGG - Intronic
922887765 1:229032982-229033004 GGACCCTCACCTATGGAATAAGG - Intergenic
922902516 1:229147851-229147873 ATTCCCTCGTCCATGAAATGAGG + Intergenic
923513397 1:234673246-234673268 TTTCCCTCATCTATTAAATGGGG - Intergenic
923928489 1:238664136-238664158 ATTTCCTTACCTTTTAAATATGG + Intergenic
924311350 1:242746586-242746608 ATTTCCTCATCTACAAAATAAGG + Intergenic
924386179 1:243499558-243499580 AGCCCTTCACATATGAAATAAGG - Intronic
924660411 1:246011178-246011200 ATTTCCCCATCTATGAAATGGGG - Intronic
924755424 1:246936528-246936550 ATTTCACCACCTATAAAATAAGG - Intergenic
1063486526 10:6425523-6425545 GGTCTCTCACCTATTAAATAGGG + Intergenic
1063728167 10:8663404-8663426 ATTTCCACACCTATGGCATAAGG + Intergenic
1064318956 10:14284069-14284091 GTTATCTCAACTATGAAATATGG + Intronic
1064646614 10:17466015-17466037 ATTTCCTCATTTATAAAATAAGG + Intergenic
1064752579 10:18546492-18546514 ATTTCCTCATCTATTAAACAAGG + Intronic
1066669316 10:37820278-37820300 AGTCCCTCATCTATGAGATCTGG - Intronic
1067012827 10:42730564-42730586 ATTTCCTCGACTATAAAATAAGG - Intergenic
1067769675 10:49114511-49114533 GTTTCCTCATCTATAAAATAGGG + Intronic
1067960288 10:50840378-50840400 ATTTCCTCATCTATAAAATGGGG - Intronic
1067964804 10:50899073-50899095 ATCCCTTCATCTATCAAATAGGG - Intergenic
1068507039 10:57914187-57914209 ATTTTCCCACCTATGAAATAGGG - Intergenic
1068810602 10:61251598-61251620 CTTTCCTCACCAATGAAAGAGGG + Intergenic
1068824061 10:61413130-61413152 TTTCTTTCACCCATGAAATAGGG - Intronic
1069274416 10:66571446-66571468 ATTTCCTCATCCATGAAATGGGG - Intronic
1069784756 10:70980886-70980908 TTTCCCTCATCTGTGAAATGGGG + Intergenic
1069787402 10:70997681-70997703 ATTTTCTCACCTGTGAAATGCGG - Intergenic
1069822001 10:71234122-71234144 ATTTCCTCATCTATAAAATGAGG - Intronic
1069845382 10:71367407-71367429 ATTTCCTCATCTGTAAAATAGGG + Intergenic
1070371241 10:75784252-75784274 GTTTCCTCACCTATAAAATGGGG + Intronic
1070509176 10:77144885-77144907 ATTTCCTCATCTCCGAAATAGGG + Intronic
1070625272 10:78046689-78046711 ATTTCCTCATCTATAAAATGGGG - Intronic
1070643596 10:78186216-78186238 ATTTCCTCACCTTTGAAACAGGG - Intergenic
1070677127 10:78419772-78419794 GTTTCCCCACCTGTGAAATAAGG - Intergenic
1070705704 10:78636457-78636479 GTTCCATAACCTATGAAACATGG - Intergenic
1071369705 10:84938881-84938903 ATTTCCTCACCTTTAAAATAGGG - Intergenic
1071661487 10:87506493-87506515 ATTTCCTCATCTTTGAGATAAGG - Intronic
1071715594 10:88092333-88092355 ATTCCCTCATCTGTAAAATGGGG - Intergenic
1071809403 10:89162549-89162571 ATTCTTTCAGCTATAAAATATGG + Intergenic
1072162140 10:92778055-92778077 ATTTCCTCATCTATAAAACAGGG + Intergenic
1072430259 10:95364957-95364979 ATTTCCTCATCTATAAAATGGGG + Intronic
1072626035 10:97112579-97112601 ATTGCCTCATCTGTGAAATGGGG - Intronic
1072898261 10:99385822-99385844 GTCCCTTCACCTAAGAAATATGG - Intronic
1073194871 10:101681983-101682005 ATTTCTTCACCTATAAAATAAGG + Intronic
1073464408 10:103685711-103685733 ATTTCTTCACCTGTAAAATAGGG - Intronic
1073530732 10:104229801-104229823 ATTTCCTCATTCATGAAATAGGG - Intronic
1074109943 10:110415708-110415730 CTTTCCTCACCTATAAAATGAGG + Intergenic
1074449712 10:113549308-113549330 GTTTCCTCATCTATAAAATAGGG - Intergenic
1074904469 10:117849170-117849192 ATGTCCTCACCTATTAAATGAGG + Intergenic
1076137063 10:128052458-128052480 GTTTCCTCATCTATGAAATGAGG + Intronic
1077223693 11:1428471-1428493 GTTTCCTCATCTGTGAAATAGGG + Intronic
1077418555 11:2437331-2437353 ATTTTCTCACCTGTGAAATCAGG - Intergenic
1077963032 11:7095697-7095719 TTCCCCTTACCTATAAAATAGGG + Intergenic
1077963052 11:7095906-7095928 TTTCCCTTATCTATAAAATAGGG + Intergenic
1079114332 11:17631568-17631590 TTTCCCTCACCTATAAAATGGGG + Intronic
1079155903 11:17947771-17947793 GTTCCCTCATCTACAAAATAAGG + Intronic
1079308225 11:19343465-19343487 ATTTGCTCATCTATAAAATAGGG - Intergenic
1079924199 11:26472412-26472434 ATTTCCTCACCTATGAAATGGGG - Intronic
1079951259 11:26807987-26808009 AATCAATCACCTATGAATTAAGG + Intergenic
1080042137 11:27770040-27770062 ACTCTCTCAGCTATAAAATAGGG + Intergenic
1080242410 11:30141617-30141639 ATTTCCTCATCTGTGAAATGAGG - Intergenic
1080815427 11:35751895-35751917 ATTTCCTCATCTATGTAATATGG - Intronic
1080988163 11:37496203-37496225 ATTCTCTCAGGTATTAAATAAGG - Intergenic
1081194433 11:40143877-40143899 GTTTCCTCACCTATAAAATGGGG - Intronic
1081612730 11:44572752-44572774 GTTTCCTCATCTGTGAAATAGGG + Intronic
1081743301 11:45455962-45455984 GTTTCCTCACCTATGAAATGAGG - Intergenic
1081800379 11:45854829-45854851 GTTTCCTCATCTATAAAATAAGG + Intronic
1081944378 11:46976548-46976570 ATTTCCTCTGCTATAAAATAAGG + Intronic
1081947025 11:47005732-47005754 CTTACCTCATCTATAAAATAGGG + Intronic
1082988880 11:59190390-59190412 GTTTTCTCACCTATGAAATGGGG - Intronic
1083023807 11:59532966-59532988 ATTTCCTCACCTGTAAAATGAGG - Intergenic
1083145613 11:60756276-60756298 GTTTCCTTACCTGTGAAATAGGG - Intergenic
1083186961 11:61023205-61023227 ATTTTCTCACCCATGAAATGGGG - Intergenic
1083449473 11:62733108-62733130 ATTCCCACAGTTGTGAAATAGGG + Intronic
1083599968 11:63940484-63940506 ATTTCCTCACCTCTGTAATTGGG + Intronic
1083628297 11:64083058-64083080 GTTTCCTCACCTGTGAAATGGGG - Intronic
1083694706 11:64434832-64434854 ACTGCCTCACCTGTGAAATGGGG - Intergenic
1084070678 11:66732173-66732195 ATTTCCTCATCTGTGAAATGGGG - Intergenic
1084313714 11:68331667-68331689 CTTCCCTGACCTTTGAAATGTGG + Intronic
1084535270 11:69752847-69752869 CTTTCCTCACCTGTGAAATGAGG + Intergenic
1084861442 11:72021157-72021179 ATCCCCTCATCTCTGAAATGGGG - Intronic
1085048993 11:73370140-73370162 ATTTCCTCACGTGTGAAATGAGG + Intergenic
1085625408 11:78068048-78068070 ATTCCCTCATCTATAAAATGGGG + Exonic
1085826257 11:79850992-79851014 ATTTCCTTACCCATGAAATGGGG - Intergenic
1085826784 11:79856374-79856396 ATTCCCTCATCTGTAAAATAAGG - Intergenic
1085833434 11:79927745-79927767 CTTCCCTCATCTATAAAATGTGG + Intergenic
1086126685 11:83355916-83355938 AGTTTCTCATCTATGAAATAGGG - Intergenic
1086147076 11:83563699-83563721 ATTTCCTCATCTATAAAATAAGG - Intronic
1086239014 11:84666777-84666799 ATTTCTTCAGCCATGAAATAGGG - Intronic
1086854137 11:91846245-91846267 ATTCCCTCACCTATAAAATGGGG + Intergenic
1086886697 11:92214218-92214240 ATTCCAGGCCCTATGAAATATGG + Intergenic
1087078601 11:94149017-94149039 CTTTCCTCACCTTTAAAATAGGG + Intronic
1087109065 11:94443519-94443541 GTTCCCTCACATATAAAACAGGG + Intronic
1087122851 11:94592909-94592931 CTTTCCTCATCTATGAAATAAGG - Intronic
1087329372 11:96760573-96760595 TTTTCCTCACTTATGAAAAAGGG + Intergenic
1087437036 11:98133939-98133961 GTTACCTCATCTATGAAATGAGG + Intergenic
1087510546 11:99086952-99086974 TTTTCTTCATCTATGAAATAGGG - Intronic
1087595787 11:100253443-100253465 ATTACCTCCTCTATGAAATGGGG + Intronic
1087638776 11:100733217-100733239 GTTTCCTTATCTATGAAATAGGG + Intronic
1088158579 11:106840133-106840155 ATACATTCACCTAAGAAATAAGG + Intronic
1088162184 11:106885648-106885670 ATTTCCCCACATATAAAATAGGG + Intronic
1088447287 11:109945723-109945745 ATTTTCTTACCTATGAAATGGGG - Intergenic
1088899163 11:114102145-114102167 ATTCCCAGACCTCTGAAACATGG + Intronic
1088987167 11:114919394-114919416 GTTTCCTCAGCTATAAAATAGGG - Intergenic
1089068653 11:115681562-115681584 ATTTCCTCAAGTATAAAATAAGG - Intergenic
1089132062 11:116219999-116220021 ATTCCTTCACCTATAAAATGAGG + Intergenic
1089376119 11:117996051-117996073 GTTTCCTCACTTATGAAATGGGG - Intronic
1089473860 11:118742744-118742766 GTTCCCTGACCCATGAAATAAGG - Intergenic
1089671515 11:120060455-120060477 GTTTCCTCATCTTTGAAATAGGG + Intergenic
1089793358 11:120960391-120960413 ATTTCCTCACCTGTAAAATTGGG + Intronic
1090039426 11:123276995-123277017 ATTTCCTCATCTATAAAACAGGG + Intergenic
1090407635 11:126486662-126486684 GTTTACCCACCTATGAAATAAGG - Intronic
1090484668 11:127102322-127102344 ATTTCCTCACCTGTAAAATGGGG + Intergenic
1090597071 11:128331285-128331307 ATTTCCTAACCTATAAAATGAGG + Intergenic
1090613671 11:128495119-128495141 ATTTCCTCATCTGTGAAATGGGG - Intronic
1090704072 11:129320801-129320823 GTTGCCTCAACTATGAAATGAGG + Intergenic
1090804272 11:130193000-130193022 GTTTCCTCACCTCTGAGATAGGG + Intronic
1090879683 11:130822769-130822791 ATTCCTTCCTCTATAAAATAGGG + Intergenic
1090961553 11:131561821-131561843 TTTGCCTCATCTATGAAATCAGG + Intronic
1091164801 11:133465750-133465772 GTTACCTCAACTATGAAATGGGG + Intronic
1091510561 12:1119878-1119900 ATTTCCTCATCTATAAAATGAGG + Intronic
1091795401 12:3295020-3295042 ATTTCCTCACCTGTAAAATGGGG + Intergenic
1091902460 12:4155505-4155527 ATTTCCTTAGCTATGAAATGAGG + Intergenic
1091981898 12:4871328-4871350 ATTTCCTGTCCTATGGAATATGG + Intergenic
1092089417 12:5792106-5792128 GTTTTCTCAGCTATGAAATAGGG - Intronic
1092101011 12:5883733-5883755 ATTTCCCCATCTATGAAATGAGG + Intronic
1092257110 12:6933082-6933104 GTTCCCTCACCTATATAATGAGG + Intronic
1092270120 12:7017356-7017378 ATTTCCTTATCTATGAAATGAGG - Intronic
1092486968 12:8910559-8910581 ATTTCCTCATCTATAAATTAAGG + Intergenic
1092560123 12:9603873-9603895 ATTTCCTCATCTGTGAAATGTGG + Intronic
1092836593 12:12495057-12495079 ATTTCCTCACCTGTAAAATAAGG + Intronic
1092837331 12:12503092-12503114 ATTTCCTCATCTATAAAATGAGG + Intronic
1092845158 12:12578058-12578080 ATTTCCTCATCTATAAAATGGGG + Intergenic
1092879060 12:12873776-12873798 ATTTCCTCAGCTATGAAATGGGG - Intergenic
1092958882 12:13576980-13577002 GTTTCCTCATCTATGAAATGGGG - Intronic
1092997765 12:13966148-13966170 ATTTCCTCACCTTTAAAATAGGG + Intronic
1093113242 12:15178622-15178644 ATTTCCTCATCTGTAAAATACGG + Intronic
1093114914 12:15197531-15197553 ATTTCCTCATCAATAAAATAGGG + Intronic
1093153975 12:15657867-15657889 GTTTCCTCAACTATAAAATAAGG + Intronic
1093190896 12:16074009-16074031 ATTTCCTCATCTGTGAAATGGGG - Intergenic
1093291215 12:17324443-17324465 TTTCCCTCACCTATCAACTATGG + Intergenic
1093950333 12:25158300-25158322 ATTTCCTCATCTGTGAAATCTGG + Intronic
1093998665 12:25670800-25670822 ACTCTCTCACCTATAAAATTTGG + Intergenic
1094019951 12:25903572-25903594 ATTTCCTCATCTATAAAACAGGG + Intergenic
1094558016 12:31522379-31522401 TTTACCTCACCTAGGAAATTGGG - Intronic
1095338880 12:41064823-41064845 TTTCCTTCAACTATAAAATAGGG - Intronic
1095353373 12:41241552-41241574 GTTCCCTCATCTATAAAATGGGG + Intronic
1095418678 12:42002445-42002467 GTTTCCTCACCTGGGAAATAGGG - Intergenic
1096607980 12:52780460-52780482 ATTTCCCCACCTATAAAATTGGG + Intergenic
1096701659 12:53387559-53387581 ATTTCCTCATCTAGAAAATAAGG - Intronic
1096859336 12:54512416-54512438 ATTTCCTCATCTATAAAATGTGG + Intronic
1097376549 12:58849884-58849906 ATTTCCTCACTTACGAAATGTGG - Intergenic
1097458301 12:59829039-59829061 ATTCCATCACATTGGAAATATGG - Intergenic
1097470657 12:59986860-59986882 ATTCCATCACCTAGGTATTAAGG - Intergenic
1097571684 12:61341118-61341140 ATTTCCTCATTTCTGAAATAGGG + Intergenic
1097616188 12:61886956-61886978 ATTTATTCAACTATGAAATAAGG + Intronic
1097800840 12:63912254-63912276 GTTTCCTCAACTCTGAAATAGGG - Intronic
1097818259 12:64099202-64099224 GTTTCCTCACCTATAAAATAGGG + Intronic
1098014858 12:66093652-66093674 CTTTCCTCACCTCTAAAATAGGG - Intergenic
1098280762 12:68860766-68860788 ATTTTATCACCTATGAAATGGGG + Intronic
1098596213 12:72274608-72274630 ATTTCCCCACCTGTAAAATAGGG - Intronic
1098598749 12:72304005-72304027 ATTTCCTCATCTATAAAATAAGG - Intronic
1098611918 12:72469088-72469110 ATTCCCTCACCTATGAAATAAGG - Intronic
1099026582 12:77471548-77471570 ATTTCCTCATTTATAAAATAAGG + Intergenic
1099249131 12:80230792-80230814 GTTCTTTCACCTGTGAAATAAGG + Intronic
1099353414 12:81603171-81603193 ATCTCCTCACTTATGAAATGGGG + Intronic
1099417069 12:82403516-82403538 ATTCCTTCAGATATGAAAAAAGG - Intronic
1099825294 12:87769186-87769208 AATCCATCACCTAGGAAATGTGG + Intergenic
1100164921 12:91906316-91906338 ATTTTCTCATCTATAAAATAGGG - Intergenic
1100276861 12:93079582-93079604 GTTTCCTCACCTATGAAATGAGG + Intergenic
1100280015 12:93109439-93109461 GTTTCCTTACCTATAAAATAAGG - Intergenic
1100464576 12:94833908-94833930 TTTCCCTCATCTGTGAAATAGGG - Intergenic
1100665801 12:96751786-96751808 ATTTCCTCTCCTATAAAATGTGG + Intronic
1101034365 12:100690407-100690429 ATTTCCTCAACTATAAAATGAGG - Intergenic
1101582006 12:106049926-106049948 ATTTCCTCATCTATAATATAGGG + Intergenic
1101707089 12:107230781-107230803 ATTTCCTCATCTATAAAATAAGG - Intergenic
1101786905 12:107892274-107892296 ATTTCCTCATCTACTAAATAGGG + Intergenic
1101827179 12:108229544-108229566 GTTTCCTCACCTATAAAACAGGG - Intronic
1101869240 12:108549540-108549562 ATTTCCTCATCTATAAAATGAGG + Intronic
1101893031 12:108732329-108732351 ATTCCCTCACCTGCGAAATGGGG - Intergenic
1102000001 12:109551432-109551454 GTTTCCTCACCTGTGAAATGGGG + Intergenic
1102507236 12:113391321-113391343 ATTACCTCATCTGTGAAATGGGG + Exonic
1102514010 12:113434566-113434588 GTTTCCTCACCTATGAAATGGGG - Intronic
1102521754 12:113481712-113481734 GTTTCCTCACCCATAAAATAGGG - Intergenic
1102561356 12:113764545-113764567 GTTTCCTCATCTGTGAAATAGGG - Intergenic
1102601670 12:114036183-114036205 GTTTCCTCACCTATAAAATTAGG - Intergenic
1102658041 12:114500237-114500259 ATTTCCTCATCTGTAAAATAAGG - Intergenic
1102900022 12:116629221-116629243 ATTTCCTCATCTGTAAAATAAGG - Intergenic
1103130682 12:118466080-118466102 ATTTCCTCACCTGTAAAATAGGG + Intergenic
1103228087 12:119305175-119305197 ATTCCTTCCCCTAGGATATAGGG + Intergenic
1103244395 12:119443848-119443870 CTGCCCTCATCTATGAAATGGGG + Intronic
1103964900 12:124632445-124632467 ATTCCCTCGTCCATGAAATGGGG + Intergenic
1104359485 12:128118368-128118390 ATTTACTCATCTATGAAAGAAGG + Intergenic
1104549580 12:129744112-129744134 ATTTCCACACCTGTAAAATAGGG + Intronic
1106432893 13:29698349-29698371 TTTTCCTCTCCTATAAAATAAGG + Intergenic
1106519226 13:30482527-30482549 ATTTCCTCACCTGTAAAATAAGG - Intronic
1106566773 13:30892106-30892128 ATTGCCTCACTCATGAAGTATGG - Intergenic
1107339135 13:39387586-39387608 TTTCCTTCACCTATTAAACAGGG - Intronic
1107736214 13:43401013-43401035 GTTCCCTCATCTATAAAATGGGG + Intronic
1107741094 13:43451268-43451290 GTTCCCTTACCTATAAAATTGGG - Intronic
1107916265 13:45154644-45154666 ATTTCCTCATTTATGAAATAAGG + Intronic
1108021506 13:46132474-46132496 ATGTCCTCACCTATAAAATGAGG + Intronic
1108218577 13:48209903-48209925 ATTTTCTCACCTATAAAATGGGG + Intergenic
1108390076 13:49938207-49938229 ATTTCTTCACCTATAAAATGGGG - Intergenic
1108464818 13:50704868-50704890 ATTTCCTCATCTATGTAAGAGGG - Intronic
1108533135 13:51346048-51346070 GTTCCCTCACCTGTGAAATAGGG + Intronic
1108684334 13:52805628-52805650 ATTTCCTAACCTATGGAACAGGG + Intergenic
1108736779 13:53292479-53292501 GCTTCCTCACCTATGAAGTAGGG + Intergenic
1109005163 13:56864874-56864896 ATTTCCTCATCTCTGAAATATGG + Intergenic
1109057010 13:57563463-57563485 AGTACCTAACCTATGGAATAGGG + Intergenic
1109276528 13:60310030-60310052 GTTTCCTCATCTATGAAATGGGG + Intergenic
1109922722 13:69090157-69090179 CATCCCTCATCTATGAGATATGG + Intergenic
1110862815 13:80362279-80362301 TTTTCCTCATCTATGAAATGAGG + Intergenic
1110956186 13:81555017-81555039 GTTCCCTCACCTAAAAAATGTGG + Intergenic
1112154132 13:96798641-96798663 ATGTCCTCATCTATAAAATAAGG + Intronic
1112229605 13:97575223-97575245 ATTCCCTCGCCGCTGAAGTAGGG + Intergenic
1112280544 13:98059294-98059316 GTTCTCTCACCTCTAAAATAAGG - Intergenic
1112766206 13:102747134-102747156 TTTCCCTCATTAATGAAATATGG + Exonic
1113490683 13:110689336-110689358 ATTCCTTCACCTGTGAAATGGGG - Intronic
1114068769 14:19091392-19091414 GTTTCCACATCTATGAAATAAGG + Intergenic
1114093492 14:19308613-19308635 GTTTCCACATCTATGAAATAAGG - Intergenic
1114306047 14:21423851-21423873 ATTTCCTCACCTTTGAAATGTGG - Intronic
1114403385 14:22431003-22431025 ATTCCCTCATCCACAAAATAAGG + Intergenic
1114498826 14:23153283-23153305 ATTCACTCACATATAAAATGAGG - Intronic
1114532395 14:23404069-23404091 GTTCCTTCACCTGTGAAACAGGG - Intronic
1114851244 14:26384792-26384814 ATTTCCTCACCTATGATGTCAGG + Intergenic
1115117846 14:29904423-29904445 ATTTCCTCACCTGCAAAATAAGG + Intronic
1115255411 14:31395976-31395998 ATTTCCTCATCTATAAAATGAGG + Intronic
1115497759 14:34023879-34023901 ACTTCCTCATCTGTGAAATAGGG - Intronic
1115875076 14:37852377-37852399 ATTTTCTCATCTATGAAATGGGG - Intronic
1116181701 14:41543461-41543483 AATCCCTCAGCTCTGGAATATGG - Intergenic
1116496386 14:45565650-45565672 TTTTCCTCACCTATAAAATAGGG - Intergenic
1116721431 14:48501304-48501326 ATTTCCTCACATATGTAATTAGG - Intergenic
1116999171 14:51354850-51354872 ATTTCCTCATCTATAAAATGGGG - Intergenic
1117395799 14:55308729-55308751 ATTCCCTCATCTTTAAAATGAGG + Intronic
1117687996 14:58275176-58275198 ATTTTCTCATCTATAAAATAAGG + Intronic
1117791584 14:59347716-59347738 ATTTCCTCATCTATGAATTGAGG + Intronic
1117985572 14:61383258-61383280 ATTTCCTCACCTATAAAAATAGG - Intronic
1118025561 14:61764528-61764550 ATTTCCTCATCTATAAAACAAGG - Intronic
1118335612 14:64851319-64851341 ATTTCTTCACCTATAAAACAAGG + Intronic
1118340568 14:64893120-64893142 ATTCCATCATCAAAGAAATAGGG - Intergenic
1118739089 14:68725315-68725337 ATTTCCTCATCTATAAAATGGGG + Intronic
1118796186 14:69147467-69147489 GTTTCCTCACCCATGTAATAAGG - Intronic
1118878031 14:69801363-69801385 TTTTCCTAACCTATAAAATAAGG - Intergenic
1118883567 14:69848953-69848975 ATTTCCCCACCTATAAAATGGGG - Intergenic
1119201404 14:72755508-72755530 ATTGCCTCACCTGTAAGATAAGG + Intronic
1119452337 14:74722484-74722506 GGTTCCTCACCTATAAAATAGGG + Intronic
1119517801 14:75262026-75262048 ATTTCCTCATCTATAAAATGGGG + Intronic
1119538181 14:75419864-75419886 ATTTCCTCATCTGTAAAATATGG + Intergenic
1119667534 14:76496056-76496078 GTTTCCTCATCTGTGAAATAGGG + Intronic
1119851244 14:77868190-77868212 GTTTCCTCACCTGTGAAATGTGG - Intronic
1119971376 14:78974394-78974416 ATTCTCTCACCTAGAAAATCTGG + Intronic
1120028856 14:79616832-79616854 CTTTCCTCATCTATGAAAGAAGG - Intronic
1120516492 14:85476975-85476997 GTTTCCTTACCTGTGAAATAGGG + Intergenic
1120541401 14:85755244-85755266 ATTTCCTCACATGTAAAATAGGG + Intergenic
1120732863 14:88022619-88022641 GATCCCTCACCTATAAAATGAGG - Intergenic
1120756214 14:88246803-88246825 ATTTCCTCATCTATAAAATGAGG + Intronic
1120912120 14:89676769-89676791 TTTTCCTCACCTATAAAATTAGG - Intergenic
1121496152 14:94392410-94392432 GTTTCCTCATCTATAAAATAGGG + Intergenic
1121658991 14:95620667-95620689 ATTTCCTCACCTAAAAAATGGGG + Intergenic
1121675125 14:95746256-95746278 GTTTCCTCATCCATGAAATAGGG - Intergenic
1121675272 14:95747307-95747329 ATTTCCCCACCTGTCAAATAGGG - Intergenic
1121696256 14:95914771-95914793 GTTTCCTCACCTATAAAGTAGGG - Intergenic
1121902181 14:97703645-97703667 GATTCCTCACCTATAAAATAGGG + Intergenic
1122006191 14:98705864-98705886 AATCCCTCACCTGTGAAATGGGG + Intergenic
1122009319 14:98732697-98732719 ATCCCCACATCTATCAAATAAGG - Intergenic
1122087375 14:99317097-99317119 GTTTCCTCACCTGTGAAATGGGG + Intergenic
1122197380 14:100098830-100098852 ATTTCCTTACCTATAAAATCGGG + Intronic
1122199715 14:100114983-100115005 GTTTCCCCACCTATAAAATAGGG + Intronic
1122394685 14:101415323-101415345 GTTTCCTCACCTATAAAATGGGG + Intergenic
1122454282 14:101837851-101837873 ATTCCCCCATCTGTGAAATGCGG - Intronic
1122495649 14:102152770-102152792 ATTTTCTCACCTGTAAAATAAGG - Intronic
1125054776 15:35345084-35345106 GTTCACTCATCTATAAAATATGG - Intronic
1125090004 15:35779264-35779286 GTTTCCTCAACTATAAAATAGGG + Intergenic
1125203453 15:37123473-37123495 ATTTCCTCATCTAGGAAACAGGG - Intergenic
1125335085 15:38619020-38619042 ATTCCCTCATCTTTAAAATTAGG - Intergenic
1126018058 15:44372611-44372633 GTTTCCTCACCTTTGAAAAAGGG + Intronic
1126426954 15:48537985-48538007 ATTTCCTAACCTACAAAATAGGG + Intronic
1126446889 15:48757301-48757323 ATTTCCTCATCTATAAAATGGGG + Intronic
1126498328 15:49317153-49317175 ATTTCCTCACCTCTAAAATGAGG - Intronic
1126681530 15:51206883-51206905 GTTTCTTCATCTATGAAATATGG - Intergenic
1126935151 15:53698537-53698559 ATCTCCTCATCTATGAAATGGGG - Intronic
1126937584 15:53728468-53728490 ATTTCCTCACCTGTGAAATGGGG - Intronic
1127007642 15:54588375-54588397 ATTCCCTCATCTGTAAAATGAGG + Intronic
1127055802 15:55129917-55129939 ACTTCCTCACCTGTGAAATGAGG + Intergenic
1127129237 15:55844607-55844629 GTTTCCTCATCTATAAAATAGGG + Intronic
1127215236 15:56816905-56816927 ACTTCCTCATCTATGGAATAAGG - Intronic
1127220070 15:56870443-56870465 ATTCCCTTATCTGTGAAATGTGG - Intronic
1127380756 15:58428842-58428864 ATCTCCTCACCTATAAAATGGGG - Intronic
1127387538 15:58478599-58478621 ATTACCTCCTCTATGAAATGGGG - Intronic
1127928328 15:63570166-63570188 ATTTCCTCACCTCTGAAGTGAGG + Intronic
1128931158 15:71706050-71706072 GTTTCCTCACATGTGAAATAAGG - Intronic
1129165171 15:73773088-73773110 ATTCCCTCATCTGTAAAATGGGG - Intergenic
1129265297 15:74390076-74390098 ATTCCCTCACCTGTAAAATGGGG + Intergenic
1129678398 15:77644505-77644527 TTTCCGTCACCTGGGAAATAAGG + Intronic
1129939168 15:79478871-79478893 ATTTTCTCAACTATAAAATAGGG - Intergenic
1130194485 15:81766562-81766584 ATTTCCTCCCCTGTGAAATAGGG - Intergenic
1130311835 15:82763088-82763110 GTTACCTCACCTATAAAATGAGG + Intronic
1130459496 15:84150721-84150743 ATTTCCTCACCTGAAAAATAGGG - Intergenic
1130628163 15:85537749-85537771 ATTTCCTCATCTGTGAAATGGGG + Intronic
1130641648 15:85681581-85681603 ATTTCCTCATCTGTGAAATGAGG - Intronic
1130749249 15:86692435-86692457 TTGCCCTCACCTATGAAAGCTGG + Intronic
1130883668 15:88075877-88075899 GTTTCCTCACCTGCGAAATAAGG + Intronic
1131050714 15:89346145-89346167 ATTCCCTCATCTGTAAAACAGGG - Intergenic
1131317469 15:91352631-91352653 TTCCTCTCACCTATGAAATAAGG - Intergenic
1131567098 15:93496105-93496127 ATTTCCTCACCTCTAAAATCAGG - Intergenic
1132090113 15:98941160-98941182 GTTTCCTCACCTCGGAAATAGGG + Intronic
1132995449 16:2820195-2820217 GTTTCCTCCCCTGTGAAATAGGG + Intronic
1133153744 16:3857043-3857065 ATACCCTCACCTGTAAAACAAGG + Intronic
1133515886 16:6508269-6508291 ATTCCATCACCCAGGTAATAAGG - Intronic
1133716201 16:8451656-8451678 ATTTCCTCATCTGTGAAATATGG + Intergenic
1134350501 16:13433501-13433523 CTTTCTTCACCCATGAAATAAGG - Intergenic
1135091689 16:19522782-19522804 GTTTCCGCATCTATGAAATAAGG - Intergenic
1135142473 16:19933503-19933525 GTTTCCTCAACTATCAAATAGGG - Intergenic
1135159847 16:20084254-20084276 ATTCTCTCACCTGTAAAATGGGG - Intergenic
1135173439 16:20207226-20207248 GTTCCCTTACCTATAAAATGTGG - Intergenic
1135196331 16:20398053-20398075 GTTTCCTCAACTATCAAATAGGG + Intronic
1135245313 16:20851468-20851490 GTTTCCTCACCTTTAAAATAGGG + Intronic
1135349512 16:21716748-21716770 GTTTCCTCACCTGTGAAATGGGG + Intronic
1135852178 16:25973786-25973808 GTTTCCTCACCTATACAATAGGG - Intronic
1135894017 16:26382296-26382318 ATTTTCTCATCTATGAAATAGGG - Intergenic
1136033197 16:27518406-27518428 GTTTCCTCAGCTATAAAATAGGG + Intronic
1136129294 16:28209764-28209786 ATTTCCTCAACTATGAAATTTGG - Intronic
1136555264 16:31003889-31003911 GTTCCCTCATCTGTGAAATGGGG - Intronic
1137247029 16:46714263-46714285 ATTGCCTCATCTATAAAATGGGG - Intronic
1137368817 16:47885714-47885736 ATTTCCTCATCTACAAAATAAGG + Intergenic
1137748122 16:50838269-50838291 ATTTCCTCACCTGTGAAACAGGG - Intergenic
1137806565 16:51311906-51311928 ATTTACTAACCTCTGAAATAGGG + Intergenic
1137841918 16:51648881-51648903 ATTTCCTCACTTATGAAATGGGG + Intergenic
1138084399 16:54120565-54120587 ATTGCCCCATCTATAAAATATGG - Exonic
1138292262 16:55857811-55857833 ATTCCTTCATCTGTGAAATAGGG - Intronic
1138299459 16:55914215-55914237 GTTTCCTCACCTATAAAATGGGG + Intronic
1138488487 16:57362087-57362109 ATTTCCTCACCTGTGAAAAGGGG - Intronic
1138657818 16:58500975-58500997 CTTCCCCCACCTACAAAATAAGG - Intronic
1138698075 16:58834273-58834295 ATTTCCTCCTCTATGAAAGAGGG - Intergenic
1138958287 16:61998368-61998390 ATTTACTCACCTGTCAAATAAGG - Intronic
1139195562 16:64914875-64914897 ATTTCATCACCTATAAAATGGGG - Intergenic
1139224155 16:65217916-65217938 ATTTCCTGACCCATGAAATGAGG - Intergenic
1139420471 16:66846512-66846534 GTTCCCTCATCTGTGAAATGGGG + Intronic
1140156374 16:72431603-72431625 ATGTCCTCACCAATGAAATAAGG - Intergenic
1140253261 16:73313511-73313533 ATTTTCTCATCTATGAAATAGGG - Intergenic
1140508379 16:75489071-75489093 CTTTCCTCATCTATAAAATAGGG - Intronic
1140777804 16:78265941-78265963 ATTCCCACATCTGTAAAATAGGG - Intronic
1140800223 16:78480504-78480526 CTTTCCTCATCTGTGAAATATGG - Intronic
1141323924 16:83037832-83037854 ATATCCTCATCTATCAAATAGGG + Intronic
1141480780 16:84305280-84305302 GTTTCCTCACCTATGCAATGGGG + Intronic
1141597893 16:85108330-85108352 ATTTCCTCACCTGTCAAATGAGG + Intronic
1142701954 17:1668070-1668092 ATTCCCTCATCTGTAAAATAGGG - Intronic
1142931206 17:3285235-3285257 ATTCCCTCGCCTAAGAGAGAGGG + Intergenic
1142944172 17:3411005-3411027 ATTCCCTCGCCTAAGAGAGAGGG - Intergenic
1143176469 17:4958183-4958205 GTTTCCTCACCTATAAAATAAGG - Intergenic
1143238632 17:5424675-5424697 GTTTCTTCACCTTTGAAATAAGG + Intronic
1143352081 17:6296360-6296382 TTTCCTTCCCCTATGAAATGGGG - Intergenic
1143676865 17:8439867-8439889 ATTTCCTCACCTGTAAAATGGGG - Intronic
1143693341 17:8589878-8589900 ATTTTCTCATCTGTGAAATAGGG - Intronic
1144062434 17:11595825-11595847 ATTCCCTCTCATATTGAATAGGG + Intergenic
1144420248 17:15090863-15090885 ATTTCCTCACCTACAAAATGAGG - Intergenic
1144587579 17:16497014-16497036 ATTTCCTCACCTGGGAAATCAGG - Intergenic
1144790215 17:17853864-17853886 ATTTCCTCATCTGTGAAATAAGG + Intronic
1144797596 17:17902894-17902916 ATTTCCTCACTTATAAAATGGGG - Intronic
1144952071 17:18999841-18999863 GTTTCCTCAACTGTGAAATAAGG + Intronic
1145058943 17:19720380-19720402 GTTCCCTCTCCTGTGAAATTTGG - Intergenic
1145758019 17:27407058-27407080 ATTTCCTCACCTGTGGAATAAGG + Intergenic
1145844570 17:28027097-28027119 ATTTCCTCACTCATAAAATAAGG - Intergenic
1146064652 17:29624638-29624660 ATTTCCTCAACTGTTAAATAGGG - Intergenic
1146119050 17:30173712-30173734 ATTTCCTTAACTATAAAATAAGG - Intronic
1146477746 17:33176732-33176754 GTTTCCTCACCTGTGAAATTAGG - Intronic
1146569797 17:33942388-33942410 ATTTCTTCATCTGTGAAATAAGG - Intronic
1146973781 17:37093859-37093881 ATTCCCTCATCTGTAAAATGGGG - Intronic
1147167461 17:38601135-38601157 CTTTCCTCACCTGTGAAATGAGG - Intronic
1147790436 17:43011211-43011233 ATTTCCTCATCTATAAAATAAGG + Intronic
1148450716 17:47776171-47776193 ATTTCCTCATCTGTAAAATAGGG + Intergenic
1148525412 17:48328150-48328172 GTTTCCTCACCTATCAAACAAGG + Intronic
1148724089 17:49776241-49776263 ACTTCCTCACCTGTGAAATGGGG - Intronic
1148757529 17:49981420-49981442 ATTTCTTCACCTATGCAGTAGGG + Intergenic
1149241581 17:54656935-54656957 ATTCCCTGATCTATAAAATGGGG + Intergenic
1149544078 17:57490119-57490141 ATTTCCTCATCTATAAAATGGGG + Intronic
1149618337 17:58021191-58021213 ATTTCTTCACCTATAAAATGGGG + Intergenic
1149686145 17:58536199-58536221 ATTTCTTCATCTGTGAAATAGGG + Intronic
1149824435 17:59814627-59814649 GTTCCCTCATCTATGAAATGTGG - Intronic
1150927057 17:69543644-69543666 ATTCACCCACCTATGAAAACAGG + Intergenic
1151407924 17:73901511-73901533 GTTTCCTCACCTATAATATAGGG + Intergenic
1151755514 17:76073234-76073256 GTTCCTTCATCTATGAAATGGGG + Intronic
1151812738 17:76453981-76454003 ATTTGCTCATCTGTGAAATAGGG + Intronic
1153074001 18:1141999-1142021 GTTTCCTTACCTATGAAATGGGG - Intergenic
1153155254 18:2141801-2141823 GTTTCCTCAACTATGAAATAGGG + Intergenic
1153978842 18:10292206-10292228 ATTTCCTCATCTGTAAAATAGGG + Intergenic
1154353102 18:13603534-13603556 ATTCTCTCACCTGTGAGATTGGG + Intronic
1155012402 18:21792726-21792748 ATTTCCTCATCTTTAAAATAAGG - Intronic
1155075530 18:22350711-22350733 ATTTCCTTACCTATAAAATTGGG - Intergenic
1155432237 18:25771582-25771604 ATTTCCTCAACTATAAAATAAGG - Intergenic
1155468243 18:26163126-26163148 ATTCCTGCCCCTATGAAAAAGGG + Intronic
1155939553 18:31789956-31789978 ATTTTCTCATCTATAAAATAGGG + Intergenic
1156197536 18:34791872-34791894 CTTCCTTCATCTATGAAATGGGG - Intronic
1156491270 18:37497881-37497903 ATTTCCTCACCTGTGAAATGGGG - Intronic
1156877163 18:42028706-42028728 ATTGCCTCATCTTTGAAATGAGG + Intronic
1157485848 18:48086297-48086319 ATGTCCTCACCTATAAAATGGGG - Intronic
1157800478 18:50616360-50616382 ATTTCCTCATCCATAAAATATGG + Intronic
1157882856 18:51338232-51338254 ATCACCTCACCTATGAATTGAGG + Intergenic
1157942695 18:51946390-51946412 ATTTTCTCATCTATGAAATGTGG - Intergenic
1158044510 18:53139659-53139681 GTTTCCTCACCTATAAAATGTGG - Intronic
1158124784 18:54089033-54089055 GTTCCCTCATCTATAAAATGGGG - Intergenic
1158289352 18:55921316-55921338 ATTTCCTCATCTGTGCAATAGGG + Intergenic
1158421744 18:57301004-57301026 ATTTCCTGAGCTATAAAATAGGG - Intergenic
1158585478 18:58729609-58729631 ATTTTCTCATCTATAAAATAAGG + Intronic
1158667874 18:59449206-59449228 ATTTCCTCATCTATAAAATGGGG + Intronic
1159351405 18:67279608-67279630 GTTTCCTCATCTGTGAAATATGG + Intergenic
1160557993 18:79738433-79738455 GTTTCCTCACCTGTGAAATGAGG + Intronic
1161656729 19:5520730-5520752 ATTTCCTCATCTATAAAATGGGG - Intergenic
1161958495 19:7509349-7509371 ATTTGCTCATCTATGAAATGGGG + Intronic
1163443626 19:17334155-17334177 GTTTCCTCACCTGTGAAATGGGG - Intronic
1163519984 19:17786431-17786453 ATTTCCTCATCTGTGAAATGAGG - Intronic
1164294852 19:23900891-23900913 CATCCATCACCTATGAAATAGGG + Intergenic
1164708098 19:30335269-30335291 GTTTCCTCACCTCTGTAATAGGG + Intronic
1164939173 19:32238640-32238662 ATTTCCTCATCTGTAAAATAGGG + Intergenic
1165590004 19:36960478-36960500 ATTCCCAAACCTGTGAAATAAGG - Intronic
1165787368 19:38469706-38469728 GGTGCCTCACCTATAAAATAAGG + Intronic
1165798176 19:38531347-38531369 GTTCCCCCACCGATAAAATAGGG + Intronic
1165927249 19:39334747-39334769 ATTTCCTCATCTGTGAAATGGGG - Intronic
1166195381 19:41202429-41202451 GTTTCCTCACCTAGGAAATGGGG + Intronic
1166647134 19:44540673-44540695 GTTTCCTCACCTGTGAAATGGGG - Intergenic
1166738113 19:45098002-45098024 GTTTCCTCACCTGTGAAACAGGG + Intronic
1167173309 19:47848381-47848403 GTTTCCTCATCTGTGAAATAGGG - Intergenic
1167737904 19:51308309-51308331 TTGTCCTCACCTGTGAAATAGGG + Intergenic
1167813117 19:51852547-51852569 ATTCCCTCACCGAGGAAGAAGGG + Intergenic
1168245703 19:55112313-55112335 GTTTCCTCACCTGTGAAATGGGG - Intronic
925578775 2:5388412-5388434 ATGCCATCACCCATGAAACAAGG - Intergenic
925612087 2:5710049-5710071 TTTTCCCCACCTGTGAAATAGGG + Intergenic
925964213 2:9048243-9048265 ATTTTCTCAACTATGAAATGGGG + Intergenic
926251152 2:11156087-11156109 GTTTCCTCACCTGTGAAATAAGG + Intronic
926487190 2:13476379-13476401 ATTACCTCAGCTTTAAAATAAGG - Intergenic
927014682 2:18946503-18946525 ATAACCTCAGCCATGAAATAAGG - Intergenic
927408239 2:22796620-22796642 ATTTCTTCACCTATAAAATCAGG - Intergenic
927786693 2:25979831-25979853 AATTCCTCACCTCTGAAATGGGG + Intronic
927957621 2:27218704-27218726 ATTCCTTCACCTCTGAAATTTGG + Intronic
927994674 2:27475676-27475698 ATTTCCTCATCTACAAAATAGGG - Intronic
928332315 2:30367051-30367073 ATTCCCACACATATTAAAGATGG - Intergenic
928611435 2:32995900-32995922 ATTTCCTCATCTATAAAACAGGG - Intronic
928698115 2:33871301-33871323 GTTCCCTCATCTGTGAAGTAGGG + Intergenic
928712484 2:34022918-34022940 ATTCACTGAACTAAGAAATAAGG + Intergenic
929041291 2:37747163-37747185 GTTTCCTCACCTATAAAATAGGG + Intergenic
929329380 2:40661997-40662019 GTTCTCTTACCTATAAAATAAGG - Intergenic
929826956 2:45316350-45316372 ATTTCCTCACCCATAAAATTAGG - Intergenic
929923992 2:46194307-46194329 ATTTCCTCAACTATAAAATGGGG - Intergenic
930064534 2:47317573-47317595 GTTTCCTCATCTATGAAATGGGG + Intergenic
930257362 2:49107733-49107755 TTTTCCTCACCTATAAAATTGGG - Intronic
930383375 2:50660210-50660232 ATTTCCTCATCTGTGAAATGGGG - Intronic
930813447 2:55567301-55567323 ATTTCCTGATCTATAAAATACGG + Intronic
931114494 2:59149764-59149786 ATTTCCTCATCTGTAAAATAAGG - Intergenic
931224187 2:60315519-60315541 GTTTCCTCATCTATGAAATGGGG - Intergenic
931227033 2:60340580-60340602 GTTTCCTCAGCTATAAAATAGGG + Intergenic
931267259 2:60671560-60671582 ATTCCCACACCTAGGAATTTGGG - Intergenic
931465398 2:62482395-62482417 ATTTCCTCACCTGTCAAACAGGG - Intergenic
932414044 2:71563242-71563264 ATTTCCTCACCTGTCAAATGGGG + Intronic
932972353 2:76559917-76559939 ATTTCCTCAGCTATAAAATGAGG - Intergenic
933000451 2:76915636-76915658 TTTCCATCAGCTATGACATAAGG - Intronic
933581458 2:84131305-84131327 ATGGCCTCATCTATGAAATGAGG + Intergenic
935445301 2:103150080-103150102 GTTGCCTCATCTATGAAATGTGG - Intergenic
936624473 2:114133553-114133575 ATTTCCTCACCTACAAAATGGGG - Intergenic
937070802 2:119061616-119061638 ATTTCCCCACCCATAAAATAAGG + Intergenic
938038416 2:128055546-128055568 CCTCCCTCCCCTATGAAAAAGGG + Intergenic
938323234 2:130379805-130379827 TTTCCCTCATCTAGGAAACATGG - Intergenic
938564318 2:132504361-132504383 TTTCCATCACCTGTGAAAGAAGG + Intronic
938566724 2:132525305-132525327 ATGCCCTCATCTGTGAAATGGGG + Intronic
938623648 2:133084472-133084494 ATTTCCTCACCTGTAAAACATGG + Intronic
938936527 2:136132360-136132382 ATTCACTCATTTTTGAAATAGGG - Intergenic
939171940 2:138706245-138706267 GTTCCCTCAGCTGTAAAATAAGG - Intronic
939197798 2:138993975-138993997 ATTACCTCTCCTATAAAATGAGG + Intergenic
939982136 2:148794857-148794879 ATTTCCTCAACTGTCAAATAAGG + Intergenic
940226768 2:151409120-151409142 ATTTCCTCCTCTATAAAATAGGG - Intergenic
941834001 2:169996350-169996372 ATTTCCTCATCTGTAAAATAGGG + Intronic
941893204 2:170603523-170603545 ACTCCTTCATCTATGAAATCTGG - Intronic
941903386 2:170698451-170698473 TTTTCGTCACCTGTGAAATAAGG - Intergenic
942161832 2:173196981-173197003 GTTACCTCACCTATAAAATAAGG + Intronic
942244460 2:173994366-173994388 ATTACCTCATCTATAAAATCGGG - Intergenic
942389080 2:175473255-175473277 ATTTTCTCATCTTTGAAATAAGG + Intergenic
942641872 2:178069242-178069264 ATTTCCTCACCCATAAAATGGGG - Intronic
942741301 2:179181676-179181698 ATTTCCTCAACTACAAAATAAGG + Intronic
942777640 2:179603225-179603247 ATTTCCTCACCTATGAAGTAAGG + Intronic
942827606 2:180198793-180198815 ATTCCCTCATCTTTAAAATGAGG + Intergenic
942973866 2:181990453-181990475 ATTTTCTCATCTATAAAATAGGG + Intronic
943008434 2:182416071-182416093 ATTTCTTCATCTATGAAATGGGG + Intronic
943110282 2:183596065-183596087 ATTCCCTCATCTCTTAAATCAGG + Intergenic
943520799 2:188946588-188946610 ATTTCCTCACTTATGAAACTGGG + Intergenic
943649979 2:190446883-190446905 AGTCCCTCACCCCTGAAATTTGG - Intronic
944333489 2:198500996-198501018 ATTCTCTCATCTATAAAGTAAGG + Intronic
944969494 2:204976370-204976392 GTTTCCTCACCTATAAAACAAGG + Intronic
945235760 2:207629939-207629961 ATGTCCTCATCTATAAAATAGGG + Intergenic
945879896 2:215314416-215314438 ATTTCCTCACCTATAAAATGAGG - Intronic
946346180 2:219112317-219112339 GTTTCCTCATCTATAAAATAGGG + Intronic
946375265 2:219304096-219304118 ATTCCCTCATCAATAAAATGGGG + Intronic
946579095 2:221107156-221107178 ATTTCCTCATCTATAAAATGAGG + Intergenic
947134317 2:226961873-226961895 ATTTCCTCACCTAAAAAATGGGG - Intronic
947227437 2:227853750-227853772 ATTCCCTCTCCTGTAAAATGAGG - Intergenic
947331882 2:229037354-229037376 ATTCCTTCAGCTGTTAAATACGG + Intronic
947403054 2:229747997-229748019 ACTGCCTCACCTGTGAGATAAGG + Intergenic
947448184 2:230180550-230180572 AGTCCCTCATCTATAAAATGAGG - Intronic
947478496 2:230474151-230474173 ATTTCCTCATTTATGAAACAGGG - Intronic
948150134 2:235738353-235738375 GTTTCCTCACCTGTGAAATGAGG - Intronic
948572371 2:238925734-238925756 GTTTCCTCAGCTATAAAATAGGG + Intergenic
1168789867 20:568689-568711 ATTTCCTCACCTTTAAAATGGGG + Intergenic
1168930772 20:1621833-1621855 GTTTCCTCACCTATAAAAAAAGG - Intergenic
1168981327 20:2006502-2006524 GTTTTCTCATCTATGAAATAGGG - Intergenic
1168986187 20:2050913-2050935 GTTCCCTCCTCTATAAAATAAGG + Intergenic
1169008515 20:2230047-2230069 TTTTCCTCACCTATGAAATAGGG - Intergenic
1169261483 20:4141861-4141883 TTTCCCTGGCCAATGAAATAGGG - Intronic
1169694838 20:8375749-8375771 ACTTCCTCATCTATGAAATGGGG + Intronic
1169754150 20:9025342-9025364 GTTTCCTCACCTATAAAAGAGGG - Intergenic
1170002597 20:11631758-11631780 ATTCCCTCATACATAAAATAGGG + Intergenic
1170373132 20:15671332-15671354 ATTCCCTCATCTCTTAAATCTGG - Intronic
1170418034 20:16165083-16165105 ATTCCATCATCTCTGAAACAGGG + Intergenic
1170875021 20:20242603-20242625 ATTTTCTTACCTATGAAATGTGG + Intronic
1170897582 20:20430087-20430109 ATCCCCTCATCTGTGAAAGAGGG + Intronic
1171199854 20:23232132-23232154 ATTACCTCCCCTAGGAAATCTGG - Intergenic
1172016233 20:31875206-31875228 GTTTCATCATCTATGAAATAGGG + Intronic
1172031968 20:31988623-31988645 GTTTCCTCATCTATGAAATGGGG + Intronic
1172106287 20:32519032-32519054 GTTCCCTCATCTGTGAAATGGGG - Intronic
1172325679 20:34032667-34032689 ATTTCCTCATCTATAAAATGAGG - Intronic
1172407520 20:34700757-34700779 GTTTCCTCACCTATAAAATGAGG + Intronic
1172493029 20:35356600-35356622 ATTTTCTCACCTGTGAAATGAGG - Intronic
1172503872 20:35446666-35446688 ATTTCCTCATTTATGAAACAAGG - Intronic
1172623162 20:36332700-36332722 ACTTCCTCACCTGTGAAATGGGG - Intronic
1172641024 20:36440571-36440593 GTTGCCTCACCTATGAAATGGGG - Intronic
1172823960 20:37764170-37764192 GTTTCCTCACTTATGAAATGGGG - Intronic
1173036151 20:39413055-39413077 ATCTCCTCACCTATAAAATGTGG - Intergenic
1173141728 20:40490714-40490736 ATTCCCAGACCTATGAAACCTGG + Intergenic
1173145718 20:40522396-40522418 ATTTCCTCACCTACAAAATGGGG + Intergenic
1173184277 20:40828856-40828878 AGTTCCTCATCTATGAAATGGGG - Intergenic
1173276166 20:41585550-41585572 AGTCCTTTACCTATGAAAGATGG + Intronic
1173444390 20:43104783-43104805 TTTCCCTCATCTATAAAATGTGG + Intronic
1173606504 20:44335844-44335866 GTTTCCTCATCTATGAAATGGGG + Intergenic
1173670476 20:44795325-44795347 GTTTCCTCATCTATAAAATAGGG + Intronic
1173672554 20:44809121-44809143 ATTTCCTCATCTCTGAAATGGGG - Intronic
1173689503 20:44949220-44949242 ATTTCCTCACCAATAAAATAGGG + Intronic
1173936636 20:46871638-46871660 TTTACCTCATCTATGAAATAGGG + Intergenic
1174011444 20:47452971-47452993 ATTTCCTGATCTATAAAATAAGG + Intergenic
1174144579 20:48442547-48442569 ATTCCCTCATCAATGAAATGTGG + Intergenic
1174179419 20:48665592-48665614 ATACCCTCATCTATAAAATGGGG + Intronic
1174279496 20:49428610-49428632 ATTTCCTCACCTGCAAAATAAGG - Intronic
1174862583 20:54105059-54105081 GTTAGCTCACCTATAAAATATGG + Intergenic
1175288473 20:57855479-57855501 ATTTCCTCATCTGTGAAATGGGG + Intergenic
1175568580 20:60000665-60000687 GTTCCCTCCCCTGTAAAATAGGG - Intronic
1177120229 21:17128865-17128887 ATTTCATCACCCATGAAATGTGG - Intergenic
1177179854 21:17733332-17733354 ATTTCCTCACGTGTAAAATAAGG + Intergenic
1177770382 21:25507927-25507949 GTTTCCTCATCTATAAAATAGGG - Intergenic
1178147248 21:29754502-29754524 ATTTCCTCACTTACGAAATGAGG + Intronic
1178267965 21:31162205-31162227 GTGCCCTCATCTATAAAATAGGG + Intronic
1178528347 21:33352044-33352066 ATTCCCTGATCTATAAAATCGGG - Intronic
1179241349 21:39595878-39595900 ATTGCCACACCAAGGAAATAAGG + Intronic
1180248353 21:46563252-46563274 GTTTCCTCACGTATGAAATGGGG - Intronic
1180487240 22:15813952-15813974 GTTTCCACATCTATGAAATAAGG + Intergenic
1180744232 22:18076428-18076450 ATTTCCTCACCTGTAAAATTGGG - Intergenic
1181506851 22:23364528-23364550 ATTCCTTCATCTGTGAAATACGG - Intergenic
1181531254 22:23518795-23518817 GTTTCCTCATCCATGAAATAGGG - Intergenic
1181807869 22:25385919-25385941 CTTCCCTCACCTTTGAAATGTGG - Intronic
1181882498 22:25992159-25992181 ATTCCCTCCTCTATGAAACTTGG + Intronic
1182117011 22:27762317-27762339 ATTTCCTCATCTATGAAATGGGG + Intronic
1182243019 22:28932263-28932285 GTTTCCTCACCTGTAAAATAAGG + Intronic
1182310132 22:29398464-29398486 ATGCCCTCAACTACGAAATGGGG - Intronic
1182317693 22:29458960-29458982 GTTCCCTCCTCTATGAAATTAGG - Intergenic
1182440128 22:30358150-30358172 GTTTCCTCACCTGTGAAATGAGG + Intronic
1182840578 22:33386213-33386235 GTTTCCTCACCTATAAAATAAGG - Intronic
1182897364 22:33869715-33869737 ATTGCCTCATCTCTGAAATGGGG - Intronic
1182971782 22:34586086-34586108 ATTTCCTCATCTTTAAAATAAGG - Intergenic
1183006613 22:34908169-34908191 ATTTCCTCATCCATAAAATAAGG + Intergenic
1183046498 22:35224743-35224765 GTTTCCTCATCTATGAAATGGGG - Intergenic
1183340608 22:37278745-37278767 GTTCCCTCATCTATGAAAGAGGG + Intergenic
1183444673 22:37845446-37845468 AACTCCTCACCTATAAAATAGGG - Intronic
1183501692 22:38183684-38183706 ATTTCCTCACCTGTAAAATGGGG - Intronic
1183547815 22:38464345-38464367 ATTTCCTCATCTGTAAAATAAGG + Intergenic
1183780844 22:39997947-39997969 GTTTCCTCACCTGTGAAACAGGG - Intronic
1184010254 22:41742575-41742597 ATTTCCTCATCTATTAAATGAGG - Intronic
1184177628 22:42798035-42798057 ATTCCTTCACCTGTAAAATGGGG + Intronic
1203293546 22_KI270736v1_random:18734-18756 GTTTCCTCACCTGTAAAATAGGG + Intergenic
949115586 3:317408-317430 ATCATCTCACCTCTGAAATAGGG - Intronic
949176382 3:1067949-1067971 ATTTCCTCATCTATGTAATGGGG + Intergenic
949311577 3:2704655-2704677 ATTCCCACTCCCATAAAATATGG + Intronic
949340895 3:3029757-3029779 ATTTCCTCATCTGTAAAATAAGG + Intronic
949374219 3:3369035-3369057 ATACCCTCATCAATGAAGTATGG - Intergenic
949741492 3:7239416-7239438 GTTTGCTCATCTATGAAATATGG + Intronic
949920784 3:8998842-8998864 GTTCCCTCATCTATGAAATGAGG - Intronic
950137847 3:10594853-10594875 ATTTCCTCATCTATAAAATGGGG - Intronic
950144939 3:10642206-10642228 ATTTCCTCATCTATAAAATAGGG + Intronic
950148297 3:10667228-10667250 GTTTCCTCATCTATAAAATAGGG - Intronic
950150922 3:10686746-10686768 ATTTACTCATCTGTGAAATAGGG - Intronic
950215008 3:11153201-11153223 ATTTTCTCACCTGTAAAATAGGG + Intronic
950722115 3:14890928-14890950 ATTTCCTCACCTGTAAAATGGGG - Intronic
950792969 3:15487988-15488010 ATTTCCTCATCTATGCAATGGGG - Intronic
951105404 3:18736297-18736319 ATTTTCTCAGTTATGAAATAAGG - Intergenic
951689024 3:25375947-25375969 ATTTCCTCATCTAAGAAATGGGG + Intronic
951734218 3:25846177-25846199 ATTTCCTCATCTGTCAAATAAGG - Intergenic
952038399 3:29232426-29232448 ATTTCCTCATCTGTGAAACAGGG - Intergenic
952508963 3:34035210-34035232 ATTTTCTCAGCTGTGAAATAAGG + Intergenic
952591494 3:34960540-34960562 ATTCCTTCACCTAGAAACTAGGG - Intergenic
952813172 3:37423331-37423353 ATTCCCTCATCTCTTAAATGGGG + Intronic
953114831 3:39982034-39982056 ATTTCCTCAACTATAAATTAAGG + Intronic
953435828 3:42876364-42876386 ACTCCCTCATCTGTGAAGTAGGG + Intronic
953470725 3:43163811-43163833 GTTTCCTCACCTATAAAATGGGG - Intergenic
953726311 3:45402142-45402164 TTTCTCTCATCTATAAAATAGGG + Intronic
954052336 3:47990738-47990760 TCTCCCTCACCTAGAAAATAGGG + Intronic
954430718 3:50469650-50469672 ATTCCCTCACCTGGGAAATGGGG - Intronic
954596556 3:51830212-51830234 GTGCCCTCATCTATGAAATCGGG - Intronic
954641049 3:52098083-52098105 ATTTCCTCATCTATAAAATAGGG + Intronic
954685165 3:52366328-52366350 ATTTCCTCATCTATAAAATGAGG - Intronic
955053136 3:55431521-55431543 GTTTCCTCATCTATAAAATAAGG + Intergenic
955078740 3:55638185-55638207 CTGCCCTCACCTATAAAATCAGG + Intronic
955081404 3:55660831-55660853 GGTCCCTCACCTATAAAACAGGG + Intronic
955205424 3:56891655-56891677 GTTTCCTCACCTATAAAATGGGG + Intronic
955285131 3:57633028-57633050 ATTTTCTCACCTGTGAAATATGG - Intronic
955406048 3:58626518-58626540 ATTTCCTCACCTGTAAAATAGGG - Intronic
956001985 3:64739333-64739355 TTTCCCTTACCCATGAGATAGGG + Intergenic
956309644 3:67864811-67864833 ATTTCCTCATGTATAAAATATGG - Intergenic
956371407 3:68566405-68566427 ATTCCCTCACTCCTGAAAAATGG - Intergenic
956640390 3:71410094-71410116 GCTCCCTCACCTGTAAAATATGG + Intronic
956922559 3:73945386-73945408 ATTTCCTCATCTGTGAAAGATGG + Intergenic
957323772 3:78665738-78665760 GTTTCCTCACCTATAAAATGGGG - Intronic
957560896 3:81819432-81819454 ATTTCCTCATCTATTAAATGGGG + Intergenic
958262396 3:91396925-91396947 TTTCTTTCACCTTTGAAATATGG - Intergenic
958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG + Intergenic
959044344 3:101455305-101455327 ATTTCCTCAACTATGAGATAAGG + Intronic
959126598 3:102297150-102297172 GTTTCCTCACCTATAAAATTAGG + Intronic
959164644 3:102760745-102760767 CTCCTCTCACCTATGAAATTTGG + Intergenic
959478749 3:106845496-106845518 ATTACTTTACCTATCAAATATGG - Intergenic
959517224 3:107282007-107282029 ATTTCCTCATCTGTGGAATAAGG - Intergenic
959725455 3:109537060-109537082 ATTTCCTCACCTATAAAATGAGG - Intergenic
959914718 3:111803735-111803757 CTTCCCTCAGCTATAAAAAATGG + Intronic
959927119 3:111935421-111935443 ATATCCTCATATATGAAATAAGG + Intronic
960142622 3:114165808-114165830 ATTTCTCCATCTATGAAATAGGG + Intronic
960195976 3:114768763-114768785 CTTCCCTCGCTTATGAAAAAAGG - Intronic
960213819 3:115005094-115005116 AATCCCTCTCCTTTGAAATGGGG - Intronic
960235888 3:115281598-115281620 GTTTCCTCACCTATAAAATGTGG - Intergenic
960302902 3:116026167-116026189 ACTCCCTCAGCTATGCAATGGGG + Intronic
960455195 3:117862710-117862732 ATTTCCTCATCTATAAACTAGGG - Intergenic
960698475 3:120418263-120418285 ATTTCCTCATCTATGGAATAGGG - Intronic
960944290 3:122955688-122955710 GTTTCATCACCTGTGAAATAAGG + Intronic
961073469 3:123960487-123960509 ATTTCCTCATATATAAAATAGGG + Intronic
961357485 3:126348221-126348243 ATTCTCTCCTCTGTGAAATAGGG + Intronic
961847440 3:129778412-129778434 GTTCCATCACTGATGAAATAAGG + Intronic
961954861 3:130790967-130790989 GTTTCCTCATCTGTGAAATAGGG - Intergenic
962351608 3:134660398-134660420 ATTTCCTCATCTATGAACTCAGG - Intronic
962463164 3:135633150-135633172 ATTCCCTCATCTATTAAAATGGG + Intergenic
962479982 3:135789419-135789441 ATTTCCTCATCTATAAAATGGGG + Intergenic
962866826 3:139454019-139454041 ATTCACTCACCTTTGGAATGAGG - Intronic
963117436 3:141742631-141742653 ATTCCCTCATCTGTAAAAAAGGG - Intronic
963403377 3:144831745-144831767 ATTTCTTCAGCTATAAAATAAGG + Intergenic
963840759 3:150103661-150103683 GTTCCCTCACCTGTAAAATAAGG - Intergenic
964060134 3:152512095-152512117 ATTTCCTCATCTGAGAAATAAGG + Intergenic
964123717 3:153213938-153213960 GTTTCTTCACCTGTGAAATAAGG + Intergenic
964140093 3:153388071-153388093 AATTCCTCACCTTTAAAATAAGG + Intergenic
964615821 3:158664068-158664090 ATTTCCTCACCTGTAAAATGTGG + Intronic
964690142 3:159441406-159441428 GTTCTCTCACCTATAAAATGAGG - Intronic
965085726 3:164094740-164094762 CTTTCCTCACCTATAAAATGAGG - Intergenic
966081357 3:176006052-176006074 TTTTCCTCACCTATAAATTAAGG + Intergenic
966469060 3:180266955-180266977 AATTCCTCACCTATAAAATTGGG - Intergenic
966801646 3:183769517-183769539 ATCCCCTCATCTATAAAATATGG - Intronic
966920462 3:184607962-184607984 ATGTCCTCATCTATGAAATGGGG - Intronic
966940511 3:184743369-184743391 ATTTCCTCATTTATAAAATAAGG - Intergenic
967096722 3:186183287-186183309 TTTTCCTCAACTATGAAATAGGG + Intronic
967152843 3:186665416-186665438 GTTCCCTCATTTACGAAATATGG - Intronic
967347847 3:188478584-188478606 TTTTCCTCACCTATGAAATGAGG - Intronic
967380822 3:188855778-188855800 ATTCCGTCAGCTATAAAATAAGG - Intronic
967535734 3:190600698-190600720 ATTTCCACACCTCTGAAGTAAGG - Intronic
967631518 3:191747718-191747740 ATTTCCACACCTAAGAACTATGG + Intergenic
968192226 3:196676920-196676942 CTTTCCTCACCTACAAAATAAGG + Intronic
969058409 4:4416142-4416164 GGTCCCTCACCTATAAAATGCGG - Intronic
969325715 4:6442712-6442734 GTTCCTTCATCTATGAAATGGGG - Intronic
969707920 4:8821842-8821864 AATCCCTCTCCTATAAAATGGGG + Intergenic
970008422 4:11431985-11432007 AATCCCTCAATTATAAAATAGGG - Intergenic
970197443 4:13565920-13565942 ATTCTCCCAACTATGAAATTGGG + Intergenic
970472249 4:16390511-16390533 ATTTCTTCATCTATTAAATAGGG - Intergenic
970490710 4:16570911-16570933 ATTTCCTCACCAATAAAACAGGG - Intronic
970594589 4:17588604-17588626 ATTTCCTCATCTATAAAATGAGG - Intronic
970717285 4:18941197-18941219 ATTCCTTCCCCTATTAAAAATGG + Intergenic
970782503 4:19755350-19755372 GTTTCTTCACCTATGAAACAGGG + Intergenic
970893989 4:21080237-21080259 ATTTCCTCACCTATAATATGGGG + Intronic
970991305 4:22216334-22216356 ATTTCCTCAGCTATAAAATGAGG + Intergenic
971151419 4:24036093-24036115 ATTTCCTCGTCTGTGAAATAGGG + Intergenic
971206895 4:24579635-24579657 CTTCCCTCACCTATAAGATGTGG + Intronic
971213875 4:24645823-24645845 ATTCCCTCATCTGTAGAATAGGG - Intergenic
971421092 4:26474786-26474808 ATACCTTCACCTGTGAAATGTGG + Intergenic
971704135 4:30017196-30017218 AGTCCCTCAACTAAGAAATACGG + Intergenic
971839258 4:31812305-31812327 ATTTCCTCTTCTTTGAAATAGGG + Intergenic
972260431 4:37402770-37402792 ATTTCCTCATCTCTGAAATGAGG + Intronic
973187711 4:47350491-47350513 ATTGCTTCATCTATAAAATAGGG + Intronic
973604226 4:52570710-52570732 ATTTCCCCACCTGTAAAATAGGG + Intergenic
973750272 4:54010593-54010615 GTTTCCTCATCTGTGAAATAAGG - Intronic
973844099 4:54893340-54893362 ATTTCCTCACCTGTAAAATGAGG + Intergenic
973940403 4:55903588-55903610 ATTCCCTCAGCTGTCAAATAGGG + Intronic
974097691 4:57382839-57382861 ATTTCCTCACCTATAAATTGGGG - Intergenic
974455234 4:62122027-62122049 ATTCCCTTATCTATCAAATGTGG - Intergenic
975495981 4:75036443-75036465 TTTCCCTCACCTGTAAAATAAGG + Intronic
975848800 4:78551251-78551273 ATTTCCTCATCTATAAAATGGGG + Intergenic
975916784 4:79334844-79334866 AATCCTTCACCTATAAACTATGG + Intergenic
977278288 4:95006437-95006459 ATTTCCTTACCTTTAAAATAGGG - Intronic
977400308 4:96523260-96523282 ATTTCCTCACCTATTAAATTAGG + Intergenic
977650308 4:99461468-99461490 ATTTTCTCACCTGTAAAATATGG + Intergenic
978347278 4:107784976-107784998 ATTGCCTCATCTATAAAATGAGG + Intergenic
978944823 4:114482402-114482424 ATTTCCTCACCTACAAAATTGGG + Intergenic
979192706 4:117882438-117882460 ATTCCCTCCTCTATCAAATAGGG - Intergenic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
979502840 4:121459949-121459971 ATTCCTTTATCTGTGAAATAGGG + Intergenic
979761377 4:124408866-124408888 ATTTCCTCCTCTATGAAGTAAGG + Intergenic
980754401 4:137138527-137138549 ATTTCCTCATAGATGAAATAAGG + Intergenic
980901216 4:138907219-138907241 ATTTCCTAACCCATAAAATAGGG + Intergenic
981059124 4:140401141-140401163 ATTTCATCACCTCTGAAGTATGG + Intronic
982177742 4:152722158-152722180 CTTCCCTCACCTATAAAACAAGG + Intronic
983159644 4:164396146-164396168 ATTTCCTCACCTAGAAAATTAGG + Intergenic
983250776 4:165344093-165344115 ATTATCTCATCTATCAAATAGGG - Intergenic
983250960 4:165345945-165345967 ATTTCCTCATCTATGAAATGAGG + Intergenic
984200599 4:176715997-176716019 ATTTCATTACCTATAAAATAGGG + Intronic
984697526 4:182794269-182794291 ATTCCCTTAACTATAAAATTGGG + Intronic
985024387 4:185725501-185725523 ATTTCCTCACCTATAAACTTGGG + Intronic
985165435 4:187089345-187089367 AACCCCTCACCTATAAAATGAGG - Intergenic
986170047 5:5307720-5307742 GTTGCCTCATCTGTGAAATAGGG - Intronic
986525158 5:8665471-8665493 GTTCCCTGACCTGTGAAATGGGG + Intergenic
986546933 5:8907917-8907939 ATTTCCTCATCTATGGAATGAGG + Intergenic
986755133 5:10828648-10828670 ATTCCCTCACCTATCAAATGAGG - Intergenic
987274058 5:16343601-16343623 ATTTCCTTATCTATTAAATAGGG - Intergenic
987288595 5:16486532-16486554 CGTTCCTCACCTATAAAATAAGG - Intronic
987351405 5:17025452-17025474 ATTCCCTTACTTATAAAATGGGG + Intergenic
988611798 5:32733991-32734013 ATTTCCTCATCTGTAAAATAGGG + Intronic
988623940 5:32851146-32851168 ATTTCCTCATCTAAAAAATAAGG + Intergenic
988688436 5:33548381-33548403 ATTTCTTCCCCTATAAAATAGGG + Intronic
988690160 5:33563898-33563920 TTTCCCTCATCTATGAAATGAGG - Intronic
989115249 5:37946069-37946091 ATTCCCTCACCTAGGGAGTAAGG - Intergenic
989361239 5:40603774-40603796 TTTCCATGACCTATGAAAAAAGG - Intergenic
990154307 5:52857343-52857365 ACTCCCTCTCCTGTGAAATCAGG + Intronic
990370783 5:55116010-55116032 TTTCCCTCACCTATAAAATAAGG - Intronic
990383401 5:55236375-55236397 ATTTCCTCATCTGTTAAATATGG + Intergenic
990510633 5:56486404-56486426 ATTCCCTCATCTGTAAAATGGGG - Intergenic
990811380 5:59728119-59728141 ATTTCCTCATCTATCAAATGGGG - Intronic
990967143 5:61461358-61461380 TTTCTCTCACTTATTAAATAAGG - Intronic
991053649 5:62299202-62299224 ATTTCCTCATCTATAAAATGGGG - Intergenic
991140327 5:63233079-63233101 ATTCTCTCACACATAAAATAAGG + Intergenic
991299438 5:65114775-65114797 GTTTCCTCATCTATAAAATAAGG - Intergenic
991503646 5:67302515-67302537 ATTTTCTCACCTGTGAAATGGGG - Intergenic
992005958 5:72477655-72477677 AATTCCTTACCTATAAAATAGGG - Intronic
992217006 5:74536126-74536148 GTTTCCTCATCTATAAAATAAGG + Intergenic
992671999 5:79070056-79070078 GTTTCCTCACCTGTGAAATGGGG - Intronic
993602932 5:89951520-89951542 ATTCTCTCATCCATAAAATAGGG + Intergenic
993954224 5:94213050-94213072 ATTTCCTTATCTATGAAATGGGG - Intronic
994001600 5:94787905-94787927 ATTTCCTCACCAATAAAATGGGG - Intronic
994165683 5:96605999-96606021 TTTCCCTCAAATATCAAATATGG + Intronic
994213706 5:97113549-97113571 ATTTCCTCACCTGCAAAATAAGG - Intronic
995037564 5:107552419-107552441 GTTTCCTCACCTATTAAATGAGG - Intronic
995575356 5:113525495-113525517 GTTTCTTCACCTGTGAAATAGGG - Intronic
996203676 5:120703814-120703836 ATTTCCTAATCCATGAAATAAGG + Intergenic
996351084 5:122542570-122542592 ATTCTCTCATCTGTAAAATAGGG + Intergenic
996383765 5:122888438-122888460 AGTTCCTCACCTATCAAATGAGG + Intronic
996523950 5:124457511-124457533 GCTTCCTCACCTGTGAAATAAGG + Intergenic
996760214 5:126979386-126979408 TTTTCCTCACCTATCAAATAAGG - Intronic
997148324 5:131463044-131463066 ATTTCCTCACCCATAAAATGAGG - Intronic
997639895 5:135442315-135442337 TTTCCCTCACCTATACAATGGGG - Intergenic
997724798 5:136111645-136111667 GTTTTCTCACCTGTGAAATAGGG + Intergenic
998198454 5:140097330-140097352 GTTTCCTCACTTATCAAATAAGG - Intergenic
998600126 5:143576775-143576797 ATTCCCAGACCCATGAAACAAGG + Intergenic
998606680 5:143642588-143642610 ATTCCCTCATTTATGAACTTGGG + Intergenic
998646210 5:144065082-144065104 ATTTCCTCACCTATAAAGTAGGG - Intergenic
998879344 5:146630894-146630916 ACTTACTCACCTATAAAATATGG - Intronic
998910516 5:146955030-146955052 ATTATCTCATCTATGAAAGAGGG - Intronic
998971014 5:147592698-147592720 ATCTCCTCATCTATAAAATAAGG + Intronic
999128670 5:149265949-149265971 ATTTCCTCATCTGTAAAATAAGG - Intergenic
999191141 5:149748259-149748281 GTTTCCTCACCTGTGAAATGGGG + Intronic
999227242 5:150036026-150036048 ATTTCCTCATCTGTGAAATGGGG - Intronic
999296674 5:150463945-150463967 GTTCCCTCATCTGTAAAATAGGG + Intergenic
999492580 5:152065850-152065872 ATTACCTCAACTATGTAATAAGG - Intergenic
999528871 5:152439472-152439494 TTTCCCTCATTTGTGAAATAGGG - Intergenic
999578648 5:153009562-153009584 ATTCCCTCATCTTTAAAATCAGG - Intergenic
999581027 5:153038096-153038118 ATTCTCTCATCTATGAAAAGAGG - Intergenic
999664377 5:153897500-153897522 ATTTCCTCATCTATGAAACAAGG + Intergenic
999690215 5:154139956-154139978 CAGTCCTCACCTATGAAATAGGG + Intronic
999943870 5:156574122-156574144 ATTTCCCCACCTATAAAGTATGG - Intronic
999985623 5:157002385-157002407 ATTTCTTCACCTATGGAATCTGG + Intergenic
1000020266 5:157312003-157312025 ATTTCCTCATCTGTGAAATGAGG + Intronic
1000025780 5:157358005-157358027 GTTCCCTCATCTGTGAAATGGGG + Intronic
1000273663 5:159711945-159711967 GTTTCCTCACCTATAAAATCAGG - Intergenic
1000305735 5:159992919-159992941 CTTCCCTCATCTATGCAAGAAGG + Intergenic
1000386206 5:160676851-160676873 GTTTCATCATCTATGAAATAGGG - Intronic
1000665017 5:163984291-163984313 GTTTCCTCATCTATGAAATGGGG - Intergenic
1000846847 5:166292386-166292408 ATTCACTCACCTCTGAAGGAGGG + Intergenic
1000962748 5:167619571-167619593 ATTCCCTCATCTGTAAAATGGGG + Intronic
1001298331 5:170515027-170515049 GTTTCCTCATCTATAAAATAGGG - Intronic
1001398676 5:171433993-171434015 GTTTCCTCACCTATAAAATAGGG - Intronic
1001580663 5:172796088-172796110 GTTTCCTCACCTATAAAATGGGG - Intergenic
1001664041 5:173417868-173417890 GTTTCCTCATCTATAAAATAGGG - Intergenic
1001877151 5:175211282-175211304 ATTTCCTCACCTATAAGATTTGG + Intergenic
1001967374 5:175920665-175920687 ATTTCCTCATCTATAAAATAGGG - Intronic
1002321663 5:178379948-178379970 GTTTCCTCATCTATAAAATAAGG - Intronic
1003515396 6:6813853-6813875 ATTCACTCACCTACGTAAGAGGG + Intergenic
1003543667 6:7040225-7040247 ATTCCTTCATCTGTAAAATAAGG + Intergenic
1003548111 6:7078201-7078223 ATTTTCTCACCTATCAAATGGGG + Intergenic
1003665645 6:8109003-8109025 ATTTCCTCATCTATAAAATGGGG - Intergenic
1003781666 6:9435010-9435032 ATTTCCTCACCTGTAAAATTGGG + Intergenic
1004240984 6:13921938-13921960 GTTTCCTTACCTATAAAATAGGG - Intergenic
1004880376 6:20001683-20001705 ATTCCCTTACCTATAACATGGGG - Intergenic
1005256347 6:24007429-24007451 GTTTTCTCACCTGTGAAATATGG - Intergenic
1005300313 6:24464265-24464287 ATTTCCTCACCTATAAAATTGGG - Intronic
1005622475 6:27632724-27632746 GTTCCCTGACCTATGGAATGAGG - Intergenic
1005840416 6:29741633-29741655 GTTTCCTCATCTATGAAATGGGG - Intergenic
1006946896 6:37790624-37790646 ATTCCCTCACCTAGAAAAATGGG + Intergenic
1007129001 6:39452039-39452061 GTTTCCTCATCCATGAAATAGGG + Intronic
1007138711 6:39549429-39549451 GTTTCCTCACCTATGACATGGGG - Intronic
1007489932 6:42212331-42212353 GTTTCCTCACATATGAAAGAGGG + Intronic
1007687867 6:43677725-43677747 ATTTCCTCATCTATAAAATGAGG + Intronic
1007811464 6:44489161-44489183 ATTTGCTCATCTGTGAAATAGGG - Intergenic
1007930296 6:45684932-45684954 ATTTCCTCTCCTATAAAATGGGG - Intergenic
1008031657 6:46702621-46702643 ATTTTCTCACCTATAAAATATGG - Intronic
1008919820 6:56831004-56831026 ATTTCCTTGCCTATAAAATAAGG + Intronic
1008927652 6:56904004-56904026 ATTTCCTCACCTATAAAATAAGG + Intronic
1008993021 6:57625952-57625974 TTTCTTTCACCTTTGAAATATGG + Intronic
1009181635 6:60525057-60525079 TTTCTTTCACCTTTGAAATATGG + Intergenic
1009285822 6:61815620-61815642 ATTCCATGACCTTGGAAATATGG + Intronic
1009298664 6:61987166-61987188 AATTCCTCACCTATAAAATGTGG + Intronic
1009498296 6:64377910-64377932 ATTTCCTCAGCTGTAAAATATGG + Intronic
1009588130 6:65632822-65632844 ATTTCTTCACCTATGGAACATGG - Intronic
1010121391 6:72379733-72379755 GTTTCCTCATCTATGAAATGGGG - Intronic
1010277598 6:73987986-73988008 ATTCCCCCACTTAGAAAATAGGG - Intergenic
1010969870 6:82251902-82251924 GTTTCCTCATCTCTGAAATAGGG + Intergenic
1011049940 6:83135071-83135093 ATTCCCTCACTTGTAAAATTAGG - Intronic
1011208820 6:84932252-84932274 ATTTCCTCATCTGTGAAATGGGG - Intergenic
1011472109 6:87718256-87718278 ATTTCCTTATCTTTGAAATAGGG + Intergenic
1011515844 6:88151908-88151930 ATTTCCTCATCTGTGAAATGGGG - Intronic
1011617194 6:89207968-89207990 GTTTCCTCAGCTGTGAAATAAGG + Intronic
1011638575 6:89398751-89398773 ATTTCTTCACCTGTGAAATGGGG - Intronic
1012354654 6:98298870-98298892 GTTTCCTCACCTATGAAAGGAGG - Intergenic
1013624747 6:111925940-111925962 ATTTCTTCACCTATAAAGTAAGG + Intergenic
1013937387 6:115614596-115614618 ATTACCTCTGCTATAAAATAAGG - Intergenic
1014388530 6:120831650-120831672 GTTCCCTCATATTTGAAATAGGG - Intergenic
1014398351 6:120954606-120954628 ATTCCCTCATCTATAAAATAGGG - Intergenic
1014791722 6:125680089-125680111 ATTTCCCCAGCTATGAAATGGGG - Intergenic
1014910322 6:127084753-127084775 ATGTCCTCACCTATAAAATGAGG - Intergenic
1015574996 6:134661843-134661865 ATTCCCTCATCTGTAAAATGGGG - Intergenic
1015619782 6:135118885-135118907 ATTCCCTCACCAGTGAAACAGGG + Intergenic
1015755653 6:136603496-136603518 GTTTCCTCATCTATAAAATAAGG - Intronic
1016358325 6:143241671-143241693 GTTCCCTCACCTATAAAATAGGG - Intronic
1016539402 6:145147221-145147243 ATTTCCTCACCTGTAAAATGTGG + Intergenic
1016642185 6:146361669-146361691 ATTCCCTCGTCTATAAAATGGGG - Intronic
1016731145 6:147429441-147429463 ATTTCTTCAGCTATAAAATAAGG + Intergenic
1017748925 6:157471809-157471831 ATTCCCTCCTCTATGAAGTGGGG + Intronic
1017849394 6:158290950-158290972 ATTTCCTCACCTATAAAATGTGG + Intronic
1017944348 6:159081521-159081543 ATTTCCTCACCTATGAAATACGG - Intergenic
1018270395 6:162071210-162071232 ATGCCCTCATCTGTGAAATGGGG + Intronic
1018642841 6:165920797-165920819 AATCCCTAACCCATGGAATATGG - Intronic
1018659130 6:166068759-166068781 CCTCCCTCACTTATTAAATAAGG + Intergenic
1019227148 6:170522735-170522757 GCTCCCTCACTTATGAAATGTGG - Intergenic
1019829708 7:3315328-3315350 ATTTCCTCAACTATAAAATAGGG - Intronic
1019896901 7:3989866-3989888 ATTCCCGTAGCTATGAAATGGGG - Intronic
1020576719 7:9941630-9941652 GTTTCCTCATCTATAAAATATGG - Intergenic
1020751422 7:12146364-12146386 CTTCCCTAACCTATGAAGTGAGG - Intergenic
1020960721 7:14798847-14798869 ATTCCCTGACCTATGGAATGAGG + Intronic
1020968851 7:14907415-14907437 GTTTTCTCACCTATGAAATGAGG + Intronic
1021105992 7:16640223-16640245 GTTTCCTTATCTATGAAATAAGG + Intronic
1021214892 7:17903535-17903557 ATTTCCTCACCTATGTCATGTGG + Intronic
1021271856 7:18598516-18598538 ATTCCCTCATCTGTCAAATGAGG + Intronic
1021285866 7:18780200-18780222 GTTCCTTCACCTATGAAGTAAGG + Intronic
1022038146 7:26553599-26553621 GTTCCCTCACCTGTGAAATGGGG + Intergenic
1022291694 7:29010884-29010906 ACCCCCTCACCTGTGAAATGGGG - Intronic
1022376298 7:29814650-29814672 ATTTCCTCATCTGTGAAATGGGG + Intronic
1022567136 7:31414855-31414877 ATTCCCTTACCTGTGAAGTGCGG - Intergenic
1023291721 7:38675149-38675171 TTTCACTAACCAATGAAATAAGG - Intergenic
1024441677 7:49426662-49426684 TTTCCCTTATCTGTGAAATAGGG + Intergenic
1024570029 7:50715615-50715637 ATTTCCTCACCAATAAAATCAGG + Intronic
1026148443 7:67768449-67768471 ATTTCCTCATCTGTAAAATAGGG - Intergenic
1026178291 7:68016809-68016831 ATTTTCTCACCTGTAAAATAGGG - Intergenic
1026286824 7:68970731-68970753 GTTCCCTCACCTGTAAAATGAGG + Intergenic
1026340431 7:69429900-69429922 ATCCCCTCCCCCATGAAATGAGG + Intergenic
1026494407 7:70890126-70890148 ATTCCCCTAACTATAAAATAAGG + Intergenic
1026512210 7:71037057-71037079 TTTCCCTCCCCTGTGAATTAGGG + Intergenic
1027453939 7:78363855-78363877 GTTTCCTTACCTATAAAATAGGG + Intronic
1028852804 7:95555104-95555126 ATTGCCTCACCTGTAAAATAGGG + Intergenic
1029184777 7:98730672-98730694 GTTCCCTCCTCTATGAAACAGGG + Intergenic
1029261449 7:99305474-99305496 ATTCCCTCATCTGGGAAATGGGG - Intergenic
1029349717 7:100004522-100004544 ACTCCCTCATCTGTAAAATAGGG - Intergenic
1029876946 7:103764334-103764356 ATTCTCTCATCTGTAAAATAGGG - Intronic
1030004944 7:105108675-105108697 ATTTCCTCATCTATAAAATGGGG + Intronic
1030176842 7:106662400-106662422 ATTTCCTCACCTGTTAAATAAGG - Intergenic
1030206273 7:106955208-106955230 ATTCCCTCAACTCTGAAAGCAGG + Intergenic
1030592145 7:111494643-111494665 ATTTCCTCATCTATAAAATGGGG + Intronic
1030860502 7:114618993-114619015 ATTCCTTTACCAGTGAAATAAGG - Intronic
1031073851 7:117193458-117193480 GTGCCCTCATCTATGTAATAGGG - Intronic
1031151085 7:118055240-118055262 TTTTCCTCATCTGTGAAATAAGG + Intergenic
1031455284 7:121971583-121971605 ATTTCCTCATCTGTAAAATAAGG + Intronic
1031561987 7:123249755-123249777 ATTTCTTCATCTATGAAATGGGG + Intergenic
1031962345 7:128001499-128001521 ATTGCCTCACCTATGTAAGGAGG + Intronic
1032730730 7:134640286-134640308 ATTTTCTCAACTATAAAATAAGG + Intergenic
1033215387 7:139489864-139489886 GTTTCCTCACCTGTGAAGTAGGG - Intergenic
1033308727 7:140243728-140243750 ATTTCCTCATCTATAAAATAGGG + Intergenic
1033340093 7:140485259-140485281 TCTCCCTCCCCTCTGAAATAAGG + Intergenic
1033403001 7:141045182-141045204 TTTTCCTCATCTATAAAATAAGG - Intergenic
1033441747 7:141386320-141386342 ATTCCCTGGACTCTGAAATATGG + Intronic
1033634112 7:143193131-143193153 ATTCTCTCATCTATAAAATGAGG + Intergenic
1033802258 7:144915049-144915071 ATTCCCTCATTTGTAAAATAAGG + Intergenic
1034218783 7:149428585-149428607 ATTTCCTCATCTGTCAAATAGGG - Intergenic
1034570270 7:151950203-151950225 GTTCCCTCACCTGTGTAAGAAGG + Intergenic
1034586055 7:152093295-152093317 ATTCCCTCACCTATAAAACAAGG - Intronic
1034830052 7:154301109-154301131 ATTTCCTCACCTGTAAAATGGGG + Intronic
1035005173 7:155652097-155652119 ATTTCCTCATCTATAAAATAAGG + Intronic
1035158406 7:156933261-156933283 GTTTCCTCACCCATGAAATGAGG - Intergenic
1036496964 8:9278396-9278418 ATTTCTTCACCTGTAAAATAAGG + Intergenic
1037133727 8:15438040-15438062 GTTTCCTCACCTGTGAAATGAGG + Intronic
1037263092 8:17029074-17029096 GTTTCCTCACCTGTGAAATGAGG + Intronic
1037348097 8:17921601-17921623 ATTGCCCCATCTATGAAATGAGG - Intergenic
1037558654 8:20052727-20052749 TTTCCCTTACCTATAAAATGAGG + Intergenic
1037694965 8:21215543-21215565 ATTTCCTTACCTGTAAAATAGGG + Intergenic
1037848237 8:22303749-22303771 TTTCCCCCACCAAGGAAATAAGG + Intronic
1038122556 8:24633942-24633964 ATTGCCTCATCTATAAAATATGG + Intergenic
1038437504 8:27546248-27546270 GTTCCCTCATCTATAAAAAAGGG + Intergenic
1038452247 8:27647266-27647288 GTTTCCTCACCTATCAAATCAGG + Intronic
1038486577 8:27939573-27939595 GTTTCCTTACCTATAAAATATGG - Intronic
1038650613 8:29399844-29399866 ATTTCCTCATCCATGAAATAAGG - Intergenic
1039120764 8:34143805-34143827 ATTTCCTCATTTATCAAATAAGG + Intergenic
1039347564 8:36724708-36724730 GTTTCATCACCTTTGAAATAAGG - Intergenic
1039660247 8:39453622-39453644 ATTTCCTCATCTCTAAAATATGG + Intergenic
1040514936 8:48126906-48126928 CTTCCCTAACCAAGGAAATAAGG - Intergenic
1040545335 8:48394476-48394498 TTTCCCTCACCTGTGGAATGGGG + Intergenic
1040998454 8:53425445-53425467 GTTTCCTCATCTATGAAATGGGG + Intergenic
1041082542 8:54227174-54227196 CTTCCTCCACCTATGGAATAGGG - Intergenic
1041465333 8:58152655-58152677 ATTCCCTCACCTGGAAAATGGGG + Intronic
1042413771 8:68495488-68495510 ATTTCCTCACCTGTCAAATGTGG - Intronic
1042656566 8:71104689-71104711 ATTTCCATACCTATGAAATGAGG + Intergenic
1042703723 8:71644483-71644505 ATTTCCTTACCTATAAAATGAGG + Intergenic
1042738025 8:72010682-72010704 ATTTCCTCATCTATAAAATAGGG + Intronic
1042814372 8:72862620-72862642 GTTTCCTCACCTATGAAAAGGGG + Intronic
1042842598 8:73138996-73139018 ATTTCCTCATCTATAAAATGGGG + Intergenic
1042957576 8:74268069-74268091 ATTTCCTCACCTGTAAAATAGGG + Intronic
1043693100 8:83181970-83181992 TTTCCAGCATCTATGAAATATGG + Intergenic
1044233064 8:89801181-89801203 CTTCCCTCCCCTATGAAAAAGGG + Intergenic
1044276346 8:90304055-90304077 ATACCCTCCCCATTGAAATATGG + Intergenic
1044477634 8:92646788-92646810 ATTCACCCACCTATAAAATGAGG + Intergenic
1044750989 8:95415289-95415311 ATTTCCTCACCTATAAGATACGG - Intergenic
1044883210 8:96745577-96745599 TTTTTCTCACCTATGAAATAAGG - Intronic
1045015752 8:98000288-98000310 AATTCCTCAGCTTTGAAATATGG + Intronic
1045329025 8:101139619-101139641 ATTTCCTCACCTGTAAAATAGGG - Intergenic
1045641441 8:104255935-104255957 ATTTCCTCACCTGGAAAATATGG + Intronic
1045756963 8:105555343-105555365 ATTACCTCATCTATAGAATACGG - Intronic
1046089368 8:109480927-109480949 GTTTTCTCACCTGTGAAATAAGG + Intronic
1046155102 8:110278563-110278585 ATTTCCTCTTCTCTGAAATATGG + Intergenic
1046586817 8:116157827-116157849 ATTTCCTCATCTGTGAAATCAGG - Intergenic
1046593721 8:116236093-116236115 GTTTCCTCACCTATGAAATGGGG - Intergenic
1046889133 8:119401688-119401710 ATTTCCTCATCTGTAAAATATGG - Intergenic
1047071577 8:121350056-121350078 GTTTCCTCACCTGAGAAATAGGG + Intergenic
1047322280 8:123798192-123798214 CTCCCCTCACCAATGAAATCCGG + Exonic
1047823962 8:128552837-128552859 ATTTCCTCATCTGTTAAATATGG - Intergenic
1047862922 8:128988714-128988736 AATCGCTCACCTATGACATCAGG - Intergenic
1047922523 8:129650248-129650270 ATTTCCTCAACTATAAAATAGGG + Intergenic
1047956645 8:129981663-129981685 ATTCCCTCACCTATAAAATCAGG - Intronic
1048173552 8:132130932-132130954 ATATCCTCACCTGTAAAATAGGG - Intronic
1048413880 8:134204832-134204854 AATCCATCACCTAGGTAATAAGG + Intergenic
1048563997 8:135574931-135574953 GTTTCCTCAACTATGAAATGAGG - Intronic
1050012377 9:1198066-1198088 ATTTCCTCATCTTTAAAATAGGG - Intergenic
1050276768 9:4008825-4008847 ATTTCCTCACCTATAAAAGGTGG - Intronic
1050602392 9:7266146-7266168 TTTTCCTCATCTATTAAATAAGG + Intergenic
1050664609 9:7921342-7921364 GTTTCCTCACCTATAAATTAGGG - Intergenic
1051161412 9:14212841-14212863 ATTTCCTTATCTATGAAATGGGG - Intronic
1051228914 9:14933222-14933244 ATTTCCTCACCTGTAAAATCAGG - Intergenic
1051572556 9:18576872-18576894 GTTTCCTCATCTGTGAAATAAGG - Intronic
1051714515 9:19968057-19968079 GTTTCCCCACCTATAAAATAGGG + Intergenic
1052870057 9:33496464-33496486 ACTCCCTCTTCTCTGAAATACGG - Intergenic
1053143970 9:35699508-35699530 CTACCCTGATCTATGAAATAGGG + Intronic
1053295934 9:36912895-36912917 ATTTCCCTATCTATGAAATAGGG - Intronic
1053452334 9:38203439-38203461 ATTTTCTCATCTATGAAATGGGG + Intergenic
1053754830 9:41295308-41295330 AATATCTCTCCTATGAAATAAGG + Intergenic
1054260354 9:62859606-62859628 AATATCTCTCCTATGAAATAAGG + Intergenic
1054331418 9:63760387-63760409 AATATCTCTCCTATGAAATAAGG - Intergenic
1054737647 9:68771574-68771596 TTTCCCTTATCTATAAAATAAGG + Intronic
1054943862 9:70773333-70773355 ATTTCCTCATTTATAAAATAGGG + Intronic
1055335772 9:75231863-75231885 GTTTCCTCATCTATAAAATAGGG + Intergenic
1055765530 9:79659104-79659126 CTTTCCTCATGTATGAAATAAGG - Intronic
1055874759 9:80928577-80928599 ATCTTCTCACCTATGAAATAGGG - Intergenic
1056109651 9:83382461-83382483 ATTTCTTCATCTATTAAATAAGG - Intronic
1056527652 9:87458143-87458165 GTTTCCTCACTTATGAAATAAGG - Intergenic
1056991738 9:91419636-91419658 ATTTCCTCATCTATGAAATGTGG + Intronic
1057497635 9:95573433-95573455 ATTCCCTCTTCTGTAAAATATGG - Intergenic
1057765346 9:97912101-97912123 GTTTCCTCACCTATGAGATGAGG + Intronic
1057885432 9:98826159-98826181 GTGCCCTCATCTGTGAAATAGGG + Intronic
1057979064 9:99639886-99639908 ATTTCCTTACCTGTAAAATAGGG + Intergenic
1058160628 9:101566585-101566607 ATTTCCTCACTTCTAAAATAAGG - Intergenic
1058476324 9:105337322-105337344 GTTTCCACATCTATGAAATAGGG + Intronic
1058681990 9:107448126-107448148 ATTTCCTCATGTATCAAATAGGG - Intergenic
1058749595 9:108026225-108026247 ATTCCCTCATCTCTGAAATGGGG - Intergenic
1058872560 9:109215185-109215207 ATTTTCTCATCCATGAAATAGGG - Intronic
1059038199 9:110782567-110782589 ATTCCCTCACATGTTATATATGG + Intronic
1059420487 9:114187465-114187487 ATTCCCTCATCTGTAAAATGGGG - Intronic
1059427228 9:114228627-114228649 GTTTCCTCATCTATGAAATGGGG + Intronic
1059471702 9:114509838-114509860 ATTCCCTTACCTCTAAAACAAGG + Intergenic
1059658439 9:116377797-116377819 ATTCCATCATCTGTAAAATAAGG - Intronic
1059738227 9:117123446-117123468 ATTTTCTCACCTGTAAAATATGG + Intronic
1059890594 9:118797674-118797696 ATTCCCTCACCTGCAAAATGAGG - Intergenic
1059975571 9:119713212-119713234 ATTACCTCACCCTTGCAATAAGG + Intergenic
1060060935 9:120458883-120458905 GTTTCCTCACCTATAAAATGGGG + Intronic
1060093022 9:120761447-120761469 ATTCCCTTACCTATGCGCTAAGG + Exonic
1060201998 9:121656778-121656800 GTCTCCTCACCTATGAAATGAGG - Intronic
1060417542 9:123443083-123443105 ATTTCCTCACCTATAAAAGCAGG - Intronic
1060719770 9:125969122-125969144 GTTTCCTCACCTATGAAGTGAGG - Intergenic
1060734682 9:126059428-126059450 ATGTCCTCACCTGTTAAATAGGG + Intergenic
1060799759 9:126536228-126536250 GTTTCCTCACCTGTGAAATGGGG - Intergenic
1060881464 9:127121099-127121121 GTTTCCTCACCTATAAAACAGGG + Intronic
1061249205 9:129416647-129416669 GTTTCCTCATCCATGAAATAGGG + Intergenic
1061418935 9:130462931-130462953 CTTTCCTCACCCATAAAATATGG + Intronic
1061747202 9:132749265-132749287 GTTCCCACACCTATCAAATAGGG - Intronic
1062101174 9:134729246-134729268 ATCCCCTCACCTCTGAAATTGGG + Intronic
1202798790 9_KI270719v1_random:153310-153332 AATATCTCTCCTATGAAATAAGG - Intergenic
1185718736 X:2365041-2365063 ATTTCCTCATTTATGAAATTGGG + Intronic
1186067845 X:5785624-5785646 GTTTCCTCAGCTATAAAATAGGG + Intergenic
1186444154 X:9611830-9611852 GTTCCCTCACATATAAAATGGGG - Intronic
1186525836 X:10247506-10247528 ATTTTCTCATCTATAAAATATGG + Intergenic
1186614554 X:11173048-11173070 CTTCCCTCGTCTATAAAATAGGG - Intronic
1186623258 X:11263838-11263860 TTTTCCTCATCTATGAAATGGGG + Intronic
1187144223 X:16622889-16622911 GTTTCCTCATCTATAAAATAGGG + Intronic
1187260801 X:17683560-17683582 ATTTCCTTATCTATAAAATAGGG + Intronic
1187528823 X:20078310-20078332 ATTTCCTCATCTATAAAATGGGG - Intronic
1187582335 X:20621429-20621451 CTTCCTTAACCTATGAAATGAGG + Intergenic
1188788034 X:34373162-34373184 GTTACCTCACTTATGTAATAAGG - Intergenic
1189233602 X:39471088-39471110 ATTCCCTCATCTGTAAAACAGGG + Intergenic
1189564805 X:42230662-42230684 ATTTCCTCATCTATAAAATGGGG + Intergenic
1189599135 X:42602904-42602926 TTTCCTTGGCCTATGAAATAAGG + Intergenic
1189843422 X:45107048-45107070 ATTTCCTCATCCGTGAAATAAGG - Intronic
1190481055 X:50877342-50877364 ATTTCCTCATCTATAAAACAAGG - Intergenic
1190481210 X:50878672-50878694 ATTTCCTCATTTATAAAATAGGG - Intergenic
1191672335 X:63759795-63759817 GTTTCCTCATCTATAAAATAAGG - Intronic
1192183890 X:68933142-68933164 GTTTCCTCACCTATCAAACAGGG + Intergenic
1192320974 X:70090571-70090593 GTTTCCTCACCTGTGAAATAGGG - Intergenic
1193882309 X:86937707-86937729 ATTTTCTCACCTGGGAAATATGG + Intergenic
1194054538 X:89115821-89115843 ATTTCCTCAACCATAAAATAAGG + Intergenic
1194671414 X:96737980-96738002 GTTTCCTCATCTCTGAAATAGGG - Intronic
1194806725 X:98338224-98338246 ATTTCCTCATCTGTGAAATAGGG + Intergenic
1195388016 X:104331787-104331809 ATTTCCTCATCTATAAAATAAGG + Intergenic
1195484974 X:105393881-105393903 GTTTCCTCACTTATGAAATAGGG - Intronic
1195725933 X:107916793-107916815 GTTCCCTCATCTATAAAATAGGG - Intronic
1195894895 X:109735494-109735516 ATTTCTTCATCTGTGAAATAGGG - Intergenic
1195899741 X:109785272-109785294 CCTCCCTCACCTCTGAATTAGGG + Intergenic
1195989378 X:110667571-110667593 GTTCCCTCATCTGTAAAATAAGG - Intergenic
1196013796 X:110916070-110916092 GTTTCCTCACCTATAAAATCAGG - Intergenic
1196018467 X:110964711-110964733 TTTCCCTCACAAATGAAAAATGG + Intronic
1196197038 X:112847352-112847374 ATTCCCTCATCTGTAAAATAGGG + Intergenic
1196224055 X:113144708-113144730 ATTTCCCCACCTATAAAATAAGG + Intergenic
1196306092 X:114104947-114104969 GTTTCCTCATCTATGAAACAGGG - Intergenic
1197256277 X:124266945-124266967 ATTCCATCACCTCAGAAAGAAGG + Intronic
1197327180 X:125108371-125108393 GTTTCCTCACTTATTAAATAGGG + Intergenic
1197503496 X:127271878-127271900 ATTCCCTCACCTATAAAATGAGG - Intergenic
1197635156 X:128906171-128906193 CTTCCCTCATCTGTGAGATATGG - Intergenic
1197669994 X:129266143-129266165 ACTCCCCTACCTATGAAAAATGG + Intergenic
1197752362 X:129974137-129974159 ATTCCCTCATTTGTGAAATGGGG - Intergenic
1197762095 X:130035239-130035261 ATTTTCTCACCTATAAAATGGGG - Intronic
1197887170 X:131230734-131230756 GTTTCCTCATCTATAAAATAGGG - Intergenic
1197975984 X:132166417-132166439 GTTCTCTCACCTGTAAAATAGGG + Intergenic
1198026498 X:132712717-132712739 ATTTCCTCACCTAGAAAATGGGG + Intronic
1198231464 X:134693502-134693524 ATTTCCTCACTAATAAAATAAGG - Intronic
1198503706 X:137280364-137280386 ATTGCCTCATCTATAAAATAGGG + Intergenic
1198740175 X:139833845-139833867 ATTTCCTTATCTATAAAATAAGG + Intronic
1198800404 X:140442056-140442078 ATTTCCTCACCTGTAAAATTGGG + Intergenic
1199295867 X:146158043-146158065 ATTTTCCCACCTATAAAATAAGG + Intergenic
1199312965 X:146343205-146343227 ATTCCCTTCCCTATAAAATGGGG - Intergenic
1199497079 X:148464502-148464524 AGTGCCTCACCTATGAAGTGGGG - Intergenic
1199544086 X:148988860-148988882 GTTTCCTCATGTATGAAATAAGG - Intronic
1199741343 X:150739248-150739270 ATTCCCTCCTCTCTGAAATGGGG + Intronic
1199759488 X:150894385-150894407 GTTTCCTCATCTGTGAAATAGGG - Intronic
1200757196 Y:7001063-7001085 GTTCCCTCACTTATAAAATGGGG - Intronic
1201468232 Y:14308752-14308774 ATTGGCTGACCTTTGAAATAAGG + Intergenic