ID: 1098613048

View in Genome Browser
Species Human (GRCh38)
Location 12:72485580-72485602
Sequence CCTCACCTGTAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1038
Summary {0: 1, 1: 4, 2: 50, 3: 244, 4: 739}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098613048_1098613055 -5 Left 1098613048 12:72485580-72485602 CCCTCCCCATTCTACAGGTGAGG 0: 1
1: 4
2: 50
3: 244
4: 739
Right 1098613055 12:72485598-72485620 TGAGGCAGCATCCTGTCCCTGGG 0: 1
1: 0
2: 5
3: 27
4: 239
1098613048_1098613054 -6 Left 1098613048 12:72485580-72485602 CCCTCCCCATTCTACAGGTGAGG 0: 1
1: 4
2: 50
3: 244
4: 739
Right 1098613054 12:72485597-72485619 GTGAGGCAGCATCCTGTCCCTGG 0: 1
1: 0
2: 3
3: 27
4: 263
1098613048_1098613058 10 Left 1098613048 12:72485580-72485602 CCCTCCCCATTCTACAGGTGAGG 0: 1
1: 4
2: 50
3: 244
4: 739
Right 1098613058 12:72485613-72485635 TCCCTGGGGAGCCAAGTCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 233
1098613048_1098613056 -4 Left 1098613048 12:72485580-72485602 CCCTCCCCATTCTACAGGTGAGG 0: 1
1: 4
2: 50
3: 244
4: 739
Right 1098613056 12:72485599-72485621 GAGGCAGCATCCTGTCCCTGGGG 0: 1
1: 1
2: 2
3: 33
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098613048 Original CRISPR CCTCACCTGTAGAATGGGGA GGG (reversed) Intronic
900168677 1:1255609-1255631 CCTCACCTGTGAGATGGGGTCGG - Intronic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
901241598 1:7697334-7697356 CCTCGTCAATAGAATGGGGATGG - Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902232985 1:15040076-15040098 TCCCACCTGTAAAATGGGGCTGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902617284 1:17630691-17630713 CCTCACCTGGGCAATGGGGATGG + Intronic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902685925 1:18077632-18077654 CTTCATCGCTAGAATGGGGATGG + Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902936906 1:19771027-19771049 CCTCAACTATGAAATGGGGATGG + Intronic
903000900 1:20264992-20265014 TCTAACCTGTAAAGTGGGGATGG + Intergenic
903029718 1:20454993-20455015 CCTCCCCTGTGGAATGGGAATGG + Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903168975 1:21540509-21540531 CCTCACCTGTAAAATGGAGCTGG + Intronic
903177501 1:21589817-21589839 CCCCATCTGTACAATGGGCAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903481591 1:23657401-23657423 CCCCACCTGTAAAATGGAAATGG + Intergenic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903570018 1:24297439-24297461 CCTCACCTTGAGCAAGGGGAGGG + Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903882646 1:26522053-26522075 CCTCATCTGAGGAATGGGAATGG - Intergenic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904028654 1:27520524-27520546 CCTCACCTTTAGTTTGGGGTGGG - Intergenic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904819254 1:33230185-33230207 CCTCACTTGTAAACTGGGAATGG + Intergenic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904899407 1:33844700-33844722 CCTCAACTGTAAAATGGGACGGG + Intronic
904918366 1:33986432-33986454 CTTCAGCTGTAAAATGGGCATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
905458683 1:38106559-38106581 AGTCACCTGTAAACTGGGGATGG + Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
906475026 1:46163815-46163837 CCTCAGCTGTAAAATAGAGACGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907550492 1:55300881-55300903 CCTCAGCTGTAGAATCCTGATGG - Intergenic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907912692 1:58840699-58840721 CCTCACCTGAAGAATGATGGGGG + Intergenic
908029826 1:59987416-59987438 TCTCACCTGTACAATGGGCATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909761473 1:79293035-79293057 CCTAACCTGTTGAATGGTGATGG - Intergenic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910724506 1:90324366-90324388 CCTCACATATAAAATGGTGATGG - Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911054708 1:93699973-93699995 CCTTACCTGTAAAATGGGGTGGG - Intronic
911068820 1:93815601-93815623 CCTCCCCAGAAGAATGGGGAGGG + Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912556555 1:110520423-110520445 CCTCAGTTGTGGAATGAGGAAGG + Intergenic
912598602 1:110904036-110904058 CCTCTCCTTTGGAAAGGGGAGGG + Intergenic
912692359 1:111813807-111813829 CCTCATCTATATAATGGGAAAGG - Intronic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
915320428 1:155053118-155053140 ACTCAGCTTTAGAATGGGGTGGG - Intronic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
917529083 1:175817137-175817159 CTTCAACTGTAGAATAGGAATGG + Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918286147 1:183056657-183056679 CCTCACCTGTATAATGAGCGTGG - Intronic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918703039 1:187629567-187629589 CCTTTACTGAAGAATGGGGATGG + Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920977851 1:210802700-210802722 TCCCACCTGTAAAATGGAGAGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
922053166 1:222014440-222014462 CTTTACCTGTAAAATGGAGAGGG - Intergenic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
923220648 1:231889578-231889600 CCTCAACTGTAAAACTGGGAAGG - Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923719696 1:236456320-236456342 ACTCACCTCTAGTAAGGGGATGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
924681177 1:246235712-246235734 CCTCTCCTCTAGGAAGGGGAGGG + Intronic
1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG + Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1063613864 10:7585697-7585719 CTTCACTTGTAGACTGGGAAAGG + Intronic
1064220096 10:13432932-13432954 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1064562220 10:16604654-16604676 CCCCACCTGTCAAATGGGAATGG - Intronic
1065263655 10:23952665-23952687 CCTAACCTGTAAAATGGGAATGG + Intronic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1067258230 10:44663849-44663871 GGAAACCTGTAGAATGGGGAAGG + Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067509558 10:46883893-46883915 CCTCCCCTGTAGAATTGGACTGG - Intergenic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067652696 10:48167966-48167988 CCTCCCCTGTAGAATTGGACTGG + Intronic
1067844899 10:49711829-49711851 TCTCACCTATAAAATGGGGGTGG + Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069338560 10:67383387-67383409 CCTCAGCTGTAAGATGGGTATGG - Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070471245 10:76781788-76781810 CCTCACTGGTAAAATGGGCATGG + Intergenic
1070653653 10:78255818-78255840 CCTTACCTGTGAAACGGGGATGG + Intergenic
1070678539 10:78432974-78432996 CCTCAGCTGTAGAATGAGTCAGG - Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070773824 10:79098446-79098468 CCTCACCTGTAAAATGGAGGTGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073471681 10:103726380-103726402 CCTCACCCGTAGTATGGGGATGG - Intronic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1073919596 10:108443614-108443636 TCTCACCTGTAGAATGGCCATGG + Intergenic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078422839 11:11226281-11226303 CCTCAGCTGTAAAATGGGTTTGG + Intergenic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078605821 11:12774643-12774665 CATCACCAGTAGAATGGGGCTGG + Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080685084 11:34508749-34508771 CCTCAACTGTAAAATGGTGGAGG - Intronic
1080692353 11:34568810-34568832 CCTCCCCTGTAAAATGGGCAGGG + Intergenic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083190992 11:61052464-61052486 CCAAACCTGTGGAATGGGGTGGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275884 11:61596876-61596898 CTCCACCTGTAAAATGGAGATGG - Intergenic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083879527 11:65541125-65541147 CCTGAGCTGTAGACTGGGCAGGG + Exonic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1085130255 11:74032168-74032190 CTTCACCTGTAAAATGGAGGCGG - Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085585165 11:77695970-77695992 CCTAACCTGTACCATGGGGGTGG + Intronic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086156795 11:83676105-83676127 CCTAAGCTTTAGAATGGGGCTGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086338306 11:85822104-85822126 CCTCACTTGTAAAATGGGAGTGG - Intergenic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1087549195 11:99625713-99625735 CCTCACCTGAAGAAAAGTGATGG - Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088717530 11:112561824-112561846 CATCAGCAGTGGAATGGGGAAGG - Intergenic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090163261 11:124517806-124517828 CCTCATGTGTCGAATGGTGATGG - Intergenic
1090487455 11:127126822-127126844 CCTCATCTGTAGTATAGGGCTGG + Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091782648 12:3223667-3223689 CCTCACCTATAAAATGGGAAGGG + Intronic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092172589 12:6383379-6383401 CCTCACCTTAAGCATGGAGAGGG - Intronic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1093302984 12:17477465-17477487 CCTTTCCTGAAGAATGAGGACGG - Intergenic
1093358900 12:18200439-18200461 CCTTTCCTGAAGATTGGGGATGG - Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1096914641 12:55017966-55017988 ACACCCCTGAAGAATGGGGAGGG - Intergenic
1097263262 12:57731550-57731572 ACTCACCTGTTTGATGGGGATGG + Exonic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100803941 12:98261650-98261672 AATCCCCTGTAGAATGGGGAGGG + Intergenic
1100882031 12:99029875-99029897 CCTCTGCTGTAAAATGGGAATGG + Intronic
1100883167 12:99040627-99040649 CTTAACCTGTAAAATGGGAATGG + Intronic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101291727 12:103377425-103377447 CCTCACCGTCAGAATGGGAAAGG + Intronic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101411298 12:104470718-104470740 CCTCACCTGTATAATGGGATTGG - Intronic
1101750207 12:107577269-107577291 CTTCACCTGTAAAGTGGGGTGGG - Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1103159029 12:118712169-118712191 CCTCACCTGTAAAATAGAGATGG + Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104831681 12:131756729-131756751 CCTCACCTGCAGGCTGGGGTGGG + Intronic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1105915288 13:24909784-24909806 GCTCACCTGTAGGATGGTTACGG + Exonic
1107164048 13:37264981-37265003 CCTTACTTCAAGAATGGGGAGGG + Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107540604 13:41385683-41385705 CCTCGCCTGTAGCGTGAGGAGGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108140481 13:47415982-47416004 CCCCACCTGTGAAAGGGGGAGGG - Intergenic
1108611731 13:52090466-52090488 CCTCAGCTGTAAAGTGGGCATGG + Intronic
1108983618 13:56553894-56553916 CCTCACCTGTAGATTGGGTAAGG + Intergenic
1110167436 13:72460324-72460346 CTTGGTCTGTAGAATGGGGAGGG + Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111192617 13:84830456-84830478 TTTCACCTGAAGAATGGTGAGGG + Intergenic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112579952 13:100669909-100669931 CCTCAACACTAAAATGGGGATGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114634163 14:24178074-24178096 CCTCCTCTGTTGAGTGGGGAGGG - Exonic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116835630 14:49767388-49767410 CCTCACCTGTAAAATAGGGTGGG - Intergenic
1117090738 14:52247604-52247626 CCTCACCTGTTAAATGGAAAGGG - Intergenic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118314148 14:64715514-64715536 CCTGACCTGTAAAATAGGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119726585 14:76925118-76925140 CCCCACCTGTGAAATGGGGTCGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120598219 14:86467052-86467074 CAGCACTTGTTGAATGGGGATGG + Intergenic
1120674614 14:87406452-87406474 CCTCACCTGTAAAGTGAGCACGG + Intergenic
1120780324 14:88480524-88480546 CCTCATCTATAGGATGGGCATGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121259685 14:92557242-92557264 CCTCATCTATACAATGGGCAAGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121563049 14:94888227-94888249 CCTGACCTGTACAATGAGCATGG + Intergenic
1121570835 14:94945400-94945422 CCTCACCTGATAAACGGGGATGG + Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122104969 14:99446144-99446166 CCTCACTTATAAAATGGGGACGG + Intronic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122546877 14:102527950-102527972 CCTGCCCTGTGGGATGGGGAGGG + Intergenic
1122836942 14:104435108-104435130 CCAGACCTGCAGAATGGGAAAGG + Intergenic
1122960262 14:105090951-105090973 CCCCACCTGTACAGTGGGGGTGG + Intergenic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1123882139 15:24686552-24686574 CCTCTCCTGAAGACTGAGGACGG + Intergenic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127631935 15:60835627-60835649 CTTCACCTGTAAAATAGAGATGG - Intronic
1127675427 15:61233550-61233572 CCTCACCTATAAAATGGGCATGG - Intergenic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1127857316 15:62963127-62963149 CCTCACCTGGAGCCTGAGGATGG - Intergenic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128691966 15:69731455-69731477 CATCAACTGTAAATTGGGGAGGG + Intergenic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129687121 15:77692858-77692880 CTCCACCTGTGGAATGGGGCTGG - Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1129750134 15:78056890-78056912 GCTCACCTGTGGCATGGGGATGG - Intronic
1129835459 15:78702717-78702739 CTCCTCCTGTGGAATGGGGAAGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1132564180 16:613189-613211 CCTCACCTGTAGAATCAGCAGGG + Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133815502 16:9194485-9194507 CCTCACCTGTAAAATGGTTGTGG - Intergenic
1133826978 16:9286869-9286891 CCTCAGCTGTAAAATGGAAATGG - Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134838586 16:17382854-17382876 CCTCACCTGGGTAATGGGGATGG - Intronic
1134874683 16:17687346-17687368 CATCACCTGTAAACTGGGTATGG - Intergenic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1136043847 16:27600598-27600620 GCTCACCAGGAGAATGGGGGAGG - Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1136928256 16:34395343-34395365 TCTCACCTGTGAAGTGGGGATGG - Intergenic
1136976318 16:35016461-35016483 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138131681 16:54485154-54485176 CCTCGTCTGTAGAATGGATATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140259886 16:73368845-73368867 CCTTACCAGTAAAATGGGGCTGG - Intergenic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140443323 16:75003493-75003515 CCTTACCTGCACAATGGGGGTGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141746927 16:85932062-85932084 CCTCACCTGGCAAATGGGGTGGG + Intergenic
1141760838 16:86027441-86027463 GCTCATCTGTAGTACGGGGAGGG - Intergenic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1143048853 17:4105488-4105510 CCTGACCTGAAGAATTGGGAAGG - Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146380265 17:32322714-32322736 TCTCACCTGTGTAATGGGGTGGG - Exonic
1146582503 17:34051428-34051450 CCTCACCTGTAAAATTGGATTGG + Intronic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147210799 17:38871353-38871375 CCTCCCCTCCAGACTGGGGAGGG - Intronic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1148336802 17:46847540-46847562 GGTCACCTGGAGGATGGGGAAGG + Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148804767 17:50258655-50258677 CCTCACCTGTAAAATGGGATGGG - Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1150625245 17:66837067-66837089 CCTCACCTGTAAGATGGGTCTGG + Intronic
1150630080 17:66874164-66874186 GCTCACCTGTAAAATGGGTGTGG + Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1153415527 18:4841746-4841768 CCTTACCAGTAAAATGAGGATGG + Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156611375 18:38729083-38729105 CCTGACCTGAAGAATGGAGCAGG - Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157396701 18:47347496-47347518 CCTCATCTTTATAATGGGAAGGG - Intergenic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1157978528 18:52353516-52353538 CCTCGCCTTTTGATTGGGGATGG + Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158451384 18:57568970-57568992 CCTCAGCTAGAAAATGGGGATGG - Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159464248 18:68760060-68760082 TCACACCTGTAGAATGGAGAAGG - Intronic
1159931515 18:74316572-74316594 CCTCACGTGTAGAATTGCGTAGG + Intronic
1160044185 18:75371492-75371514 CCTCATCTGTGGGATGGGAATGG + Intergenic
1160428010 18:78791589-78791611 CCTCACTTGTGGAATGGGAGTGG - Intergenic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1160565737 18:79785758-79785780 CCTCACCTGTGCAATGAGAAGGG + Intergenic
1160838754 19:1136977-1136999 CAGCACCTGGGGAATGGGGATGG + Intronic
1160848537 19:1178075-1178097 TCCCACCTATAAAATGGGGAGGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1161668255 19:5590029-5590051 CCCCAGCTCAAGAATGGGGATGG + Intronic
1161772813 19:6240489-6240511 CCTCACCTGTGAAGTGGGAAAGG + Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162340985 19:10091498-10091520 CCGCACCCGTAGCAGGGGGACGG - Exonic
1162472199 19:10879104-10879126 CCTCACCTTAAGAATGGTGGAGG - Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1165822663 19:38686440-38686462 CTTCACCTGGAGAACAGGGAGGG - Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166195383 19:41202433-41202455 CCTCACCTAGGAAATGGGGATGG + Intronic
1166545244 19:43630585-43630607 TCTCACCTATAAAATGGGAATGG - Intronic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167659828 19:50790176-50790198 CCCCATCGGTACAATGGGGATGG + Intergenic
1167685507 19:50953201-50953223 CCTGGCCCGGAGAATGGGGAGGG + Intergenic
1168025605 19:53641305-53641327 CCTCACCTGATGAATGGGCGGGG + Intergenic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168650302 19:58088193-58088215 GCCCACCTCTAGGATGGGGATGG + Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
925863674 2:8204053-8204075 CCTCAGCTGTAGAACAGGCATGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927709463 2:25315627-25315649 CGTCACCTGTAAACTGGGCACGG - Intronic
927890266 2:26743741-26743763 CCTCACCTGTAAGTTGGGCATGG - Intergenic
928101371 2:28439501-28439523 CCTGGCCTGTGGGATGGGGAAGG - Intergenic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928540188 2:32277515-32277537 CCTCACCTGTAAGATGAAGAGGG - Intergenic
928649379 2:33388469-33388491 CCTCACTGGTAAAATGGAGATGG + Intronic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929538857 2:42804220-42804242 CCTCTGCTGAGGAATGGGGAGGG - Intergenic
929870942 2:45758867-45758889 CCTCACCTGTAAAGTGCAGAGGG + Intronic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931460027 2:62442558-62442580 CCTCACTTGTAGGATGGAGAAGG + Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933536260 2:83578649-83578671 CCACATCTGAAGAATGGGCAAGG + Intergenic
933851171 2:86367850-86367872 CCTCACCTGTAAAACAGGGATGG + Intergenic
934696542 2:96404550-96404572 CCTCACCTTTAGGCTGGGGAAGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937275572 2:120681855-120681877 CCTGAGCTGTAGAGTGGGGTTGG - Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
940419120 2:153457907-153457929 CCTCACCAACAGGATGGGGAGGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940899523 2:159113654-159113676 TCTCACCTGGAGAATAGAGAAGG + Intronic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
941049853 2:160720678-160720700 CCCCACCTGTAAAATGGAGATGG + Intergenic
941279563 2:163533324-163533346 CCTCACCTTTAAAATGGTGGTGG - Intergenic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942368891 2:175259336-175259358 CCTTACCTGTAAAATGGGAATGG - Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944621236 2:201517737-201517759 CCTCACTTGTAAAATGGAAATGG - Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945058389 2:205887878-205887900 CCTGATCTGTGGAATGGGGGTGG - Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
947385165 2:229584273-229584295 CCTCACCTGGAGGATGGGGTAGG - Intronic
947454099 2:230237362-230237384 CCTAACCTACAGAATGGTGAAGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948158792 2:235807315-235807337 GCTCACCTGTTTAATTGGGATGG - Exonic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
948981521 2:241497143-241497165 CCCCACCTGGAGCCTGGGGAGGG - Intronic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170683440 20:18547267-18547289 CCTCACCTGTAAACTAGGGATGG + Intronic
1171387800 20:24781851-24781873 CCTCACCTGTGTAATGAGGGTGG - Intergenic
1171490986 20:25516975-25516997 CCTCATCTGAATAATGGGTATGG + Intronic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172294950 20:33802931-33802953 CCTCAACTGTAAAATGGAGGTGG + Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173547065 20:43905965-43905987 CCTGACCTGTAAACTGGGGATGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173795130 20:45854596-45854618 CTTCAGCTGTAAAATGGAGAAGG - Intronic
1173852795 20:46229294-46229316 CCTCAGCTGTAAAATTGGGGGGG - Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174484408 20:50852104-50852126 CCTCACCTGAAGAGTCGGAATGG - Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1175142305 20:56870089-56870111 CCTCACCCCTGCAATGGGGAAGG - Intergenic
1175216400 20:57393594-57393616 CCTCACCCGTAAAATGGGAGTGG + Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175969647 20:62677960-62677982 CCACACCTGCAGATTTGGGAAGG + Intronic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176795000 21:13365325-13365347 CCTCACCTGTAGAATAGGAATGG - Intergenic
1177647232 21:23914878-23914900 CCTCATTGGTAGAATGGAGATGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1177922337 21:27167926-27167948 CCTCACCTGTAAAATAGGAATGG + Intergenic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179110148 21:38439159-38439181 CATCGCCTGTGGAAAGGGGAAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179988091 21:44932277-44932299 CCCCATCTCTATAATGGGGACGG - Intergenic
1180727118 22:17954459-17954481 CATCACCTGGGGCATGGGGAGGG + Intronic
1180845516 22:18979106-18979128 CCTCACCTGGACTATGAGGATGG + Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181728303 22:24826894-24826916 CCTCATCTGTGTAACGGGGATGG - Intronic
1181764321 22:25080243-25080265 CCCCAGCTGTACAATGGGAAGGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182019898 22:27072906-27072928 CCTCACCTGTAAAATAGATATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182243021 22:28932267-28932289 CCTCACCTGTAAAATAAGGCCGG + Intronic
1182287574 22:29257419-29257441 CTTCACCTGTAAAATGGCCACGG - Intronic
1182438552 22:30347364-30347386 CCTCACCAGTATAATGGGGGTGG - Intronic
1182461286 22:30485735-30485757 CCTCATCTGTAGGCTGCGGATGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182843372 22:33410263-33410285 TCTAACCTATAGACTGGGGAGGG + Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1182897089 22:33867959-33867981 CCTCTCCTCTTGAATGAGGAGGG - Intronic
1183034021 22:35127125-35127147 CCTCACCTGTAAAAAGGACAGGG - Intergenic
1183035577 22:35138666-35138688 GCTCACCTGTGAAATGGGGGTGG + Intergenic
1183059672 22:35328441-35328463 CCTGACCTGGAAAATGGGGGTGG - Intronic
1183100494 22:35580753-35580775 CCTCACCTGGAAAATGGGTTTGG + Intergenic
1183176106 22:36225846-36225868 CATCAGCTGTAGAAGGGGGCTGG - Intergenic
1183191711 22:36325789-36325811 CAGCTCCTGCAGAATGGGGACGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183345688 22:37306414-37306436 CCTCTGCTGTAAACTGGGGACGG - Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183444671 22:37845442-37845464 CCTCACCTATAAAATAGGGATGG - Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184151814 22:42643832-42643854 CCCTACCTGGAGGATGGGGAGGG + Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184507819 22:44914693-44914715 CCTCACGTGGTGGATGGGGAAGG + Intronic
1184606255 22:45576414-45576436 CCTCACCTGTAAGGTGAGGAAGG - Intronic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184747736 22:46465799-46465821 CCTCACCTGTGAACTGGGGGTGG - Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949426779 3:3926138-3926160 ACACATCTATAGAATGGGGAAGG - Intronic
949484507 3:4524873-4524895 TCTCACCTGTAAAATGGGAGAGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949866451 3:8551451-8551473 TCTCACCTGTAAAATGGGTTTGG - Intronic
950029625 3:9843744-9843766 CCTCCGCTGTAGAATGGGACCGG - Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950107404 3:10396933-10396955 CCTCACCCAAGGAATGGGGAAGG + Intronic
950128697 3:10527328-10527350 CCTACCCTGTAAAATGGGGGTGG - Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950442658 3:13019070-13019092 CCTCGCCTGTAGAGTTGGGGGGG - Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950542086 3:13618770-13618792 CCTCTCCTGTGAAATGGGGTGGG + Intronic
950650636 3:14404506-14404528 CCTTACCTGTAAAATGGGTGGGG + Intronic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950704705 3:14772679-14772701 CCTCACCTGTGCAAGGGAGAGGG + Intronic
950706456 3:14785519-14785541 CCTCACCTGTACAATCAGGGAGG - Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951308745 3:21098557-21098579 GCTCATCTGTGGAATGGGAATGG - Intergenic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951685109 3:25335117-25335139 CCTCAGCTATAATATGGGGATGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953073236 3:39544650-39544672 CCTCAACTCTAAAATGGGAATGG - Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953958139 3:47247076-47247098 CCTCACCTGCCTAGTGGGGAGGG - Intronic
954156904 3:48690461-48690483 CCTTACCTCTACAAAGGGGAGGG + Intronic
954388269 3:50255663-50255685 TCCCACCTGTAGAATGGGAATGG - Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955530729 3:59870284-59870306 CCTCACCTGTGACATGGGAATGG - Intronic
955708531 3:61754264-61754286 GCTCAGCTGTAAAATGGAGATGG + Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956737448 3:72248596-72248618 CCTCACCTCTACAAAGAGGATGG - Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956882597 3:73526371-73526393 CCTTATCTGTGGAATGGGTATGG - Intronic
957194228 3:77047314-77047336 CCTTACCTGTAAAATGGGCATGG + Intronic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959529190 3:107413289-107413311 CCCCACCTCTAGCATGGCGAGGG - Intergenic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
960996401 3:123343373-123343395 CCTCACCTGTAACATGGGGTGGG - Intronic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961683656 3:128615566-128615588 GCCCACCTGGAGAATAGGGAAGG + Intergenic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962471088 3:135709971-135709993 CTTCATCTGTAGAATGGGTGTGG - Intergenic
962608362 3:137051310-137051332 CTTCACCTGTAGCAATGGGAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963643768 3:147888805-147888827 CCTCACCTGTTAAATGAAGATGG - Intergenic
963843276 3:150130012-150130034 CTACATCTGTAGAATGGAGATGG + Intergenic
964409152 3:156380134-156380156 CCTCAGCTGATGGATGGGGAGGG - Intronic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969583666 4:8079972-8079994 CCTCACCTGCACCATGCGGAAGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971003590 4:22349960-22349982 CCTCACCTGGATAATAGAGATGG - Intronic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
971493840 4:27242821-27242843 CCCAAGCTGTAAAATGGGGAGGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
979312558 4:119220981-119221003 CATCACCTGGAGGATGGTGAAGG + Intronic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980860219 4:138490369-138490391 TCTCACCTCTATAATGAGGAAGG + Intergenic
981316314 4:143343137-143343159 CCTTACCTGTAAAATGGGGGAGG + Intronic
983711887 4:170728245-170728267 CCTTTCCTGTATAATGAGGAAGG - Intergenic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
984653295 4:182291580-182291602 CCTCAGCTGTACCATGGGGAGGG - Intronic
985557828 5:566022-566044 CCTCACCTGTAAAATAGTGCAGG - Intergenic
985849658 5:2379261-2379283 CCTCACCTGTGAAGTGGGGCAGG + Intergenic
986234355 5:5893513-5893535 CCTCACCTGGAGAATGGGCGTGG - Intergenic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
987074123 5:14364888-14364910 TCTGACCTGTAGCATTGGGAAGG + Intronic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990544312 5:56807215-56807237 CTTCACCTGGAAAATGGCGATGG + Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991468106 5:66936315-66936337 CTTCACCTGTACAATGGAAATGG + Intronic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992017761 5:72593399-72593421 CCTCACCTGTAAAATGCCTATGG - Intergenic
992796298 5:80257200-80257222 CCTCACCGCTAAAATGGGTACGG - Intergenic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
994079713 5:95694820-95694842 CCTCCCTGGTAGAAAGGGGAGGG - Intronic
995037562 5:107552415-107552437 CCTCACCTATTAAATGAGGATGG - Intronic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996347043 5:122498833-122498855 TCCCACTTGTAAAATGGGGATGG - Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
998130132 5:139647754-139647776 CCTCACCTGAGAAATGGGAACGG + Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999645582 5:153714013-153714035 CCTCGCCTATCGAATTGGGATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000281529 5:159786561-159786583 TCCCACCTGTAAAATGGGAATGG + Intergenic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001086665 5:168704981-168705003 CCTCAGCTGTAAAATGGAGGAGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001131614 5:169069148-169069170 CCTCAACTGTAAATTGGGGGTGG - Intronic
1001227063 5:169953883-169953905 CCTCATCAGTAGAATAGGAATGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001773200 5:174311161-174311183 CCTCATCTGTGGAATGGGCGTGG + Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002295484 5:178228584-178228606 CCCCACCTGTAAAATGAAGATGG + Intronic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1003861884 6:10329963-10329985 CTTCACCTGTACGATGGGAATGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1006181745 6:32157704-32157726 TCTCACCTGTGGCATTGGGATGG - Exonic
1006453064 6:34116277-34116299 CCTCTCCTGTAAAATGGGGCCGG + Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016388802 6:143554580-143554602 CCTCACCTGAGGAAAGGTGAAGG + Intronic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017922414 6:158883867-158883889 CCTTTCCTGAAGATTGGGGATGG + Intronic
1017958098 6:159196192-159196214 CCTCACCTCTGGAGTTGGGAGGG + Intronic
1018021783 6:159767935-159767957 CCTTACCTGTAAACTGGGAATGG - Intronic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021797174 7:24267747-24267769 CCTCTGCTGTAGAGTGTGGAAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022304503 7:29133979-29134001 CCTCTCTTTTAGACTGGGGAGGG - Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023642829 7:42277923-42277945 CCACAGCTGTAGAATGGAGAAGG + Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024244106 7:47456414-47456436 CCCCACCTGGGGAATGGGGGTGG + Intronic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1030065180 7:105653867-105653889 GTTCACCTGGAGAATGGGGGAGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030869079 7:114733509-114733531 CTTCTCCTCTACAATGGGGAGGG + Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032439347 7:131930277-131930299 GCTCACCTGTATGATGTGGAAGG + Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035073155 7:156159409-156159431 CCACTCCTGCAGCATGGGGATGG + Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037720407 8:21439019-21439041 TCTCACCTGTATAGTAGGGATGG + Intergenic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1041675541 8:60534833-60534855 CCCCACTTAGAGAATGGGGAAGG - Intronic
1042326226 8:67530786-67530808 CCTCAGCTAAAGAGTGGGGATGG + Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1043933664 8:86118862-86118884 CCTCATCCTTAGAATGGTGATGG - Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044641832 8:94390639-94390661 CCTCACCAAAAAAATGGGGATGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045067650 8:98465185-98465207 CCTCACCTGTCAAACGGGGTTGG - Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047218867 8:122902432-122902454 CCTCAGCTGTACATTGGGGATGG + Intronic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047706037 8:127500569-127500591 CCTCACCTCTAAAATGGAGATGG - Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1047873030 8:129106091-129106113 CCTGGCCTGTAAAATGGGGATGG + Intergenic
1048136985 8:131756151-131756173 CCTCACCTGTATAATAAGAACGG + Intergenic
1048354582 8:133642788-133642810 CCCCACCTGTGGAAGGCGGAAGG + Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048509665 8:135050774-135050796 CCTTAGCTGTAAAATGGGGCTGG + Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049298238 8:141855274-141855296 CCTCACCTTGAGGATGGTGACGG + Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1051674701 9:19547308-19547330 CAGCACCTGCAGAATGGGCAGGG - Intronic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1051730648 9:20139342-20139364 CCGCACCCATAAAATGGGGATGG + Intergenic
1052012200 9:23423657-23423679 CCTCACCTGTAAATTGGAAATGG - Intergenic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053546328 9:39026808-39026830 TCTCACATGTATAATTGGGAAGG - Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1053810643 9:41848470-41848492 TCTCACATGTATAATTGGGAAGG - Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054619950 9:67338969-67338991 TCTCACATGTATAATTGGGAAGG + Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1055139395 9:72858566-72858588 CCTCCCCTGTAAAATATGGAAGG + Intergenic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056565321 9:87766930-87766952 CATCACCTGGAGGATGGGGGAGG + Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057180734 9:93028716-93028738 CCTCACCTGTAAAATGGGATGGG - Intronic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057565630 9:96164004-96164026 CCTCACTTGAAGAAAGGGCATGG - Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1059376764 9:113888187-113888209 CCTCAGCTGTACAACGGGAATGG - Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060105346 9:120869644-120869666 CCTCAACTGTAAAGTGGAGATGG - Intronic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060429923 9:123542282-123542304 CCTCAACTGTACAATAGGTAAGG - Intronic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061548163 9:131316666-131316688 CCTCACCTGGGGGAAGGGGAAGG - Intergenic
1061673057 9:132200033-132200055 GGCCATCTGTAGAATGGGGATGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062255358 9:135618239-135618261 CCACATCTGTAGAGTGGAGACGG - Intergenic
1062434607 9:136541394-136541416 CCTCCGCTGTAGAAGGGGCATGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186240519 X:7560725-7560747 CCTGGCCTGTAAAATGGAGAAGG - Intergenic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187128990 X:16482571-16482593 CCTCACCTCTTGATGGGGGAGGG - Intergenic
1187397336 X:18930255-18930277 CCCCACCTGTACAGTGGTGATGG - Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1189407966 X:40742927-40742949 CCTCACCTCTGGAAGGGGCAAGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190516611 X:51230204-51230226 CCTCATCTGTTGAGTGGGGCAGG - Intergenic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191673137 X:63767759-63767781 CCTCACCTCTAGAATGAAGGAGG + Intronic
1192094897 X:68200172-68200194 CCTCACTGGTAAAATGGGGGGGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192723337 X:73723535-73723557 ACACACCTGTAGAATGTGGCTGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1195177609 X:102326307-102326329 CCTCACCTGGAGCATAGTGAAGG - Exonic
1195181255 X:102360786-102360808 CCTCACCTGGAGCATAGTGAAGG + Exonic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196013794 X:110916066-110916088 CCTCACCTATAAAATCAGGATGG - Intergenic
1196262755 X:113603957-113603979 CTTCACCTGTAGCAAGAGGAGGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1201782999 Y:17743863-17743885 TCTCACCTCTAAAATAGGGATGG - Intergenic
1201818554 Y:18162124-18162146 TCTCACCTCTAAAATAGGGATGG + Intergenic
1202350058 Y:23980108-23980130 CCTCACTTAGAGGATGGGGATGG + Intergenic
1202520721 Y:25690013-25690035 CCTCACTTAGAGGATGGGGATGG - Intergenic