ID: 1098619923

View in Genome Browser
Species Human (GRCh38)
Location 12:72582906-72582928
Sequence CTGTAAAAACAGAAAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1136
Summary {0: 1, 1: 0, 2: 5, 3: 96, 4: 1034}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098619923 Original CRISPR CTGTAAAAACAGAAAAAGAT AGG (reversed) Intronic
900260661 1:1726817-1726839 CTCTCAAAACAGAAAAAAAAAGG - Intronic
900286336 1:1902315-1902337 CTGTAAAAAAAAAAAAAAAGTGG + Intergenic
900573021 1:3368807-3368829 CTGTTGAAAAAGACAAAGATGGG - Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901667409 1:10834633-10834655 CTGCAAAAACAGAAAATGAAGGG + Intergenic
901710883 1:11114158-11114180 CTGCAAAAACTGAAAAAATTAGG - Intronic
902525523 1:17054674-17054696 CTGAAAAAAAAAAAAAAAATTGG - Intergenic
903203182 1:21760413-21760435 CTGTCAAAAAATAAAAAGGTAGG + Intronic
903593981 1:24479943-24479965 CTGAAAAAAAAAAAAAAGAGTGG + Intergenic
903933764 1:26880312-26880334 CTCAAAAAAAAGAAAAAGAAAGG - Intronic
904156119 1:28484665-28484687 CTTTAAAAATATAAAAACATGGG + Intronic
904231543 1:29078216-29078238 CTCAAAAAAAAGAAAAAGAGGGG + Intronic
904473553 1:30750543-30750565 CTGCAAAATCAGAAAAATATGGG - Intronic
904740831 1:32674528-32674550 CTTTAAAAACAAAAAAAAGTGGG - Intronic
904794339 1:33047761-33047783 CTGGAAAAAAGGAAAATGATGGG + Intronic
905066195 1:35185806-35185828 CTTAAAAAAAAGAAAAAGTTGGG + Intronic
905070671 1:35222457-35222479 CTGTAAAATTACAAAAATATGGG - Intergenic
906025209 1:42667642-42667664 CTGTAAAAATAAAAAGAGAAAGG + Intronic
906097384 1:43233486-43233508 CTAAAAAAAAAAAAAAAGATTGG + Intronic
906110071 1:43316821-43316843 CATTTAAAACAGAAAAGGATCGG - Intronic
906347690 1:45029954-45029976 CTCTAAAAACATAAACAGGTAGG - Intronic
906564662 1:46790381-46790403 CTGTAAAAAAAAAAAAAAAAAGG - Intronic
906853342 1:49277735-49277757 CTGAAAAAAAAAAAAAAGACGGG + Intronic
906969838 1:50500304-50500326 TTGTAAAGACAGAAAAAAAATGG + Intronic
906979505 1:50614537-50614559 CTTTAAAAACAAAACAAAATGGG + Intronic
907070574 1:51530970-51530992 TTGTAAAAAAAGAAAAAAATAGG + Intergenic
907673131 1:56494013-56494035 CTCTAAAAACAGAAAAGGCAAGG + Intergenic
907673985 1:56501772-56501794 CTGGAAAAAGATAAAAAGAGAGG + Intronic
908143251 1:61209978-61210000 CTGTACTAACAGAAAAAGGCTGG - Intronic
908226499 1:62061175-62061197 ATAAAAAAACAAAAAAAGATGGG - Intronic
908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG + Intergenic
908604390 1:65779008-65779030 CTGTAAATAGAGACAAAGAAGGG + Intergenic
908797559 1:67846026-67846048 CATTATAAACAGAAAAAAATAGG - Intergenic
908886170 1:68791417-68791439 CTGTGAAGACACAAGAAGATGGG + Intergenic
909233477 1:73121042-73121064 CTGAATCAACAGAAAAAAATGGG + Intergenic
909260095 1:73476970-73476992 CTGTAAAATAATAAAAATATAGG + Intergenic
909311277 1:74153093-74153115 TTGTAAAAAAGGAAAAAGAATGG - Intronic
909930417 1:81491536-81491558 CTTTAAAAACACAAACAGAAGGG + Intronic
909967247 1:81930026-81930048 CTGTAGAATCAGAAAAAAATTGG - Intronic
910014852 1:82509526-82509548 CTGTGAAAGCTGAGAAAGATGGG + Intergenic
910042481 1:82869436-82869458 CTGTAAAAAAAAAAAAAAAGTGG + Intergenic
910095979 1:83522133-83522155 TCATTAAAACAGAAAAAGATAGG - Intergenic
910836290 1:91516069-91516091 CTGTTTAAACAAAAAAAGAGAGG - Intronic
910994897 1:93094187-93094209 ATGTGAAAACAGAAAAAAAGTGG - Intronic
911001837 1:93174263-93174285 ATGTAAAAGCAAAAAAAGCTGGG - Intronic
911608095 1:99931269-99931291 ATGTAAAAAGAGAAAAATAACGG + Intergenic
911617191 1:100027471-100027493 CTGAAACAACAAAAAAAGACTGG + Intergenic
911700265 1:100944451-100944473 CTGCAAAAAGAAAAAAAAATTGG + Intronic
912092030 1:106090267-106090289 CTTTAAAAAAATAAAAATATAGG + Intergenic
912351195 1:109015487-109015509 CTGAAAATACAAAAAAAAATTGG - Intronic
912998424 1:114554913-114554935 ATGAAAATACAGAGAAAGATGGG + Intergenic
913075264 1:115336677-115336699 CTGTAAACACAGGATAAGAAGGG + Intronic
913449838 1:118985695-118985717 TTTTTAAAAAAGAAAAAGATGGG - Intronic
913590779 1:120322649-120322671 CTTTAAAAACTTAAAAACATTGG - Intergenic
914600033 1:149195293-149195315 CTTTAAAAACTTAAAAACATTGG + Intergenic
914790639 1:150874688-150874710 CTGTAGCAAAAGAAAAAGAGGGG + Intronic
914905198 1:151738161-151738183 GTGTAAAATCAAAAACAGATTGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
915037987 1:152944472-152944494 CTGTCAAAAAAAAAAAAAATTGG + Intergenic
915151684 1:153837870-153837892 CAGAAGAAACAAAAAAAGATTGG - Intronic
915378876 1:155422946-155422968 CTGAAAAAAAAAAAAAAGAAAGG - Intronic
916370223 1:164084716-164084738 CAGTTAAAAAAGCAAAAGATTGG - Intergenic
917382175 1:174423891-174423913 TTCTAAAAACAGAGAAAGTTTGG - Intronic
917871986 1:179250141-179250163 CTTTAAAAATAAAAAAATATTGG + Intergenic
917939052 1:179898779-179898801 CTCAAAAAAGAGAAAAAGAAAGG + Intronic
918052877 1:180990050-180990072 CTGGAACAACAGATAAATATGGG - Exonic
918331242 1:183462984-183463006 TTGAAAAAGCAGAGAAAGATGGG + Intergenic
918512166 1:185323167-185323189 CTGTAAAAAAAAAAAAAAAAAGG + Intergenic
918815683 1:189178343-189178365 TTGTGAAAACATAAAAACATGGG + Intergenic
918881412 1:190127479-190127501 CTGTAAAAAGAAGAAAAGACAGG - Intronic
919127051 1:193407964-193407986 TTGTCAAAACATAAAAAAATTGG - Intergenic
919289602 1:195612313-195612335 CTATAAAAACAGAAAAAAATAGG - Intergenic
919350113 1:196440698-196440720 ATGAAAAAACAAAAAAAAATAGG - Intronic
919653464 1:200174233-200174255 CTTTCAAAACAAAAAGAGATTGG + Exonic
919700902 1:200629996-200630018 GGGTAAAAAAAGAGAAAGATGGG - Intronic
920373573 1:205494385-205494407 CTCTAAAAAAAGAAAAGGAAAGG - Intergenic
920904114 1:210143878-210143900 CTGTTAATACTGAAAATGATAGG + Intronic
920976390 1:210789900-210789922 CTCTAAAAAGAGAAAGAAATGGG - Intronic
921107499 1:211997242-211997264 CTGAAAAAAAAGAGAGAGATAGG + Intronic
921240629 1:213178036-213178058 CTACAAAAAAAGAAAAAGCTGGG + Intronic
921291251 1:213659821-213659843 TTTTAAAAAAAGAAAATGATAGG + Intergenic
921658365 1:217768490-217768512 CTTAAAAAAAAAAAAAAGATGGG - Intronic
921949920 1:220918850-220918872 AAGTACAAACAGAACAAGATTGG + Intergenic
922105050 1:222506403-222506425 TTGTAAAAAAAAAAAAAGCTTGG - Intergenic
922143237 1:222911457-222911479 CTGTAAAAGAGGAAAAAGAAGGG - Intronic
922438603 1:225631406-225631428 CTATAAAAAAAAAAAAAAATTGG + Intronic
922526068 1:226305167-226305189 CTTTAAAAAAAAATAAAGATAGG + Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
923312838 1:232752650-232752672 CAGCAAAAAGATAAAAAGATGGG + Intergenic
923692912 1:236213554-236213576 CTGTTAAAAAAAAAAAAGGTGGG + Intronic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
924161372 1:241235995-241236017 ATATAAAAACAGAAAATGAGAGG - Intronic
924878707 1:248134504-248134526 CTGTAAAAATAAAACAAGATAGG + Intergenic
924878788 1:248135521-248135543 CAATAAAAACAGTAAAACATTGG + Intergenic
1062941872 10:1428289-1428311 CTGTCAAAAAAAAAAAAAATAGG - Intronic
1063642131 10:7840522-7840544 ATGAAAAAAAAAAAAAAGATTGG + Intronic
1063935569 10:11074335-11074357 TTTTAAAAACAGCCAAAGATTGG + Intronic
1064089916 10:12374627-12374649 TTCTAAAAAAAGAAAAATATAGG - Intronic
1064417339 10:15161317-15161339 CTGTTAAAGAAGAAAAAGACAGG + Intronic
1064676754 10:17767908-17767930 CTCAAAAAAAAAAAAAAGATGGG - Intronic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1064858670 10:19799999-19800021 CTGTAGAACTAGAAAAAAATGGG + Intergenic
1065041310 10:21699681-21699703 CTGTAAAAAAAAAAAAAAGTGGG + Intronic
1065110145 10:22432881-22432903 CTCAAAAAAAAGAAAAAGAAAGG - Intronic
1065722704 10:28642047-28642069 CTTATAAAAAAGAAAAAGATGGG + Intergenic
1065904754 10:30240441-30240463 TTTTAAAAAAAGAAAAAGACTGG + Intergenic
1066162552 10:32749118-32749140 CTGGAGAAACAGGTAAAGATAGG - Intronic
1066317273 10:34260273-34260295 CTGTTTAAAAAGAAAAAAATTGG - Intronic
1066442932 10:35455822-35455844 TTTTAAAAAAAGAAAAAGACAGG + Intronic
1066447209 10:35494060-35494082 AGGAAAACACAGAAAAAGATGGG - Intronic
1066520437 10:36212511-36212533 TTTTAAAAACAGGAAAAGAAAGG - Intergenic
1067052863 10:43033859-43033881 CTGTTACAAGAGACAAAGATGGG - Intergenic
1067151979 10:43743373-43743395 CTGTAAAAAAGAAAAAACATAGG - Intergenic
1067355550 10:45522079-45522101 CATTAAAAACAGAAAAATGTGGG - Intronic
1068010310 10:51440934-51440956 CTATAAAATCAGGAAAAGAATGG + Intronic
1068336772 10:55643134-55643156 ATGTAAAAACAAAATAATATAGG + Intergenic
1068437159 10:57007391-57007413 CTGGAAAAAAAAAAAAAGAGAGG - Intergenic
1068560331 10:58507932-58507954 CTCTATAAAAACAAAAAGATTGG + Intergenic
1068624010 10:59220147-59220169 CTATAAAATGATAAAAAGATAGG + Intronic
1068666439 10:59680468-59680490 CTGTAAAACCTGCAAAAGAAAGG - Intronic
1069142667 10:64846469-64846491 CTTTAGAAACACAAAAAAATTGG + Intergenic
1069649778 10:70037584-70037606 CTATAAAAAAAGAAAAATATGGG - Intergenic
1070040589 10:72774783-72774805 CTGTAAAAAGAAACAAAGAAGGG + Intronic
1070777473 10:79118258-79118280 GTGAACAAACAGAAAAACATGGG - Intronic
1071132216 10:82407768-82407790 ATGTTAAAATAGAAAAATATAGG + Intronic
1071887454 10:89966557-89966579 CCATAAAAGCACAAAAAGATGGG + Intergenic
1071928898 10:90443030-90443052 CAATAAAAAGAGAAAAAGAAGGG + Intergenic
1073305241 10:102498088-102498110 CTCAAAAAAAAAAAAAAGATAGG + Intronic
1074021660 10:109590713-109590735 CTCAAAAAAAAGAAAAAAATTGG + Intergenic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1074075249 10:110117389-110117411 CTGTAGCTTCAGAAAAAGATAGG - Exonic
1074259998 10:111843428-111843450 CTGGAAAAAAATTAAAAGATGGG - Intergenic
1075055084 10:119212151-119212173 CTTTAAAAAAAAAAAAAGAAAGG - Intronic
1075285437 10:121181429-121181451 CTGTAAAAATAAGAAAATATTGG - Intergenic
1075905461 10:126077804-126077826 CTTTAAAAAAATAAAAAGGTGGG - Intronic
1075985771 10:126783878-126783900 CTGAAAGAAGAGAAAAATATTGG + Intergenic
1076022526 10:127085754-127085776 CTAAAAAAAAAGAAAAAGAAAGG + Intronic
1076591076 10:131583097-131583119 CCCCAAGAACAGAAAAAGATGGG - Intergenic
1077257578 11:1594660-1594682 ATGTAAAAAAAAAAAAAGAAGGG - Intergenic
1077676633 11:4200123-4200145 CAATAAAAACAAAAATAGATGGG - Intergenic
1077733035 11:4755418-4755440 CTGTACCAACATAAAAAGTTGGG + Intronic
1077767311 11:5173381-5173403 ATATAAAAACAGAATAAGAACGG - Intronic
1078388216 11:10911839-10911861 GTGTAAAGACAGAAACAGAAAGG + Intergenic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079215318 11:18505255-18505277 CTCAAAAAAAAAAAAAAGATTGG - Intronic
1079346978 11:19661458-19661480 CTGTACAAACAGAAAAACCCAGG - Intronic
1079368750 11:19832100-19832122 CTCAATAAAGAGAAAAAGATGGG + Intronic
1079528164 11:21415580-21415602 CTGTAAAAATAGAAAAAATAGGG - Intronic
1080011365 11:27462867-27462889 CTTAAAAAAAAGAAAAAGAAAGG + Intronic
1080111534 11:28573529-28573551 CTGTCTAAACAGCAAAAGAGTGG + Intergenic
1080364972 11:31563438-31563460 CAGTAAGAACAGAAAGAGCTTGG + Intronic
1080629661 11:34062322-34062344 CTGGAAAAACTGGTAAAGATTGG + Intronic
1080719018 11:34831160-34831182 CTGTAAAAGGGGTAAAAGATGGG + Intergenic
1081007522 11:37764879-37764901 CTGGAAAAAGAGACAGAGATGGG - Intergenic
1081015742 11:37877866-37877888 CTCTACAAGCAGAAAAAAATTGG - Intergenic
1081326045 11:41745878-41745900 TTGTAAAAAAAGAAAAAAAAAGG - Intergenic
1081628160 11:44667886-44667908 CTCTAAAAACAGACAAACAAGGG + Intergenic
1082037601 11:47658010-47658032 CTTTAAAAAAAAAAAAAGACTGG - Intergenic
1082055756 11:47814536-47814558 CTCAAAAAAAAAAAAAAGATTGG + Intronic
1082789876 11:57339677-57339699 CTGAAAGAACAGCATAAGATTGG - Intronic
1083597567 11:63925798-63925820 CTCAAAAAAAAAAAAAAGATGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085425016 11:76396680-76396702 CAGTAAAAAGAGAGAAAGATAGG - Intronic
1085910093 11:80813812-80813834 TTGTAAGAAAAGAAAAAGAGAGG - Intergenic
1086065593 11:82740387-82740409 CTGTAAAAAAAAAAAAAGGAAGG - Intergenic
1086156029 11:83666867-83666889 CTCTAAATACAGAGAAAGAATGG + Intronic
1086526589 11:87734635-87734657 CTGAAAAAACAAAAAACCATAGG - Intergenic
1086563928 11:88202571-88202593 CTGTAATTACAGGAAAAAATAGG - Intergenic
1086571916 11:88294884-88294906 ATGTAAAAATAGCAAAAGTTAGG + Intronic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086841315 11:91688243-91688265 CTGAAAGAAAAAAAAAAGATTGG + Intergenic
1087350317 11:97022953-97022975 CTGTAAGAAGAGACAAAGAAAGG + Intergenic
1087754525 11:102040883-102040905 CTGTTACAATAGAAAAAGAGGGG + Intergenic
1087909211 11:103733775-103733797 TATTAAACACAGAAAAAGATAGG - Intergenic
1088125525 11:106419065-106419087 CTGCAAAAACACCAAATGATGGG + Intergenic
1088320177 11:108547099-108547121 CTGTAAAAATAGAAAATGCATGG - Intronic
1088334442 11:108687892-108687914 CTGTAAACACAGACACACATGGG + Intronic
1088611247 11:111579285-111579307 CTGTAAGAAAACAAAAAAATTGG - Intergenic
1088944240 11:114493057-114493079 CTATAAAAAGAGACAAAGAAGGG - Intergenic
1089029164 11:115305410-115305432 CTGAAAACACAGAAAAGGAGAGG - Intronic
1089113645 11:116076646-116076668 CTGTAAAAAAAAAAAAAAAGCGG + Intergenic
1089750727 11:120649301-120649323 CTGAAGAAAAAAAAAAAGATAGG + Intronic
1089789883 11:120934891-120934913 ATGGAAAACCAGAAAAAGCTGGG - Intronic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1089916651 11:122163594-122163616 CTGCCAATACAGAAAAAGTTTGG - Intergenic
1091083793 11:132699796-132699818 CTACAAGAAAAGAAAAAGATAGG - Intronic
1091114231 11:132998498-132998520 CTATGAAAACTGACAAAGATGGG - Intronic
1091450981 12:571679-571701 CTGTAAATAAACAAAAATATAGG - Intronic
1092298805 12:7225213-7225235 CTGGTAAAAAAGGAAAAGATAGG - Intergenic
1092562837 12:9634393-9634415 GTGTAAGGACAGAAAAAGAAAGG - Intergenic
1092601875 12:10075572-10075594 CTATAAAGACAGCAAAAGTTGGG - Exonic
1092760776 12:11809161-11809183 GTGTCAAAAAAAAAAAAGATAGG + Intronic
1092937125 12:13374608-13374630 CAGTAAAAACACAAAATGCTGGG - Intronic
1093143190 12:15534282-15534304 CTTAAAAAAAAGAAAAAGAAAGG + Intronic
1093361266 12:18231884-18231906 CAGCAAAAAAAGAAAAATATAGG - Intronic
1093478852 12:19584023-19584045 CTGTAAAATCAAAAACAAATTGG - Intronic
1093924929 12:24900585-24900607 CTCAAAAAAAAGAAAAAGAAAGG + Intronic
1094225881 12:28045493-28045515 CTTGAAAACCAGAAAAAGATAGG - Intergenic
1094332183 12:29305979-29306001 CTGTAAAAAAAAAAAAACCTAGG - Intronic
1094395540 12:30001466-30001488 TTGGAATAAAAGAAAAAGATAGG + Intergenic
1094702096 12:32879869-32879891 ATTTAAAAAAAGAAAAAGAAGGG + Intronic
1095257907 12:40061944-40061966 CAGTATATACAGAAAAAGAAAGG + Intronic
1096641866 12:53001179-53001201 CTGAAAAAAAATAAAAAGGTCGG - Intergenic
1096697369 12:53358383-53358405 CTCAAAAAACAGAAAAAGGCAGG + Intergenic
1097534374 12:60847885-60847907 CTCAAAAAAAAAAAAAAGATGGG + Intergenic
1097549166 12:61045619-61045641 TTGGAAAAACAAAAAAAAATTGG - Intergenic
1097977416 12:65702132-65702154 CTGAACAAACAGAAAAAAAGTGG - Intergenic
1098339330 12:69435607-69435629 ATTTAAAAACACAAAAAGATGGG + Intergenic
1098420280 12:70288965-70288987 AAGTAAAAACAGGAAAAGATGGG - Intronic
1098497766 12:71156147-71156169 CAGTAAAAATGGAGAAAGATTGG + Intronic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1098800153 12:74946527-74946549 GGGTAAAAACAGAGAAAGACTGG + Intergenic
1098867605 12:75780750-75780772 CTTGAAAAAAAAAAAAAGATAGG - Intergenic
1099091986 12:78323588-78323610 CTGTAAAAAAAAAAAAAAATTGG - Intergenic
1099871749 12:88358446-88358468 CTTTAAAAATTGAAAAAGAAGGG + Intergenic
1100041163 12:90319378-90319400 CTCAAAAAACTAAAAAAGATAGG - Intergenic
1100181583 12:92092018-92092040 CTGTAAAACAGGAAAAAGAATGG + Intronic
1100236869 12:92670361-92670383 TTATAGAAAGAGAAAAAGATGGG - Intergenic
1100571987 12:95851657-95851679 CTGTATAAAAAGAGAAAGAAGGG - Intergenic
1100578522 12:95916173-95916195 ATGTAAAAGCAGCAAATGATAGG - Intronic
1100605381 12:96148111-96148133 CTGTACAAACAAGAAAAGTTAGG - Intergenic
1100797078 12:98193610-98193632 CTAGAAAAACAGAAAAAGACTGG - Intergenic
1101274028 12:103179534-103179556 ATGTGAGAACAGAAAAAGAGGGG + Intergenic
1101914094 12:108883012-108883034 CTTAAAAAAAAGAAAAAGAGTGG + Intronic
1102132206 12:110540774-110540796 CTCAAAAAAAAAAAAAAGATTGG - Intronic
1102534780 12:113573277-113573299 CTGTAAAATCTGAATAAGGTGGG + Intergenic
1102790625 12:115642172-115642194 CTATGGAAACAGTAAAAGATCGG + Intergenic
1102954611 12:117051442-117051464 CTGTGAAAACACATAAAGATGGG - Intronic
1103199974 12:119079948-119079970 ATTTAAATAAAGAAAAAGATTGG - Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103522554 12:121546079-121546101 CAGTAATCACAGAAATAGATGGG - Intronic
1103582171 12:121923453-121923475 CTTAAAAAACAAAACAAGATGGG - Intronic
1103695057 12:122808525-122808547 CTCTAAAAAAAGAAAAAAAAAGG - Intronic
1104384347 12:128337468-128337490 CTGCGAAATCAGAAAAAGGTAGG - Intronic
1104484834 12:129142100-129142122 CTGTTAAAAAATAAAAAGGTTGG + Intronic
1104913106 12:132249796-132249818 CTGTGATTACAGAAAAAGGTGGG + Intronic
1105433604 13:20359061-20359083 CTGTGAAAAAAAAAAAAGAAAGG - Intergenic
1105745002 13:23369543-23369565 CTGAAAAAAAAAAAAAAGAATGG - Intronic
1105932736 13:25067894-25067916 CTGTGAAAAGAGAAAGAGGTAGG + Intergenic
1106089907 13:26581438-26581460 CTGTTAAAAAAAAAAAAAATTGG - Intronic
1106142982 13:27026497-27026519 CTCTAAAAAAAGAAAAAGTGAGG + Intergenic
1107074876 13:36312368-36312390 CTCTTAAAAAAGACAAAGATGGG - Exonic
1107155360 13:37160343-37160365 CAGTAAAAAGAGACAAAGAAGGG - Intergenic
1107281372 13:38739227-38739249 TTTTAAAAACAGGAAAATATTGG + Intronic
1107952986 13:45482530-45482552 GTTGAAAAACACAAAAAGATAGG - Intronic
1108107897 13:47032926-47032948 CTGTGAGAACAGAAAAAGGTGGG - Intergenic
1108259125 13:48639448-48639470 GTATAAAAACAGAAAAAGGCCGG + Intergenic
1108458256 13:50638446-50638468 CTGAAAAAAAAAAAAAAAATCGG - Intronic
1109264029 13:60176080-60176102 CTTTAAGAAAAGAAAAATATTGG - Intergenic
1109703923 13:66063694-66063716 CTCAAAAAAAAAAAAAAGATTGG - Intergenic
1109753427 13:66726068-66726090 CTAAAAAAATAGAAATAGATTGG - Intronic
1109999670 13:70179083-70179105 CTATTAAGACAGAAAAAGGTGGG + Intergenic
1110100741 13:71598073-71598095 CTGTCAAAAAAAAAAAAAATAGG + Intronic
1110748744 13:79087892-79087914 CTGTAAAAACAGCAAACACTAGG + Intergenic
1110894769 13:80735774-80735796 CAATAAAAACACAATAAGATAGG + Intergenic
1111061666 13:83027533-83027555 CTGTAAAAAAAGAAAACTACAGG + Intergenic
1111522113 13:89418851-89418873 GTGTAAAGACATAAAAATATAGG - Intergenic
1111702111 13:91704246-91704268 CTGTAAAAAGAGACAAAGAAGGG - Intronic
1111705259 13:91740561-91740583 CTATATAAACAGAAATGGATTGG - Intronic
1111722079 13:91958270-91958292 CTGTAAAAAGAAAAAAAAAAAGG + Intronic
1112374100 13:98822760-98822782 CTACAAAAAAAGAAATAGATTGG - Intronic
1112516951 13:100061726-100061748 CAGTAAAAACAAAGAAAAATAGG - Intergenic
1112578795 13:100660630-100660652 CTTTAAAAACATACAAAGAGTGG - Intronic
1112678468 13:101732951-101732973 CTGTAAAAGATGAAAGAGATTGG - Intronic
1112894340 13:104280462-104280484 CTGAAAAGAAAGAAAAAAATTGG - Intergenic
1113174061 13:107541162-107541184 CTGTCAAAAAATAAAAAGCTTGG + Intronic
1113430948 13:110249786-110249808 CTTAAAAAACAGTAAAATATAGG + Intronic
1113980925 13:114274855-114274877 CTTTAAAAACAGAAAAAGTTTGG - Intergenic
1114196334 14:20480112-20480134 CTTTGAAAAAAAAAAAAGATAGG + Intergenic
1114846247 14:26326102-26326124 CTTTAAAAAAAGAAATAGTTTGG + Intergenic
1114937777 14:27565374-27565396 CTCTAATAACAGAAAAATAAAGG + Intergenic
1115039443 14:28905286-28905308 CTGTAATAAAAGAAAAAAATTGG + Intergenic
1115087070 14:29530244-29530266 CTATAAAAATATAAAAATATAGG - Intergenic
1115178329 14:30591618-30591640 CTGTGAAGATAGAAACAGATTGG - Intronic
1115429152 14:33296430-33296452 CTGTAAAGACACAGATAGATAGG - Intronic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1116055156 14:39854742-39854764 CAGTAAAGAGAGAAAAAAATGGG - Intergenic
1116061176 14:39926275-39926297 CTCAAAAAATAAAAAAAGATAGG - Intergenic
1116330069 14:43584672-43584694 GTGTAAATGCAAAAAAAGATGGG - Intergenic
1116551993 14:46252224-46252246 ATTTAAAAACAGAAAGAGAATGG - Intergenic
1116647174 14:47543279-47543301 CTCTAAAAAAACAAAAAGAATGG + Intronic
1117148571 14:52861540-52861562 GTGTAAAAAAAGAAACAGATGGG - Intronic
1117163282 14:53009804-53009826 CTCAAAAAAAAGAAAAAGAGAGG - Intergenic
1117579087 14:57133492-57133514 CTGAAAAAAAAAAAAAAGTTAGG + Intergenic
1117946723 14:61033996-61034018 CTGTAAAATCAGCAAAAGGAAGG - Intronic
1118086501 14:62424028-62424050 CTGTAAAAACAGAACATTAAAGG + Intergenic
1118204009 14:63704790-63704812 GTGTAACAAAAGAAAAACATAGG + Intronic
1118407452 14:65440506-65440528 CTATTAAAACAAAAAAAGCTTGG + Intronic
1118506310 14:66415873-66415895 CTGTAAAAAGAGAAAATTACAGG + Intergenic
1118659800 14:67996018-67996040 CTGTGAAAAAAGAAAAAGTAGGG + Intronic
1119393514 14:74308249-74308271 CTACAAAAAAAGAAAAAAATTGG + Intronic
1119500386 14:75121867-75121889 CAGGAAAAAAAGAAAAAAATTGG + Intronic
1119599337 14:75964464-75964486 CTGAAAAAAAAGGAAAAGACTGG + Intronic
1120423576 14:84318584-84318606 CAGTAAAAATAGACAAAGAATGG + Intergenic
1120835207 14:89032697-89032719 CTGTATCAACACAAAATGATCGG - Intergenic
1120950501 14:90036813-90036835 CCTTAAAAAAAAAAAAAGATAGG + Intronic
1121258714 14:92550716-92550738 CTGTGAAAACATAATAAGCTGGG - Intronic
1121487493 14:94329985-94330007 TTGGAAAAAGAGAAAAAGCTAGG + Intergenic
1121533524 14:94675292-94675314 CCCTACAAAAAGAAAAAGATGGG - Intergenic
1121555002 14:94829785-94829807 CTGAAAAAAAAAAAAAAAATGGG - Intergenic
1121613403 14:95296371-95296393 CTGTAAAAACACAACAAAACTGG + Intronic
1121871220 14:97409419-97409441 CTTTGAAAAAAAAAAAAGATTGG - Intergenic
1122555418 14:102576662-102576684 CTGTCAAAAAAAAAAAAAATCGG - Intergenic
1122569154 14:102682970-102682992 CTGTAATAACAGAAAGATAGTGG - Intronic
1122747078 14:103904234-103904256 TTGAAAAAAAAAAAAAAGATGGG + Intergenic
1122912990 14:104842875-104842897 ATGTAAAAATAAAAAAAGAAGGG + Intergenic
1123689446 15:22824544-22824566 TTATTTAAACAGAAAAAGATGGG + Exonic
1123903972 15:24904036-24904058 CTCAAAAAAAAAAAAAAGATCGG + Intronic
1124045117 15:26141674-26141696 ATGTAAAAACAGAATTAGTTTGG + Intergenic
1124162100 15:27281345-27281367 CTGGAAAAACAGGCAAAGGTGGG - Intronic
1124273145 15:28301681-28301703 GTTTAAAAAAAAAAAAAGATGGG - Intronic
1124998835 15:34750952-34750974 ATGTTATAACAGAAAAACATTGG - Intergenic
1125115218 15:36082767-36082789 ATGTAAAAAGAGACAAAGAAGGG + Intergenic
1125169926 15:36754923-36754945 CTGCTAAAATAGAAAATGATGGG - Intronic
1125618246 15:41035523-41035545 CTCTAAAAAAAAAAAAAGACCGG + Intronic
1125734641 15:41915902-41915924 ATATACAAACAGAAAAAGAAGGG + Intronic
1125875921 15:43144474-43144496 CAATAAAAAAGGAAAAAGATGGG + Intronic
1125998455 15:44186737-44186759 CTGGAAAAGGAGAAAAAGAAGGG - Intronic
1126195126 15:45922847-45922869 CTGCAGCCACAGAAAAAGATTGG - Intergenic
1126449845 15:48794248-48794270 CTTTAAAAAGAGAAAAAAAATGG + Intronic
1126769716 15:52043195-52043217 GTGTACAAACAGAAAAAACTTGG + Intronic
1126783544 15:52158643-52158665 CTTTAAAAAAAAAAAAAGGTTGG - Intronic
1126835403 15:52658982-52659004 CTCAAAAAACAAAAAAAGAAAGG + Intronic
1126941522 15:53771893-53771915 CTTTACAAACAGAAAAAGAATGG + Intergenic
1126961297 15:53998102-53998124 CTCTATAAAAAGAACAAGATTGG - Intergenic
1127035419 15:54911050-54911072 CTGTAAGAAGAGACAAAGAAGGG + Intergenic
1127318532 15:57819554-57819576 CTTAAAAAAAAAAAAAAGATGGG + Intergenic
1127595247 15:60475054-60475076 CTGAGAAAGCAGGAAAAGATGGG + Intronic
1127880561 15:63153829-63153851 TTTTAAAAAAAGAAAAAGAGGGG + Exonic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1128803227 15:70510465-70510487 CAGTAAAAAAAGAAAACTATAGG + Intergenic
1129187391 15:73918066-73918088 CTGGCAAAAAAGAAAAAGAAGGG + Intergenic
1129203128 15:74017650-74017672 AAGAAAAAAGAGAAAAAGATGGG + Intronic
1129746653 15:78026540-78026562 CTGTTAAAACAGAATACCATAGG - Intronic
1130010198 15:80146439-80146461 CTGTAAAACTAGAAGAAAATGGG + Intergenic
1130199859 15:81814992-81815014 CTGTGAAAAAAGAAAAAAAAGGG + Intergenic
1130573620 15:85071083-85071105 CTGAGAGAACAGAAAAGGATAGG + Intronic
1130614056 15:85387334-85387356 TTAAAAAAACAAAAAAAGATAGG + Intronic
1130898897 15:88192369-88192391 CAGTAAAAATAGAAGCAGATAGG - Intronic
1131352997 15:91718536-91718558 CTGCAAAAACTCAAAAAGAGAGG - Intergenic
1131627798 15:94142163-94142185 ATGCAAAAACTGAAAAAGAAAGG - Intergenic
1131659749 15:94501184-94501206 CTGTAAAAAAAAAAAAAAAAAGG - Intergenic
1131737998 15:95354913-95354935 CTATAAAAATAGACAAATATAGG - Intergenic
1131860826 15:96651575-96651597 ATGTGATAACAGAAAAAAATTGG + Intergenic
1131938173 15:97530979-97531001 CTTAACCAACAGAAAAAGATAGG + Intergenic
1133152501 16:3846522-3846544 CTGTGAAAACAGCAAAATACTGG + Intronic
1133556460 16:6910628-6910650 CTCTAGAAACTGACAAAGATGGG - Intronic
1133636391 16:7670010-7670032 CTGGAACAACAGAAAAATAGAGG - Intronic
1133863674 16:9620939-9620961 CTGAAAAAAAAGAAAGAGAGAGG + Intergenic
1134177755 16:12021888-12021910 CTCAAAAAAAAAAAAAAGATAGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134469093 16:14506825-14506847 CTTTAAAAAAAGAAAAAGAGTGG + Intronic
1134801984 16:17092860-17092882 CTTTAAAAATAAAAAAAGACAGG - Intergenic
1135014154 16:18909905-18909927 ATGTAACAAAAGAAAAAGATAGG - Intronic
1135412010 16:22242471-22242493 CTTTAAAAAAAAAAAAAGCTGGG - Intronic
1135431517 16:22387826-22387848 CTCTAAAAAAATAAAGAGATAGG - Intronic
1135653213 16:24225239-24225261 CCATAAAAACACAAAAGGATAGG + Intergenic
1135693123 16:24561251-24561273 GTTTAAAAAAAAAAAAAGATGGG + Intronic
1136445959 16:30318954-30318976 ATGTAACAAAAGAAAAAGATAGG - Intergenic
1137031695 16:35530533-35530555 TTTTAAAAACTGAAAAAAATAGG + Intergenic
1137373921 16:47934771-47934793 CTGTAAAAACAAAAAATTAATGG - Intergenic
1137671641 16:50282708-50282730 CTGGAAAAAAAAAAAAAGCTGGG - Intronic
1137807079 16:51317403-51317425 CTGCCAAAAAAGAAAAAGAGAGG - Intergenic
1138058944 16:53868274-53868296 CTATAAAAGCAGAAAAAGAGTGG - Intronic
1139281881 16:65778213-65778235 CTGTGAAAAGAGTAAAACATTGG + Intergenic
1139368422 16:66448402-66448424 CAGGAAAAAAAGAAAAAGAAAGG - Intronic
1139498422 16:67339256-67339278 CTGTAAAAAAAAAAAAAAAAAGG + Intronic
1139869169 16:70090267-70090289 GTGTAAAAAAAGAAAAAAAAAGG - Intergenic
1139870149 16:70101349-70101371 CTGTATAAGCAGAGACAGATTGG + Intergenic
1139878842 16:70167534-70167556 CTAAAAAAAAAGAAAAAGAAGGG + Intergenic
1140132044 16:72171406-72171428 TTTTAAAAACACAAACAGATGGG - Intronic
1140232188 16:73126455-73126477 CTGAAGAAACAGAAACAGATGGG + Intergenic
1140385296 16:74531204-74531226 CTGTATAAGCAGAGACAGATTGG - Intronic
1140873122 16:79125042-79125064 CTAAAAAAAAAAAAAAAGATGGG - Intronic
1141283330 16:82648588-82648610 CTCTAAATAAAGAAAAAGAAGGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141363513 16:83419909-83419931 TTTTAAAAAAAAAAAAAGATTGG - Intronic
1141460184 16:84173854-84173876 CTCAAAAAAAAGAAAAAGAAAGG + Intronic
1141547191 16:84778125-84778147 CTGTTAAAACATAGAAAAATGGG + Intronic
1141612447 16:85190022-85190044 TTGCAAAAACAGAACAAGATAGG - Intergenic
1141686500 16:85573162-85573184 CTTTAAAAAAAGAAAGGGATGGG - Intergenic
1141773997 16:86110229-86110251 CTCTCAAAACAGAAAAAAATTGG + Intergenic
1142164006 16:88575701-88575723 CTCAAAAAACAAAAAAAGACGGG - Intronic
1142922943 17:3207110-3207132 CTCTAAAAACAAAAAAAAAAAGG + Intergenic
1143070257 17:4285947-4285969 CTTTAAAAAAAAAAAAAAATTGG + Intronic
1143071940 17:4302977-4302999 CAGTGAAAACAGAAAAACACAGG + Intronic
1143221542 17:5266196-5266218 CTCTAAAAACAATAAAATATTGG + Intergenic
1143614927 17:8044062-8044084 CTGTAAAGAGAGAAAGAGGTGGG + Intronic
1143849568 17:9800195-9800217 CTGAAAAAAAAAAAAAAGAGAGG - Intronic
1144129910 17:12236483-12236505 CAGAAAATACAGAAAAAAATCGG + Intergenic
1144138591 17:12322946-12322968 CTGTAAAATCTGAAAATGACTGG + Intergenic
1144139458 17:12334627-12334649 CAGTTAAAAGAGACAAAGATGGG - Intergenic
1144184916 17:12788450-12788472 AAGAAAAAAAAGAAAAAGATTGG - Intergenic
1144941503 17:18945307-18945329 AAGTAAAAAAAGAAAAAAATTGG + Intergenic
1145192599 17:20857610-20857632 ATGTAAAAACAGAATAATATAGG + Intronic
1145403122 17:22560680-22560702 ATGTAAAAACAGAATAATATAGG + Intergenic
1146140868 17:30366924-30366946 CAGTAAAAACAGCAAGAAATTGG - Intergenic
1146359725 17:32164235-32164257 GTCTAAAAAAAGAAAAAAATTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147221419 17:38933873-38933895 CTCAAAAAAAAAAAAAAGATTGG - Intergenic
1147346542 17:39800603-39800625 CTGAAAACATAGACAAAGATGGG - Intronic
1147492970 17:40888015-40888037 CTCAAAAAAAAGAAAAAAATTGG - Intergenic
1147573048 17:41583141-41583163 CTGTGAAAATAGAAAAGGACAGG + Intronic
1147692993 17:42329458-42329480 CTGTAAGAAAAGAAAAAGGCAGG + Intronic
1147811866 17:43176660-43176682 CTCAAAAAAAAAAAAAAGATTGG + Intronic
1147814593 17:43199798-43199820 CTATAAAAAGAGAAAAAGTTAGG - Intronic
1148123610 17:45225841-45225863 CTGTAAAAAGAGAATAATAATGG + Intronic
1148262690 17:46197111-46197133 CTCCAAAAAAAGAAAAAGAAAGG + Intronic
1149176151 17:53873131-53873153 ATGTGAAAACAGAAAAGGTTAGG + Intergenic
1149247995 17:54734166-54734188 AAGTAAAATCAGACAAAGATGGG + Intergenic
1149368727 17:55971490-55971512 CTTTCAAAACAGGAAAGGATGGG + Intergenic
1149526875 17:57363440-57363462 CTGTAAAAACATAATAGGCTGGG + Intronic
1150344293 17:64392185-64392207 CTCAAAAAAAAAAAAAAGATTGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150594537 17:66592421-66592443 CTCAAAAAATAGAAAAAGAAAGG + Intronic
1150663102 17:67103163-67103185 CCATAAAAACAGAAAAAAATTGG + Intronic
1151127624 17:71862026-71862048 CTATAAAAAGAGAAAGAGACAGG + Intergenic
1151311120 17:73293012-73293034 CTCTAAAAACATAAAAAAATCGG - Intronic
1151443126 17:74146506-74146528 TTGTAAAAAAAAAAAAAGATGGG + Intergenic
1151726891 17:75890654-75890676 CTGTTAACTCAGAAAGAGATGGG - Exonic
1152496857 17:80679275-80679297 CTCCAAAAACAAAAAAAGAAAGG + Intronic
1153079266 18:1201980-1202002 CAATAACAACAGAGAAAGATTGG - Intergenic
1153310328 18:3671290-3671312 CTGTAAAGAGAGAGAGAGATAGG - Intronic
1153700959 18:7692690-7692712 CAGTGAAAACAGAGGAAGATAGG - Intronic
1153852762 18:9111774-9111796 TTATAAAAACAGAAAAATAACGG - Intronic
1154085806 18:11304264-11304286 CTGTAAAAATACACAAAGACTGG - Intergenic
1154247506 18:12712273-12712295 CAGAAAAAACAGTAAAAGGTAGG - Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1154948715 18:21187084-21187106 CTCTAAAAAAAAAAAAAGGTGGG + Intergenic
1155179296 18:23330245-23330267 CTGTAAAAACAGAAAACCTCAGG + Intronic
1155315360 18:24565817-24565839 CTGTAAAACCAGAGAAGCATGGG + Intergenic
1155360623 18:24996796-24996818 GGGTAAAAACAGCAACAGATTGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156179527 18:34586577-34586599 GTGTAATAACAGAAAATGACAGG - Intronic
1156325385 18:36069990-36070012 CTTTTAAAAAAAAAAAAGATAGG - Intergenic
1156609783 18:38712568-38712590 TTGTGAAAACAGTAAAAAATTGG - Intergenic
1156612889 18:38748445-38748467 CTGTAAGGACAGAATAAGCTGGG - Intergenic
1156765538 18:40650369-40650391 CTTTAAAAAAAAAAAAACATTGG + Intergenic
1156927038 18:42594919-42594941 CAGTAAAAAGAGACAAAGAAGGG - Intergenic
1157162952 18:45331365-45331387 ATGTAAAAACTAAAAAAGAGAGG - Intronic
1157172017 18:45416172-45416194 CCTTAAAAAAAGAAAAAAATAGG - Intronic
1157560885 18:48645328-48645350 CTAAGAAAAGAGAAAAAGATAGG + Intronic
1157666975 18:49495475-49495497 TTGAAAAAGAAGAAAAAGATGGG - Intergenic
1157692634 18:49696451-49696473 ATGAAAAAAGAGAATAAGATAGG - Intergenic
1158007828 18:52693334-52693356 CTATAAAAATATAAAAATATAGG + Intronic
1158123449 18:54076106-54076128 CTCAAAAAAAAAAAAAAGATTGG - Intergenic
1158187070 18:54782870-54782892 GTACAAAAACAGAAAAAAATAGG + Intronic
1158240591 18:55373279-55373301 ATGTAAAAAAAGAAAAAAGTTGG + Intronic
1158324628 18:56300907-56300929 GTGTAAAAATAGAAAACGTTGGG - Intergenic
1158678666 18:59546884-59546906 CTAGAAAAACAGAAAAAGAATGG - Intronic
1159115683 18:64110395-64110417 TTGTAGAGACAGAAACAGATAGG - Intergenic
1159157570 18:64604313-64604335 CTGCAACAACAGACAAAGAAAGG + Intergenic
1159284554 18:66332243-66332265 CTTTTAAAACAGAAATACATTGG + Intergenic
1160235963 18:77087381-77087403 CAGAAAAAAAAGAAAAAAATGGG - Intronic
1160937003 19:1601166-1601188 CTCAAAAAAAAGAAAAAGACTGG + Intronic
1161159448 19:2753761-2753783 CTACAAATACAAAAAAAGATTGG - Intergenic
1161418083 19:4159149-4159171 CTCAAAAAAAAAAAAAAGATGGG - Intronic
1161449535 19:4337230-4337252 CTCAAAAAAAAAAAAAAGATGGG - Intronic
1161603631 19:5201797-5201819 CAGTGAAGAGAGAAAAAGATGGG - Intronic
1162258377 19:9512062-9512084 CTGGAAAGACAGAAAAAGATAGG - Intergenic
1162522153 19:11187790-11187812 CAATAAAATCAGAAAAAGCTGGG + Intronic
1163042776 19:14614884-14614906 CTTTAAAAAAAAAAAAAAATGGG - Intergenic
1163048894 19:14666375-14666397 CTTTAAAAAAAAAAAAAAATAGG - Intronic
1163897767 19:20074574-20074596 CTGTAATAACAAAAAAGGATAGG + Intergenic
1163949388 19:20569916-20569938 CTGTAATAACAAAAACAGAGGGG - Intronic
1163968688 19:20771987-20772009 CTGTAATAACAAAAACAGAGGGG + Intronic
1163976348 19:20856698-20856720 CACTAATAACAGAAAAACATGGG + Intronic
1165562126 19:36688804-36688826 CTCAAAAAAAAAAAAAAGATTGG + Intronic
1165564705 19:36714501-36714523 CTTTAAAAAGAGAAAATTATTGG + Intronic
1165588588 19:36944980-36945002 CCCTAAAAATAGAAAAAAATTGG - Intronic
1165598236 19:37029805-37029827 ATTTAAAAAAAGAAAAAAATTGG - Intronic
1165775528 19:38402433-38402455 CTTTAAAAAAAAAAAAAAATTGG + Intergenic
1165866094 19:38939941-38939963 ATGTAAAAAAAGGAAAACATTGG - Intronic
1166416429 19:42597810-42597832 TTTTAAAAAAAGAAAAAGAGGGG - Intronic
1168699095 19:58425253-58425275 CTCAAAAAAAAAAAAAAGATGGG + Intergenic
925004922 2:434990-435012 CAGAAAAAAAAGAAAAAGAAAGG - Intergenic
925036677 2:692457-692479 CTGTGGAAACAGAGAAAGACCGG + Intergenic
926898284 2:17719793-17719815 ATGTAAAAATAGGTAAAGATAGG - Intronic
927349591 2:22093784-22093806 CAGTAAAAAAGGAAAAAGAAGGG - Intergenic
928926311 2:36583228-36583250 CTGTATAACCAGAAAAAAATAGG + Intronic
929341312 2:40821987-40822009 GTGTCAAAACAGGAAAAGGTGGG - Intergenic
929369783 2:41208733-41208755 CAGAAAAAACAAAGAAAGATAGG - Intergenic
929465491 2:42140184-42140206 CTCAAAAAAAAAAAAAAGATGGG + Intergenic
930383896 2:50667738-50667760 GGGTAAAAACAGAAACATATAGG - Intronic
930445939 2:51472300-51472322 CTTCAAAAACAAAAAAAAATTGG + Intergenic
930451984 2:51553015-51553037 CTTAAAAAAAAAAAAAAGATGGG - Intergenic
930526739 2:52539909-52539931 GTGTAAACACAGAAAAATGTTGG + Intergenic
930750378 2:54928602-54928624 CTCAAACAACAGAAAGAGATTGG - Intronic
930989194 2:57630530-57630552 CTGTAAAAAAAAAAAATGTTTGG + Intergenic
931161104 2:59691539-59691561 CTGCCAAAACAGAAAAACAAAGG - Intergenic
931395166 2:61881645-61881667 CTTAAAAAATAGAAAATGATTGG - Intronic
932017466 2:68046411-68046433 CTGTTAAAAAAGAAAGAGAGAGG + Intronic
932275366 2:70448050-70448072 CTGAGAAAGGAGAAAAAGATGGG - Exonic
932427483 2:71648637-71648659 CAGGAAAAACTGACAAAGATTGG + Intronic
932910801 2:75804428-75804450 TTGTGAAGACAGAAAAATATAGG - Intergenic
933149853 2:78901533-78901555 CCATAAAAACACAAAAAGACTGG - Intergenic
933170431 2:79118933-79118955 TTGTAAAAGCAGAAAAAATTTGG + Intergenic
933602707 2:84349151-84349173 CTCTAAAGACAGAAGAAAATGGG + Intergenic
933745456 2:85567643-85567665 CTCTAAAAAGAAAGAAAGATGGG - Intronic
934728370 2:96639654-96639676 CTCAAAAAAAAAAAAAAGATAGG + Intronic
934772989 2:96919838-96919860 CAGGAAAGACAGAAAGAGATGGG + Intronic
934848845 2:97683693-97683715 CTGAAAAAAAAGAAAACAATTGG + Intergenic
935009286 2:99116685-99116707 CAGTAAGAAAAAAAAAAGATTGG + Intronic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
935481019 2:103589819-103589841 ATTTAAAAACAGAAAAAAAATGG - Intergenic
935914662 2:107936108-107936130 TTTTAAAAATAGAAAACGATGGG + Intergenic
935919175 2:107991839-107991861 CTCTAAAAACAAAAAGAAATAGG + Intronic
936023493 2:109013590-109013612 CTCAAAAAAAAAAAAAAGATTGG - Intergenic
936837125 2:116722425-116722447 CTGTAAAATCAAAAAAAGTTAGG + Intergenic
937040986 2:118820444-118820466 GTGTAAAAAAAAAAAAAAATAGG + Intergenic
937079020 2:119127039-119127061 CTGGAAAAAGAAAAAAAGAAAGG - Intergenic
937079024 2:119127080-119127102 CTGGAAAAAGAAAAAAAGAAAGG - Intergenic
937385762 2:121430973-121430995 CTTTAAAAAAAAAAAAAAATAGG + Intronic
938021830 2:127912310-127912332 CTGGAAAAAGAAAAAAAGACTGG + Intergenic
938025749 2:127946409-127946431 GTTCAAAAACAGAAAAAGAAGGG - Intronic
938038824 2:128058949-128058971 CTTTAAAAAAAAAAAAAGACAGG - Intergenic
938586690 2:132697601-132697623 ATGGAAAAAAAAAAAAAGATGGG - Intronic
938980368 2:136520595-136520617 CTGGGAAATCTGAAAAAGATTGG + Intergenic
939483889 2:142784252-142784274 CTGTAAAAGATGAAAAAGGTGGG - Intergenic
939626341 2:144482123-144482145 CTGCAAAAAGAGAAAATGAACGG - Intronic
940186810 2:150994319-150994341 CTGTAAAGACAGCAAAGGATTGG - Intergenic
940296505 2:152130689-152130711 CTTTAAAAAAAAAAAAAGCTGGG + Intronic
940676892 2:156734374-156734396 CTCTTAAAACAGAAAAACCTAGG + Intergenic
941004278 2:160231907-160231929 CCGTAAAAAAATCAAAAGATTGG - Intronic
941094180 2:161216951-161216973 CTATAAAGTAAGAAAAAGATAGG - Intronic
941225662 2:162844038-162844060 TTGTTAAAACAAAAAAATATAGG + Intergenic
941441490 2:165542919-165542941 CAGTAAATTCAGAAAAAAATTGG - Intronic
942367763 2:175246168-175246190 CTGGAAGAAAAGGAAAAGATAGG - Intergenic
942636739 2:178015792-178015814 AAGGAAAAAAAGAAAAAGATTGG + Intronic
943301130 2:186202217-186202239 CTGTAAAAAGTGAAAAAGAAAGG + Intergenic
943531404 2:189085936-189085958 GTGTAAAATCAGAATAATATTGG + Intronic
943738834 2:191388876-191388898 CTGTAAAAATAAAAAAAGGAGGG - Intronic
943814006 2:192228206-192228228 TTGTAAAAACAGAAGAAATTTGG + Intergenic
943850040 2:192708189-192708211 CTGTAGAAAAAGATAAAGGTAGG + Intergenic
944146121 2:196509342-196509364 CTTTAAAAACTCAAAAAGACTGG - Intronic
944480496 2:200152796-200152818 CTGTAAAGAGAGAAAGAGCTTGG - Intergenic
944777749 2:202985054-202985076 CTCAAAAAAAAAAAAAAGATTGG + Exonic
945502813 2:210598598-210598620 ATTTAAAAACAGACAAAGAAGGG + Intronic
945567284 2:211416483-211416505 ATGTAAAAATAGAAACAAATTGG + Intronic
945687150 2:212985562-212985584 CTGAAAAAGCTGAAAAGGATAGG - Intergenic
946384079 2:219371263-219371285 CTGAAAAAAAAAAAAAAGGTGGG + Intergenic
946488040 2:220119844-220119866 CAGAAAAAACAGAACAAGATGGG - Intergenic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
946687960 2:222290858-222290880 CTTTAAAATAAGAAAAAAATGGG + Intronic
946767246 2:223052023-223052045 CTGTGAAAAGTGAAAAAGACTGG - Exonic
946880596 2:224173517-224173539 ATGCAAAAAAAAAAAAAGATAGG - Intergenic
946971028 2:225091781-225091803 CTGAAAAAAAAAAAAAAGTTAGG - Intergenic
947694518 2:232173394-232173416 CTATAAAAACACAAAAAAATTGG - Intronic
947850170 2:233281082-233281104 CTGTATAAAAAGAAAAAATTAGG - Intronic
947916829 2:233838172-233838194 CGGGAAAAGCAGAAAAACATAGG + Intronic
947960721 2:234234763-234234785 TGGTAAAAAAAAAAAAAGATAGG + Intergenic
948006549 2:234613967-234613989 ATGTATAAACAGAAAAGGTTTGG + Intergenic
948451376 2:238076045-238076067 CTGTAAAAAAAAAAAAAAAAAGG - Intronic
948617134 2:239206661-239206683 CTGAAAAAAAAAAAAAAGGTAGG + Intronic
948647372 2:239414517-239414539 TTGTAAAAAAAAAAAAAAATAGG - Intergenic
1168946305 20:1761590-1761612 CTGTAAAAACCCAAAAGGACTGG - Intergenic
1169320218 20:4626190-4626212 CTGTAAAAACTCAAAAGGACAGG - Intergenic
1169575411 20:6954728-6954750 CTGTAAAAGAAGAAAAATAAAGG + Intergenic
1169973696 20:11299893-11299915 TTGAAAAAGAAGAAAAAGATTGG + Intergenic
1170066291 20:12314252-12314274 CTGGAAACACAGAAAAGCATGGG - Intergenic
1170373779 20:15678358-15678380 CTCAAAAAAAAAAAAAAGATGGG - Intronic
1170433716 20:16301654-16301676 CTCAAAAAAAAGAAAAAAATGGG - Intronic
1170530119 20:17282746-17282768 CTGTGAAAAAAAAAAAAGAAAGG + Intronic
1170949057 20:20918791-20918813 CTTCAAAAACACAAAAAGGTTGG + Intergenic
1171477583 20:25424234-25424256 CTCTCAAAAAAGAACAAGATGGG - Intronic
1171936701 20:31281119-31281141 TTTTAAAAACTGAAAAAAATAGG + Intergenic
1172296256 20:33813140-33813162 CTGTAAAAAAAAAAAAAAAAGGG + Intronic
1172308491 20:33898949-33898971 CTTTAAAAAGAAAAAAAGGTCGG - Intergenic
1172710701 20:36920918-36920940 CTACAAAAAGATAAAAAGATTGG + Intronic
1173140734 20:40480501-40480523 CTCTAAAAAAAAAAAAAAATTGG + Intergenic
1173714273 20:45188642-45188664 CTGCAAAAACAGAACAAAACAGG - Intergenic
1173894801 20:46542572-46542594 CTCAAAAAAAAAAAAAAGATGGG + Intronic
1173990981 20:47303271-47303293 CTGAAAAAAAAGAAAAAGAAGGG - Intronic
1174322516 20:49753133-49753155 CTGTCAGAACAGAAAGAGCTTGG + Intergenic
1174758124 20:53180137-53180159 CTGTGACAAAAGAAAGAGATTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174985330 20:55445292-55445314 CTAGGAAGACAGAAAAAGATGGG + Intergenic
1175091074 20:56504684-56504706 CTTTAAAACCAGAAAAGGAAAGG - Intronic
1175092314 20:56514347-56514369 CTTTAAAAAAAAAAAAAGTTGGG + Intronic
1175600974 20:60272765-60272787 CTGTGAAAACAGCTAAAAATAGG + Intergenic
1177097135 21:16849855-16849877 GGGGAAAAACAGAAAAAGGTAGG - Intergenic
1177397696 21:20558886-20558908 CTGATAAAACAGGAAAAAATGGG + Intergenic
1177448372 21:21230368-21230390 CTGTATAAAAAGATAAAAATTGG + Intronic
1177952456 21:27555548-27555570 AAATAAAAACAGAAAAGGATGGG - Intergenic
1178167756 21:30000678-30000700 ATGTGAAAAAAAAAAAAGATAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178801887 21:35803305-35803327 CAGTTAAAACAGACAAAGAGGGG + Intronic
1179051621 21:37893206-37893228 CTCCAAAAAAAGAAAAAAATAGG - Intronic
1179227731 21:39470257-39470279 CTTTAAAAAAAAAAAAAGTTTGG - Intronic
1179563645 21:42233081-42233103 GTGAAAAAACGCAAAAAGATGGG + Intronic
1179835033 21:44025632-44025654 AAGTTAAAACAGAAAAAGACTGG + Intronic
1180211280 21:46296692-46296714 CATTAAAAAAAGAAAAAGTTTGG + Intronic
1180604788 22:17049687-17049709 CTGAAAAAGAAGAACAAGATTGG + Intergenic
1180762020 22:18217716-18217738 CTATAAAGACAGAAAGAGATTGG + Intergenic
1180773647 22:18406894-18406916 CTATAAAGACAGAAAGAGATTGG - Intergenic
1180804996 22:18656438-18656460 CTATAAAGACAGAAAGAGATTGG - Intergenic
1180805747 22:18712970-18712992 CTATAAAGACAGAAAGAGATTGG + Intergenic
1180908758 22:19433478-19433500 TTGGAAAAACAGAAAAGCATCGG - Intronic
1181069704 22:20325610-20325632 CTATAAAGACAGAAAGAGATTGG - Intergenic
1181192746 22:21153819-21153841 CTATAAAGACAGAAAGAGATTGG - Intergenic
1181216696 22:21338755-21338777 CTATAAAGACAGAAAGAGATTGG + Intergenic
1181349751 22:22246520-22246542 CTGTATTTACAGAAACAGATGGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182193848 22:28493431-28493453 CTGTGAAAACAGGAAAATAAGGG + Intronic
1182373993 22:29832744-29832766 CTTTAAAAAAAAAAAAAGCTGGG - Intronic
1182589283 22:31366407-31366429 CTGGAAATAAAGAAAAACATGGG - Intergenic
1183431526 22:37768805-37768827 CTAAAAAAAAAAAAAAAGATGGG + Intronic
1184423828 22:44397361-44397383 CTGTAAAATGAGGATAAGATGGG + Intergenic
1184463633 22:44656000-44656022 CTCTAAAAGCTGAAAAAGACAGG + Intergenic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
1203235477 22_KI270731v1_random:147868-147890 CTATAAAGACAGAAAGAGATTGG - Intergenic
949131375 3:505798-505820 CTATGAAATCAGTAAAAGATAGG - Intergenic
949160117 3:871916-871938 CTGTAACACCAGATATAGATGGG - Intergenic
949385055 3:3491913-3491935 CAGTAAAAAGAAAAAAAGAAAGG + Intergenic
949529254 3:4937953-4937975 CTGTAAAACCAAAGAAAGCTTGG + Intergenic
949869677 3:8577689-8577711 CTTTAAAAAGAAAAAAAAATGGG + Intergenic
950120790 3:10481311-10481333 CCGCAGAAACAGAAAAAGAGAGG - Intronic
950221352 3:11198734-11198756 CTGAAAAAAAAAAAAAAAATGGG + Intronic
950341383 3:12248187-12248209 CTGTTAAAACTTAAGAAGATCGG - Intergenic
950759629 3:15209308-15209330 CAATAAAAAAAGAAAAAAATAGG - Intronic
951718286 3:25672590-25672612 CTTTAAAAAAAGAAAACGGTAGG + Intergenic
952045985 3:29320933-29320955 ATGTAAAAAAAAAAAAAGTTTGG + Intronic
952189151 3:31003883-31003905 CTTTAAAATCTGAAAAATATTGG + Intergenic
952616003 3:35274854-35274876 AATTAAAAACAGAAAAAAATAGG + Intergenic
952683862 3:36127474-36127496 CAGTAAAAACAGAAAACTACAGG + Intergenic
953108093 3:39905533-39905555 CTGTCAGAACTGAAAAAGAATGG - Intronic
953161225 3:40421796-40421818 CTTTAAAAAAAGAAAAGCATGGG + Intronic
953952924 3:47206273-47206295 CTACAAAAATAGAAAAACATTGG - Intergenic
954903655 3:54041761-54041783 CTGTCAAAACCGTAAAAGCTGGG - Intergenic
954904785 3:54051430-54051452 ATTTAAAAAAAGAAAAAGAAAGG + Intergenic
955010480 3:55009798-55009820 CTGTGAAAACAGAAATAGAATGG - Intronic
955058127 3:55474161-55474183 CAGGAAAGACAGAGAAAGATAGG + Intronic
955204115 3:56879643-56879665 CTTTAAAAAAAAAAAAAGGTGGG - Intronic
955244841 3:57215466-57215488 CTTTAAAAACAGAAAAATGCTGG + Intronic
955678901 3:61479623-61479645 CTGGAACCACATAAAAAGATAGG + Intergenic
955717477 3:61845855-61845877 CTTTAAAAACACAAAAGAATAGG - Intronic
955982202 3:64538532-64538554 ATGTATAAACAGAAAAAGTCTGG - Intronic
956517956 3:70071001-70071023 CAGTCAAAAAAGAAAATGATTGG - Intergenic
956597234 3:70981065-70981087 CTGTGAACACCCAAAAAGATGGG - Intronic
956706744 3:72005673-72005695 CTTAAAAAAAAAAAAAAGATAGG - Intergenic
957480537 3:80787792-80787814 CTGAATCAACAGAAAAAGAAGGG + Intergenic
957708707 3:83824466-83824488 TTGAGAAAGCAGAAAAAGATTGG + Intergenic
957880774 3:86209893-86209915 CTGTAAGAACAGGAAAATATTGG - Intergenic
957930025 3:86865347-86865369 CAGAAAAAAAAGAAAAGGATGGG + Intergenic
959047172 3:101487004-101487026 CAGTTAAAAGAGACAAAGATGGG + Intronic
959276362 3:104281938-104281960 CTGAAAAAAAAGAAAAAGAAGGG - Intergenic
959531019 3:107433551-107433573 CTGCAAAAAGAAAAAAAAATGGG + Intergenic
959542060 3:107551386-107551408 CTTTAAAAGAAGAAAAAGATGGG - Intronic
959999956 3:112720924-112720946 CTGTGAAGACATAAAGAGATGGG - Intergenic
960156334 3:114300369-114300391 CTCTAAAAAAAAAAAAAAATTGG + Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960691498 3:120350717-120350739 ATGTAAAATGAGAAAAAGAAAGG + Intergenic
961228147 3:125273349-125273371 CTGTAAAAATATAAAAACACTGG - Intronic
961793108 3:129390650-129390672 CTGGAAAATCAGAAAAAAGTGGG - Intergenic
961966329 3:130907725-130907747 CTGAAAAAAAAAAAAAAGAAAGG - Intronic
962058268 3:131897593-131897615 CAATAAAAATAGAAAAAAATAGG + Intronic
962150830 3:132891698-132891720 CTGTAAAAGCTGGAAAAGAGAGG + Intergenic
963258682 3:143171917-143171939 CTGTATAAGCAGAAAAAATTGGG + Intergenic
963440821 3:145337212-145337234 TTGTAAAAATAGAAAAATAGAGG + Intergenic
964171731 3:153778797-153778819 CTGTAAAAACATAAAAACAATGG + Intergenic
964213700 3:154255924-154255946 ATGTAAAAAAAGAAAAAAAAAGG - Exonic
964230604 3:154462689-154462711 CTATAAAAATAGAAAAACTTGGG + Intergenic
964305621 3:155336402-155336424 CTGTAAAAACCCAAAAGGATGGG - Intergenic
964467535 3:157012684-157012706 CTGTAAAAACAGTACCACATGGG + Intronic
964827937 3:160850412-160850434 CTATAAAAACCCAAAAAGACAGG - Intronic
965284264 3:166797468-166797490 ATTTTAAAACAGAAAAAGGTAGG - Intergenic
965300894 3:167003067-167003089 ATGTAAGAAGAGAAAAAGAGTGG - Intergenic
965540837 3:169869959-169869981 ATAAAAAAACAGAAAAAGAAAGG - Intergenic
965693991 3:171387944-171387966 CTGTACTATCAGAAAAATATAGG + Intronic
966226013 3:177598828-177598850 CTGTAAAAAAAAAAAAAAACTGG - Intergenic
966521716 3:180880908-180880930 CTACAAAAACAGAAAAATTTGGG + Intronic
966984585 3:185167551-185167573 CTGTAAAAAAAAAAAAAGGTAGG - Intergenic
967019457 3:185509679-185509701 CTTTAAAAACAATAAAAGAAAGG + Intronic
967914626 3:194569456-194569478 CTTTAAAAAAAAAAAAAAATGGG + Intergenic
969164075 4:5289844-5289866 CTCTAAAAAGAGAATAAAATAGG - Intronic
969191672 4:5526385-5526407 CAGTAAAAAAAAAAAAAAATAGG - Intronic
969472210 4:7395535-7395557 CTGTGTAAACAAAAAAAGTTGGG - Intronic
969542493 4:7802041-7802063 CTATAAAGACAAAAAAAGAGAGG + Intronic
969693072 4:8717094-8717116 TTGTAAAAACAGAAATTGAAAGG + Intergenic
970051010 4:11915250-11915272 ATGTTAAAACAGAAAAGTATAGG + Intergenic
970170802 4:13288058-13288080 GTGATAAAACATAAAAAGATTGG - Intergenic
970471287 4:16381717-16381739 CTGGAAACAAAAAAAAAGATGGG - Intergenic
970666342 4:18341860-18341882 TTGGAATACCAGAAAAAGATGGG - Intergenic
970683736 4:18541013-18541035 TTGTCAAAACAGGAAAAGAATGG + Intergenic
970859338 4:20683815-20683837 CTTTAAAAACAGAGAAGAATAGG - Intergenic
971274759 4:25185347-25185369 ATGTCAAAAAAGAAAAAGAAAGG + Intronic
971325514 4:25640196-25640218 CTTTAAAAAAAAAAAAAAATTGG - Intergenic
971363290 4:25956043-25956065 CTGTAAAAACTCAAAAGGACTGG + Intergenic
971617969 4:28818034-28818056 CTATAAAAAAAGAAAAAAAAAGG + Intergenic
971631779 4:29001920-29001942 CTGGAATTACAGAAAAAGAAAGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971932316 4:33100902-33100924 CTATAAAAAAACCAAAAGATTGG - Intergenic
971934160 4:33125920-33125942 CAGAAAAAAAAAAAAAAGATGGG - Intergenic
971949085 4:33320163-33320185 CTGTAAACAAACAAAAAGAGTGG - Intergenic
972142098 4:35973393-35973415 TTATAAAAACAGCAAAAGAGAGG + Intronic
972638002 4:40901351-40901373 TTGTAAAAACAAAACTAGATTGG - Intronic
972712674 4:41613443-41613465 CTGTCAAAAAAGAAAATGAAAGG - Intronic
973076782 4:45938711-45938733 CAGTTAAAACAAAAAAAAATTGG - Intergenic
973100964 4:46270274-46270296 CAGTAAAAAGACAAAAAGAAAGG - Intronic
973932545 4:55807519-55807541 CTTTTAAAACAGAAAATGAAAGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974126619 4:57704759-57704781 CAGTAAAATCAGACAAAGAAGGG - Intergenic
974142440 4:57904436-57904458 CTATAAAACCTGAGAAAGATGGG + Intergenic
974178586 4:58357551-58357573 CTCAGAAAACAGAAAAATATGGG + Intergenic
974358675 4:60846639-60846661 CTGAAAAAAAAAAAAAAAATAGG - Intergenic
974611391 4:64222803-64222825 CAATAAAAACAGAATAAAATGGG - Intergenic
975737627 4:77397132-77397154 CTGGAAAGACAGAAAAAGATTGG - Intronic
976535476 4:86209519-86209541 ATTTAAAAACAGCAAACGATGGG + Intronic
976652923 4:87455507-87455529 GTTTAAAGAGAGAAAAAGATAGG - Intronic
977657534 4:99539151-99539173 CTTTTAAACCAGAAAAAGAGTGG + Exonic
977960106 4:103076067-103076089 GTGTACAAACAGAAAAGGCTGGG + Intronic
978174674 4:105715940-105715962 ATGTATAAACATAAAAAGACAGG + Intronic
978503236 4:109431889-109431911 CTGTGATAAGACAAAAAGATGGG + Intergenic
978803797 4:112779516-112779538 CTCTAAAAAAAGAAAAAAAAAGG + Intergenic
978808000 4:112820738-112820760 CTCGAAAAACAGAAAAACAAAGG - Intronic
978940581 4:114431572-114431594 CTTGAAAATCAGAAAAAGACAGG - Intergenic
979098559 4:116584235-116584257 CTTTAAAATCAGAAAAAAATAGG + Intergenic
979116262 4:116828345-116828367 ATGTAAAAACAGAAAATCTTTGG + Intergenic
979132166 4:117060804-117060826 CTGTGCAAACAGAATAAGGTAGG + Intergenic
979222949 4:118250482-118250504 CTCAAAAAAAAAAAAAAGATTGG - Intronic
979533858 4:121797815-121797837 CTCAAAAAAAAGAAAAAAATGGG - Intergenic
979541956 4:121894241-121894263 CTTTAAAAAGAGACAAAGAAAGG + Intronic
979816051 4:125105519-125105541 ATTTAAAAAAAGAAAAAGGTGGG + Intergenic
980035185 4:127875218-127875240 AAGAAAAAAGAGAAAAAGATGGG - Intergenic
980066017 4:128189261-128189283 CTGTAAAAAAAAAAAAAAAAAGG - Intronic
980298923 4:130962912-130962934 CTGCAGAAAGAGAAAAATATGGG - Intergenic
980329120 4:131388020-131388042 ATATAAAAACATAAGAAGATTGG - Intergenic
980372520 4:131895608-131895630 CATTAAAAAAAGAAAAAAATTGG - Intergenic
980685118 4:136217954-136217976 CAGTAAAAAAAGACAAAGAAAGG - Intergenic
980774898 4:137424964-137424986 CTTCAAAAAAATAAAAAGATAGG - Intergenic
980910261 4:138987855-138987877 CACTAAAAACAGAAAAGGCTGGG - Intergenic
981072948 4:140563905-140563927 CTGTAAGAATACAAAAATATGGG - Intronic
981175368 4:141676772-141676794 CAGAAAAAAAAAAAAAAGATGGG + Intronic
981198616 4:141950496-141950518 CAGTAAAAAAAGAAAACTATAGG + Intergenic
981203528 4:142012539-142012561 CTGTAAGAAGAGACAAAGAAAGG - Intergenic
981323878 4:143424951-143424973 CTTTAAAAAAAGAAAAAAAAAGG + Intronic
981510797 4:145556099-145556121 TTTTAAAAACAGCACAAGATTGG - Intronic
981647986 4:147021311-147021333 ATATAAAAACAGAAATAGACTGG - Intergenic
982263363 4:153515909-153515931 CTTTAAAAAAAAAAAAAAATGGG - Intronic
982276823 4:153644439-153644461 CTTTAAAAAAAAAAAAAGCTGGG - Intergenic
982492818 4:156050243-156050265 CTGTAAAAATGAAAAATGATAGG + Intergenic
982608601 4:157545009-157545031 CTGTAAAAAGACACAAAGAAGGG - Intergenic
982750900 4:159160442-159160464 ATTTAAAATCAGAAACAGATGGG - Intronic
983264936 4:165498903-165498925 CTGGAAAAAGACAGAAAGATGGG + Intergenic
983305293 4:165977051-165977073 CTATAACAAAAGAAAAAAATAGG + Intronic
983329282 4:166303722-166303744 CAGTAAAAAAAGACAAAGATGGG + Intergenic
983740875 4:171131834-171131856 CTATCAAAACAGAAAATAATAGG - Intergenic
984020387 4:174477954-174477976 CAGTAAAAAAAGAGAAAGAAGGG + Intergenic
984173955 4:176393457-176393479 CTGTAAACAAAGAAATACATTGG - Intergenic
984203475 4:176756775-176756797 GTGTAAAGCAAGAAAAAGATAGG + Intronic
984248998 4:177309650-177309672 CTGTAAAAGCAGAAGAAATTGGG - Intergenic
984443803 4:179807243-179807265 CAAGAAAAACAGAAAATGATAGG + Intergenic
984571494 4:181399848-181399870 GTGTAAAAACAGACAATGTTAGG + Intergenic
984736518 4:183113696-183113718 CTTTAAAAAGAAAAAAAGAAAGG - Intronic
984907085 4:184638358-184638380 CTTTATAATCAGAGAAAGATGGG - Intronic
984956375 4:185049818-185049840 ATGTAAAAAAAGGAAAACATTGG - Intergenic
985526129 5:402853-402875 CTGTTCAACCAGAAAAAGAAGGG + Intronic
985699164 5:1360299-1360321 CTGTGGAAAAAGAAAAAGCTAGG + Intergenic
985919124 5:2954658-2954680 CTGTAAAAAGAGACAAAGAAGGG - Intergenic
985998582 5:3612255-3612277 CTCAAAAAAAAGAAAAAGAAAGG + Intergenic
986660193 5:10052434-10052456 CTAAAAATACAGAAAAAAATTGG - Intergenic
987108911 5:14666293-14666315 CTGTGAAAACAGACAATGATAGG + Intronic
987464611 5:18256927-18256949 CTGTAGAAACAGAGATAGAGAGG + Intergenic
987787500 5:22520564-22520586 CTTAAAATACAGAAAAAAATAGG + Intronic
987795404 5:22621862-22621884 CTGTAAAAACACAAAAAACTAGG + Intronic
988020631 5:25615486-25615508 AGGGAAAAACAGAAAAACATAGG + Intergenic
988042086 5:25902609-25902631 AAGTAAAAACAGAAAAAGACAGG + Intergenic
988044638 5:25934844-25934866 TTGTTAAAAAAGAAAAAAATTGG - Intergenic
988287677 5:29241314-29241336 CTGTAAGAACAGGACAAAATTGG - Intergenic
988614426 5:32760886-32760908 GTGGCAGAACAGAAAAAGATGGG - Intronic
988795876 5:34653508-34653530 ATGTCAGAACTGAAAAAGATCGG + Intergenic
989000068 5:36750618-36750640 CTGAAAATACAAAAAAAAATTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989249511 5:39293328-39293350 CTGTAAAGACATACATAGATGGG + Intronic
989556266 5:42798776-42798798 GTGCAAAAACAAAAAAAAATTGG + Intronic
989759427 5:44994945-44994967 CATTAAAAAAAGAAAAAGTTCGG - Intergenic
989803133 5:45569659-45569681 TTGTAAAAACAGATAAAGACTGG - Intronic
989825978 5:45855657-45855679 CTGAAAAAACAGGCATAGATAGG - Intergenic
990054573 5:51556121-51556143 TTGTAAAAACAGAATAAAGTGGG + Intergenic
990059779 5:51633168-51633190 CTTTAAAAACAGAGAAAGACTGG - Intergenic
990770166 5:59234987-59235009 CTATAAAAAAAGAAAAAGAGTGG - Intronic
991269269 5:64760172-64760194 CTGTAAAAAGAAAAAAAGCAAGG + Intronic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
991478041 5:67044510-67044532 ATTTAAAAAAAGAAAAAGGTGGG - Intronic
992050954 5:72940528-72940550 CTGTAAAAAAAAGAAAAGATGGG + Intergenic
992528321 5:77632101-77632123 CTGTTAAAAAAAAAAAAAATAGG - Intronic
993291165 5:86073260-86073282 CTGGAAAGATAGAAAAAGAGAGG - Intergenic
993462334 5:88198908-88198930 CTGTAAAAAAAAAAAAAAATTGG - Intronic
993713591 5:91252178-91252200 CTGAGCAAACAAAAAAAGATTGG - Intergenic
993758329 5:91760645-91760667 CTGTAAGAAAAGAAAACTATGGG - Intergenic
993808052 5:92437342-92437364 CTGGAGTACCAGAAAAAGATGGG + Intergenic
993869722 5:93238268-93238290 GTGTAAAAATATAAAAAGAATGG + Intergenic
994038482 5:95229738-95229760 CTCAAAAAAAAAAAAAAGATTGG + Intronic
994466551 5:100141079-100141101 CTGGAAAAATAGAAAATGAAGGG - Intergenic
994507718 5:100663535-100663557 CTAAAAGAACAGAAAAAGAGGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994948334 5:106425323-106425345 GTGTAAAAAGAGACAAAGAAGGG - Intergenic
995099461 5:108280906-108280928 CAGTAAAAAGAGAAAGAGAGAGG + Intronic
995683741 5:114748219-114748241 TTGTAAAACCAGATAAAGAAAGG + Intergenic
995818623 5:116201387-116201409 CTGTAAAAACTGAAAAATGCAGG - Intronic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996249651 5:121313938-121313960 CTGAAAAAACAGAACCAGAGAGG - Intergenic
997256549 5:132433026-132433048 TTGAAAAACCAGAAAAATATTGG - Intronic
997449845 5:133973440-133973462 CTGTAAAAAGACAAAGAAATAGG - Intronic
998000586 5:138621958-138621980 CTGGAAAAAAAAAAAAAGAAAGG + Intronic
998223878 5:140311136-140311158 CTGAAAAGACAGAAAAAAAGGGG + Intergenic
998234359 5:140385537-140385559 CTGTTAAAAAATAAAAAGAATGG + Intergenic
998475663 5:142419347-142419369 TTGAAAAATCAGAAAAAGAGAGG + Intergenic
998579035 5:143350682-143350704 CTGAAGCAACAGAAAAGGATGGG + Intronic
998598860 5:143563353-143563375 AAGGAAAAAAAGAAAAAGATGGG - Intergenic
998601998 5:143593973-143593995 TTGTAAAAGGAGAAAAAGAACGG + Intergenic
998779430 5:145640177-145640199 CTGAAAAAATACAAAAAAATTGG + Intronic
998800127 5:145860767-145860789 CTATAAATAAAGAAACAGATTGG - Intronic
998888380 5:146719469-146719491 CTGTAAAATAAGAATAATATTGG + Intronic
999378449 5:151103328-151103350 CTTTAAAAAAAGCAAAAAATGGG + Intronic
999886860 5:155934018-155934040 ATGTAAAGACAGAAAACAATAGG - Intronic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000080454 5:157840594-157840616 TTGCGTAAACAGAAAAAGATGGG + Intronic
1000487874 5:161870657-161870679 AAGAAAAAACAGAAAAAGAGGGG + Intronic
1000676452 5:164127758-164127780 GTGTGAAAACAGACAAATATAGG - Intergenic
1001226426 5:169948345-169948367 CAGTAATGACAGAAAGAGATGGG + Intronic
1001660165 5:173385222-173385244 CAGAAAAAAAAGAAAAAGAATGG - Intergenic
1001847155 5:174932468-174932490 CAGCAAAAACAGACTAAGATGGG - Intergenic
1002213993 5:177616260-177616282 CAGAAAAGACAGAAAAAGAAGGG - Intergenic
1002584446 5:180233559-180233581 ATGTAAAAACACACAAAAATTGG + Exonic
1003865850 6:10361837-10361859 CTGCAAAAAAATAAAAACATTGG - Intergenic
1004017416 6:11744714-11744736 TTTTAAAGACAGAAACAGATGGG + Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004347642 6:14863364-14863386 TTGGAAAAACAGAAACAGAGAGG + Intergenic
1004576029 6:16895984-16896006 CTATAAAAACAACAAAATATTGG - Intergenic
1004776746 6:18855530-18855552 CAGTAAAAAAAGAAAAAGACAGG - Intergenic
1004853954 6:19730341-19730363 CTGTAAAGAGAGAAAGGGATGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005234410 6:23743132-23743154 GTGTAAAAATAGAATATGATAGG - Intergenic
1005865108 6:29931617-29931639 AAGTAAAAACAGAAAAATTTCGG + Intergenic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1006975670 6:38098499-38098521 CTCAAAAAAAAAAAAAAGATGGG - Intronic
1008725532 6:54413810-54413832 CTGTAAAGACTATAAAAGATGGG + Intergenic
1008986759 6:57553538-57553560 CTTTAAAGACAGAAAAAAATTGG - Intronic
1009561684 6:65253861-65253883 CTGAAAAATCAGAAAAAGATAGG - Intronic
1009890869 6:69680030-69680052 CTGTAGAGACAGAAAAATAATGG - Intronic
1009932392 6:70192021-70192043 ATGACAAAACAGAAAAAAATGGG + Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG + Intronic
1010393675 6:75365703-75365725 CTGTATAAACAAAAAAAAAAAGG - Intronic
1010484198 6:76390372-76390394 CAGTAACAACAGAATAAGAATGG - Intergenic
1010598676 6:77797315-77797337 CTATAAAAACAGAAACAAGTGGG + Intronic
1011239110 6:85251986-85252008 TGGTGAAGACAGAAAAAGATAGG - Intergenic
1011480215 6:87786276-87786298 CTCAAAAAAAAAAAAAAGATAGG + Intergenic
1011481592 6:87799217-87799239 CTGTAAAATCTGAGAAAGTTGGG + Intergenic
1011585890 6:88924724-88924746 CTCTAAAAAAAAAAAAAAATTGG - Intronic
1011933938 6:92751613-92751635 CTGTAATAAGAGAAAAAGAAGGG - Intergenic
1012062669 6:94508936-94508958 CTCAAAAAAAAGAAAAAGAAAGG - Intergenic
1012772896 6:103462368-103462390 CTTTAAAAACTAAAAAAAATAGG - Intergenic
1012840078 6:104318960-104318982 CTTTAAATACAGAAATAAATTGG + Intergenic
1012919696 6:105208738-105208760 CTTTAAAAAAAAAAAAAAATAGG + Intergenic
1012945359 6:105460217-105460239 TTGGAAAAAAAAAAAAAGATGGG - Intergenic
1012950059 6:105508392-105508414 CTGTAAAAACAAAACAAAAATGG - Intergenic
1013273958 6:108566564-108566586 CTTTAAAAAAAAAATAAGATGGG - Intronic
1013712065 6:112913087-112913109 CTGTAAAAAAAAAAAAAAAAAGG + Intergenic
1013914306 6:115316177-115316199 CTGTAAAGCAAGAAAAAGAGAGG + Intergenic
1014502890 6:122214549-122214571 CTGTAGAAAGAGAAAAAACTGGG + Intergenic
1014710165 6:124796947-124796969 CTGTAAAGAAAGAAAATGTTTGG + Intronic
1014756324 6:125305174-125305196 CTCTAAAAGCTGAAAAAGACAGG + Intergenic
1014886592 6:126789323-126789345 CTGGAAAAACAGGAAAAGAGAGG + Intergenic
1015175744 6:130306242-130306264 CTGTCTAAGCAGAAAAATATAGG + Intronic
1015274300 6:131368311-131368333 CTGTTAAAATCCAAAAAGATGGG + Intergenic
1015458622 6:133461843-133461865 ATTTAAAAAAAGAAAAAGAAAGG - Intronic
1015561395 6:134520159-134520181 CTGAAAAAAAAAAAAAAAATAGG - Intergenic
1015870589 6:137772589-137772611 GGGAAAAAAAAGAAAAAGATTGG + Intergenic
1016377968 6:143443528-143443550 CTCTAAAAAAAGTAAAAAATAGG + Intronic
1016712420 6:147189058-147189080 CTTTAAAAAGAGAAAAAGTGTGG + Intergenic
1016774112 6:147885423-147885445 CTTTAAAAACAAAATAAGGTTGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017670912 6:156768708-156768730 CTCTAAAAAAAAAAAAAGGTGGG - Intergenic
1017689883 6:156953498-156953520 TTTTAAAAAAAGAAAAAAATCGG + Intronic
1017752726 6:157503367-157503389 GTCTAAAGACAGAAAAAGACAGG - Intronic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1018884689 6:167924623-167924645 CTTTGAAAACACAAAAAGACTGG + Intronic
1019091203 6:169536091-169536113 CTGTGCCAACAGAAAAAAATAGG + Intronic
1019375498 7:689606-689628 ATGCAACAAAAGAAAAAGATGGG + Intronic
1019671559 7:2282674-2282696 CTTTAGAAACAAAAAAGGATTGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020346979 7:7175953-7175975 CTGTAAAACCCCAAAAGGATAGG + Intronic
1020480393 7:8652949-8652971 TTGTTAACACAGAAAAATATAGG + Intronic
1020960092 7:14791584-14791606 CTGATAAAACAGAAAAAGAAGGG - Intronic
1021019854 7:15583986-15584008 CTAAAAAAAAATAAAAAGATAGG - Intergenic
1021170326 7:17391631-17391653 CTGAAAAAAAAAGAAAAGATAGG + Intergenic
1021333523 7:19369186-19369208 CTGTGAAAACAGACATAGAATGG - Intergenic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1022165327 7:27754325-27754347 TTTTAAAAACAGAAAATGAGTGG - Intronic
1022305530 7:29143265-29143287 CTGTAAAAACATAAAAGGCAGGG - Intronic
1022914349 7:34932789-34932811 TTTAAAAAACAGAAAAACATGGG + Intronic
1022918549 7:34987755-34987777 CTTAAAAATCAGAAAAAAATAGG + Intronic
1023900983 7:44478549-44478571 GTCTAAAAAAAGAAAAAGATAGG + Intronic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1024519659 7:50293794-50293816 CTGTAAAAAGACAACAGGATTGG + Intergenic
1024682009 7:51700382-51700404 CAGAAAAGACAGAAAAAGAATGG + Intergenic
1024775828 7:52784312-52784334 CTGGAGAATCAGGAAAAGATTGG + Intergenic
1024888494 7:54173670-54173692 ATGAAAAAACAGAAAATTATGGG - Intergenic
1024895199 7:54251974-54251996 CTGTAAGTACAGACAAATATTGG - Intergenic
1024923084 7:54581500-54581522 GTGAAAAAACAGAAAAAAAAAGG + Intergenic
1024988526 7:55216696-55216718 CTTTAAAAACTGAAAAACATTGG - Intronic
1025100907 7:56134319-56134341 TTTTAAAAAAAGAGAAAGATAGG - Intergenic
1025107282 7:56182416-56182438 CTCAAAAAACAAAAAAAGAATGG - Intergenic
1026026725 7:66751334-66751356 TTTTAAAAACAGAAAAAAAGAGG - Intronic
1027154999 7:75760830-75760852 CTCAAAAAAAAAAAAAAGATGGG - Intergenic
1027261347 7:76466896-76466918 CTCTAAAAAAAGAAAGAAATAGG - Intronic
1027312730 7:76965005-76965027 CTCTAAAAAAAGAAAGAAATAGG - Intergenic
1027408013 7:77883015-77883037 TTGTAAAAACAAAAAAAGAATGG + Intronic
1027562526 7:79750130-79750152 CACTAAAAACATAAAAAGATGGG - Intergenic
1027671795 7:81109375-81109397 CTGGAAAAAAAAAAAAAGAAAGG - Intergenic
1028015970 7:85713071-85713093 TTTTAAAATCAGAAAAAGAAAGG - Intergenic
1028129817 7:87157016-87157038 TTGTGAAAACAGTAAAAGATAGG + Intronic
1028333497 7:89624782-89624804 CAGAAAAAAGAAAAAAAGATTGG + Intergenic
1028622457 7:92839764-92839786 CAGTAAAAACAGAAAAACCCAGG - Intergenic
1028678585 7:93497604-93497626 TTGTTAAAACAGAAATAGCTTGG - Intronic
1028713036 7:93932927-93932949 CTGCCAATACAAAAAAAGATTGG - Intergenic
1029117319 7:98244060-98244082 CTCTAAAAAGAAAAAAAAATAGG + Intronic
1029242886 7:99176878-99176900 CTTTACAAACAAAAAAAAATTGG + Intronic
1029386270 7:100245633-100245655 CTCAAAAAAAAAAAAAAGATGGG - Intronic
1029481474 7:100815986-100816008 CTTAAAAAAAAGAAAAAGTTAGG + Intronic
1029982602 7:104893211-104893233 CTCTAAAAAAAAAAAAAAATTGG + Intronic
1030235156 7:107250916-107250938 CTGTAAGAAAAGAAAATAATGGG + Intronic
1030308663 7:108046510-108046532 TTGTCAAAAAAGAAACAGATTGG + Intronic
1030363168 7:108616646-108616668 CTATAAAAAAAAAAAAAAATGGG + Intergenic
1030549173 7:110936768-110936790 CTGTTAAAACAGCAAAGGCTTGG + Intronic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1031123634 7:117748754-117748776 TAGGAAAAACAGAAAAAGTTTGG - Intronic
1031175210 7:118340223-118340245 GTGTGAAAACAGAATAATATAGG + Intergenic
1031358734 7:120821444-120821466 CTGTAAAAATGGAAGAACATAGG + Intronic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1031452255 7:121936721-121936743 CTGTAAGAAAAGGCAAAGATTGG + Intronic
1031454994 7:121968629-121968651 TTTTAAAAAAAAAAAAAGATAGG - Intronic
1031660717 7:124420969-124420991 CTGTAAATTCAGAAATAAATGGG - Intergenic
1031839282 7:126717697-126717719 TTGTAAAAACATAAAAATTTAGG + Intronic
1032416832 7:131742067-131742089 CTGAAAATCCAGATAAAGATGGG + Intergenic
1032655691 7:133927132-133927154 ATGTAAAAAAAAAAAAAAATGGG + Intronic
1032941010 7:136791569-136791591 CTATTAAAAGAGAAAAAGAATGG + Intergenic
1033071012 7:138202378-138202400 CTGTTAAAAAAAAAAAAGGTGGG + Intergenic
1033395712 7:140971928-140971950 CTCAAAAAAAAAAAAAAGATGGG - Intergenic
1033638263 7:143233931-143233953 CTTTAAAAAAAGAAAAAAAAAGG + Intergenic
1034021846 7:147652954-147652976 TTGAAAAAACATAAAAAGGTAGG - Intronic
1034772234 7:153791419-153791441 CTGAAAAAAAAAAAAAAGAAAGG - Intergenic
1035082507 7:156228781-156228803 CTGCATAAAGAGAAAAAGACAGG + Intergenic
1035490143 7:159268845-159268867 CTGTAAAAAGAGGCAAAGAAGGG - Intergenic
1035712894 8:1731930-1731952 TTTTAAAAAAAGAAAAAAATGGG - Intergenic
1035843377 8:2836443-2836465 CTGGAAAAACAGAAATACATTGG + Intergenic
1036545266 8:9762600-9762622 CTGTAACAACAGATAAAATTGGG + Intronic
1036701620 8:11016828-11016850 CTGGAAAAACAGAAGAGGAGAGG - Intronic
1036908703 8:12732687-12732709 TGGTAAAAACAGTAAAATATGGG - Intronic
1037356057 8:18020774-18020796 CTGTATAAATGGAAAATGATTGG - Intronic
1037501925 8:19494866-19494888 CAGTAAAAACAGAAAATGGGCGG + Intronic
1037767281 8:21780051-21780073 CTTAAAAAAAAAAAAAAGATGGG - Intronic
1037897773 8:22669495-22669517 GTGTACAAACTGTAAAAGATAGG - Intergenic
1037954682 8:23045628-23045650 CTGTAAGAAAAGAAAATTATAGG + Intronic
1038279563 8:26151677-26151699 CAGGAAAAACAGCAAATGATGGG + Intergenic
1038678675 8:29646673-29646695 CTTCAAAAAAAGAAAAAGAAAGG + Intergenic
1038799948 8:30740537-30740559 CTGGAAAAAAAAAAAAAGAAAGG + Intronic
1038896347 8:31786853-31786875 CTGTAAAAACCCAAAAGGATTGG - Intronic
1038966315 8:32576746-32576768 TTTTAAAAAGAGAAAAATATAGG - Intronic
1039165980 8:34680460-34680482 CTGAAAAAAAAAAAAAAGGTGGG - Intergenic
1039275437 8:35929952-35929974 ATGTAAAAATAGAAAAAAAACGG - Intergenic
1039295652 8:36149862-36149884 CTACAAAAAGAGAAAATGATGGG - Intergenic
1039490230 8:37942010-37942032 CTTTAAAAAAAAAAAAAGGTCGG + Intergenic
1039633210 8:39134852-39134874 CCTTAAAAAAAGATAAAGATGGG + Intronic
1039646584 8:39290849-39290871 CTGTAGAAACAGAGACAGTTAGG + Intergenic
1039673603 8:39633827-39633849 CTGTAAAAAAAAAAAAAGGTGGG + Intronic
1040346973 8:46513049-46513071 CTATAAAAACTAGAAAAGATGGG + Intergenic
1040775720 8:51041002-51041024 GTGTTAAAAAAGAAAAACATGGG - Intergenic
1040894029 8:52347261-52347283 CTGTAAAAGCAGGAAAAGCTTGG + Intronic
1041172738 8:55161501-55161523 CTGAAAAAACAGAAAAGGGCAGG + Exonic
1041216109 8:55602027-55602049 CTAAACAAAGAGAAAAAGATAGG - Intergenic
1041267878 8:56082751-56082773 CTGTAACCACAGAAAACGAAAGG + Intergenic
1042133103 8:65608741-65608763 CTATAAAAATACAAAAAAATTGG + Intronic
1042520527 8:69706845-69706867 CTGTAAAAAAATAAAGAAATTGG + Intronic
1042744584 8:72094056-72094078 CTGTAAAATAGGAAAAATATAGG - Intronic
1043308019 8:78821253-78821275 ATGTAAGAACAGAAAGAGAAAGG - Intergenic
1043322203 8:79001931-79001953 AAGTAAAAACATAAAAAGAAAGG - Intergenic
1043585085 8:81759467-81759489 TTGTAAATACATAAAAATATTGG + Exonic
1043934632 8:86129509-86129531 CTATAAAAAAGGAAAAAAATTGG + Intronic
1044551481 8:93517507-93517529 CTGGAAAATCTGAAATAGATGGG - Intergenic
1044761384 8:95521185-95521207 CTGGAAAAAAAAAAAAAGAAGGG - Intergenic
1044783356 8:95767007-95767029 CTGTAAGAAAAGAAAATTATAGG + Intergenic
1045099286 8:98828280-98828302 CTGATGAAACACAAAAAGATGGG - Intronic
1045169447 8:99647570-99647592 CTGTAAAAAAAAAAAAAAAAAGG + Intronic
1045280148 8:100743034-100743056 CTTTAAAAAAAAAAAAAGAATGG - Intergenic
1045518518 8:102882287-102882309 CTGCAAAAAAAAAAAAAAATTGG - Intronic
1045860105 8:106806831-106806853 CAGAAAAAAAAAAAAAAGATAGG + Intergenic
1045896261 8:107221520-107221542 GTGTCAAGACAGAAAAAAATAGG - Intergenic
1046001341 8:108424215-108424237 TTCTAGAAATAGAAAAAGATTGG - Intronic
1046295384 8:112212858-112212880 ATGTAAAAAAAAAAATAGATTGG + Intergenic
1046299141 8:112263134-112263156 CTGTAAAAAAAAAAAAAAAAAGG + Intronic
1046313731 8:112473515-112473537 GTTTAAAATCAGATAAAGATTGG + Intronic
1046584960 8:116140061-116140083 CTCAAAAAAAAAAAAAAGATAGG + Intergenic
1046825982 8:118692365-118692387 CTGTAAAAATAAAATAAAATAGG - Intergenic
1046928474 8:119819207-119819229 GTGGTAAAACAGATAAAGATTGG + Intronic
1046968592 8:120194805-120194827 CCATAAAAACAGAGAAAAATGGG + Intronic
1047246125 8:123146683-123146705 CTTTAAAAAAAAAAAAAGGTAGG - Intronic
1047300755 8:123611939-123611961 CTTTAAAAACAAAAAAAGGGAGG - Intergenic
1047684643 8:127292632-127292654 CTGAAAAAAAAAAAAAAAATAGG + Intergenic
1048423181 8:134297276-134297298 CTGTAACAACAGAACAGGGTGGG + Intergenic
1048487339 8:134860495-134860517 CTCTCAAAACAGAAAAAAACAGG - Intergenic
1048667931 8:136685080-136685102 CCCTAAAAACTGAAGAAGATAGG + Intergenic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1049127758 8:140807772-140807794 ATTTAAAAAGATAAAAAGATAGG - Intronic
1049442367 8:142615228-142615250 CTGGAAACACAGAAAAGTATTGG - Intergenic
1050073015 9:1836120-1836142 CTGTTAAGCCAGAAAAAGACTGG - Intergenic
1050233095 9:3549400-3549422 CTGTAAAACAAGGAAAAGAGAGG - Intergenic
1050275682 9:3996316-3996338 CAGAGAAAACAGAAAAATATGGG + Intronic
1050505479 9:6344059-6344081 CTTTAAAAAAAGAAAACTATAGG + Intergenic
1050723543 9:8619638-8619660 CTCTGAGAACACAAAAAGATGGG - Intronic
1050971829 9:11887501-11887523 CTATAGAAAGAGAAAAATATTGG - Intergenic
1051739475 9:20237675-20237697 CATTAAAAACAAAAAAAAATCGG - Intergenic
1051767909 9:20544565-20544587 CTGAAAAAACAGAAAATAATAGG + Intronic
1051857710 9:21588439-21588461 CTGTAAATACAGAAAATAATAGG - Intergenic
1052104222 9:24492453-24492475 TTGTAAATATAGAAAAACATTGG + Intergenic
1052195702 9:25711762-25711784 ATGTCTAAACTGAAAAAGATAGG + Intergenic
1052384263 9:27806257-27806279 TTGGAAAAACAAAAAAGGATGGG - Intergenic
1052391111 9:27879443-27879465 CTGTCAAAACAAAAACTGATTGG - Intergenic
1052419909 9:28230262-28230284 CTGTAAAAAAATAAAAATACAGG + Intronic
1053130386 9:35611248-35611270 CTCAAAAAAAAAAAAAAGATGGG + Intronic
1053158231 9:35794654-35794676 CTGAGCAAAGAGAAAAAGATAGG + Intronic
1053300883 9:36948654-36948676 CAGTAAAAACAGAGAAAGTCTGG + Intronic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1053538387 9:38948334-38948356 CTCAAAAAAAAGAAGAAGATGGG + Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1055228603 9:74032030-74032052 CTTAAAATACAGAAAAAGTTGGG + Intergenic
1055406754 9:75982612-75982634 CAGGAAAAGCAGCAAAAGATAGG - Intronic
1055659259 9:78486026-78486048 ATTTAAAAAGAGAAAAATATAGG - Intergenic
1055754057 9:79538357-79538379 CAGTAAAAAGAGAGAAAGTTTGG + Intergenic
1055783006 9:79840780-79840802 CAATAAAAAAAGACAAAGATAGG - Intergenic
1056019702 9:82429280-82429302 CTCAAAAAAAAAAAAAAGATTGG - Intergenic
1056124751 9:83524229-83524251 TTGTAAAAAGAGAAAAAGGAAGG - Intronic
1056146873 9:83739745-83739767 CTGTAAAAAAAAAAAAAAATAGG + Intronic
1056515078 9:87342647-87342669 CTGGAGAAAGAGAAAAAGAAAGG + Intergenic
1056708628 9:88972075-88972097 CTTTAAAAAAAGAAAAAAACTGG - Intergenic
1057123767 9:92600431-92600453 CTGTACAAACAAGAAAAGTTGGG + Intronic
1057458922 9:95241658-95241680 CTCAAAAAAAAGAGAAAGATTGG - Intronic
1058143263 9:101380916-101380938 CTAAAAAAACACAAAAAAATTGG - Intronic
1058193971 9:101951992-101952014 CTGTAAAAAGAAAGAAAAATAGG + Intergenic
1058427750 9:104890276-104890298 TTTTAAAAAAAGCAAAAGATTGG + Intronic
1059478577 9:114570108-114570130 CTGTAAAAAAAAAAAAACACGGG - Intergenic
1059640281 9:116210020-116210042 GTGTAATAGCAGAAAAAGAGGGG - Intronic
1059983812 9:119801938-119801960 CTGTAAAAATAAGAAGAGATTGG - Intergenic
1060129334 9:121079744-121079766 TTTTAAAAACAAAAAAAGACGGG + Intronic
1060135875 9:121153320-121153342 CTGTGATAAAAGAAAAAGACGGG - Intronic
1061098477 9:128473810-128473832 CTGTAAAAAGAAAATAAGATTGG + Intronic
1185518746 X:720717-720739 CTGCAAAGACAGAAAAAGAGAGG - Intergenic
1186037687 X:5442606-5442628 CTCTAAAAAAATAAAAAGTTAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186213176 X:7271782-7271804 TTGTAAAAAAAAAAAAAGGTTGG + Intronic
1186296259 X:8152058-8152080 CTTTAAAAAAAAAAAAAGAAAGG - Intergenic
1186489198 X:9958330-9958352 CTGTAAAAAAAAAAAAAAAAAGG + Intergenic
1186536148 X:10350613-10350635 AAGTAAAAACACAAAAATATAGG + Intergenic
1186794878 X:13036498-13036520 GAGCAAAAACAGAAAAAGACTGG + Exonic
1187370061 X:18697822-18697844 CTGAAAAAAGAAAAAATGATGGG - Intronic
1188356943 X:29203254-29203276 CAATAAAAACAAATAAAGATAGG - Intronic
1188438309 X:30188196-30188218 CTTTAAAAACAGAAATTAATAGG + Intergenic
1188639480 X:32482130-32482152 ATGTAAAGAAGGAAAAAGATTGG - Intronic
1189031077 X:37451315-37451337 CTGTAAAAACAGCAAAAATGGGG - Intronic
1189143003 X:38626369-38626391 CTTTAAAAATATAAAAAGATTGG + Intronic
1189207169 X:39251651-39251673 CCTTAAAAAAAAAAAAAGATGGG - Intergenic
1189632550 X:42970162-42970184 CAGAAAAAACAAAAAAGGATTGG - Intergenic
1189960287 X:46317997-46318019 CTTTAAAAAAAAAAAAAGGTTGG + Intergenic
1190176436 X:48154554-48154576 CTGAAAATGCAGAAAAAAATGGG - Intergenic
1190181854 X:48198967-48198989 CTGAAAATACAGAACAAAATGGG + Intronic
1190194897 X:48308454-48308476 CTGAAAATACAGAACAAAATGGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190661334 X:52656656-52656678 CTGAAAATACAGAAAACAATAGG + Intronic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1191891434 X:65946774-65946796 CTCTAGAAACTGGAAAAGATTGG - Intergenic
1191898102 X:66014874-66014896 CAGTAAAAAATGAAAACGATAGG - Intergenic
1192128294 X:68523137-68523159 CTTTAAAAAAAAAAAAAGGTTGG + Intronic
1192658402 X:73016718-73016740 TTGTAAAAATAGAAAAAAAAAGG - Intergenic
1192868866 X:75166335-75166357 TTGTAATAACAGATAAAAATAGG + Intergenic
1192876823 X:75238367-75238389 CAGTTAAAACAGATAAAGAGGGG + Intergenic
1192946764 X:75971528-75971550 ATGTAAAGAGAGAAAAATATAGG + Intergenic
1193189032 X:78547674-78547696 TTGGTAAAACAGAGAAAGATAGG - Intergenic
1193240853 X:79167454-79167476 CTGGAAAAAAAAAAAAAGTTAGG - Intergenic
1193303427 X:79920497-79920519 CTCTAAAAACAGAAACAAGTCGG - Intergenic
1193478732 X:81999820-81999842 CAGTAAAAACAGACAAAAATGGG - Intergenic
1193559978 X:83006741-83006763 CTATAAAATCAGTAAAAAATTGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194574087 X:95589966-95589988 TTGTTAAATCAGAAAAAAATAGG - Intergenic
1194608228 X:96007403-96007425 ATGGAAAAACAGAAAAAAGTAGG + Intergenic
1194615703 X:96100873-96100895 ATGAAAAAATAGAAAAAGAAGGG - Intergenic
1194804306 X:98308433-98308455 CTTGGAAAACAGAAAAAGGTAGG + Intergenic
1194912107 X:99658227-99658249 AGGAAAAAACAGAAAAAGAGAGG + Intergenic
1194923005 X:99791106-99791128 CAGTAAAAAAAGACAAAGAAGGG - Intergenic
1195012373 X:100745562-100745584 CTTTAAAAAAATAAGAAGATTGG + Intergenic
1195096866 X:101510721-101510743 CAATAAAAAAAGAAAAGGATAGG - Intronic
1195236397 X:102903229-102903251 CTGTAAAAAGAAAGAAAGAGAGG + Intergenic
1195472546 X:105247519-105247541 ATGTAAAAAAAGAAAGACATGGG - Intronic
1195735007 X:108003182-108003204 CAGTAAAAAAAGACAAAGAAGGG + Intergenic
1195795792 X:108645504-108645526 TTGTAAAAAAAAAAAAAGATGGG - Intronic
1195993950 X:110712700-110712722 CTCTAAAAAAAAAAAAAAATTGG + Intronic
1196348168 X:114693053-114693075 CTGTAATAACATAAAAAAACTGG - Intronic
1196651780 X:118175319-118175341 CTGTAAATATAAAAAATGATTGG + Intergenic
1196787677 X:119435151-119435173 TTTTAAAAAAAGAAAAAAATCGG + Intronic
1197022056 X:121703176-121703198 CTTTAACAACAGAGAAAGAGAGG - Intergenic
1197165092 X:123368397-123368419 AGGTAAAAGCAGAAAGAGATGGG - Intronic
1197323203 X:125059431-125059453 CTACAAAAACAAAAAAAAATGGG - Intergenic
1197331281 X:125156104-125156126 CTGTCAAAACAAAAAAATACAGG - Intergenic
1197498240 X:127212098-127212120 CAGTAAGAACAGAAATAGATAGG - Intergenic
1197673103 X:129300127-129300149 CTGTAACAACATTAAGAGATGGG + Intergenic
1197833505 X:130670725-130670747 TTCTAAAAAAAAAAAAAGATGGG + Intronic
1198342960 X:135732647-135732669 CTTTAAAAGCAGACAGAGATGGG + Intergenic
1198345029 X:135750648-135750670 CTTTAAAAGCAGACAGAGATGGG - Intergenic
1198525394 X:137495275-137495297 CTCTCAAAACAGAAAACTATAGG + Intergenic
1198635745 X:138698460-138698482 TTGCAAGAACAGAAAAACATTGG + Intronic
1198678186 X:139153253-139153275 CTATAAAACCAGAAATAGCTGGG - Intronic
1198712674 X:139522943-139522965 CAATAAAAAAAGAAAAAGAGAGG + Intergenic
1198913902 X:141644852-141644874 CTGTAAAGGCAGAAAAACAAAGG + Intronic
1199329781 X:146545334-146545356 CTGTAAAAAAAAAAAGAGGTTGG + Intergenic
1200130593 X:153842161-153842183 AGGCAAAAACAGAACAAGATAGG - Intergenic
1200176287 X:154118824-154118846 CTGTAAAAAAAGGAAAAGGAAGG - Intergenic
1200355662 X:155547713-155547735 TTGTAAAAAAAAAAAAAGATGGG + Intronic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201379715 Y:13361460-13361482 ATGGCAAGACAGAAAAAGATGGG + Intronic
1201394885 Y:13537521-13537543 CAGTAAAAAAGGACAAAGATGGG + Intergenic
1201489071 Y:14522632-14522654 CTGTACTAACAGACAGAGATGGG - Intronic
1201633628 Y:16097596-16097618 CTCTAAAAAAATAAAAAGTTAGG + Intergenic
1202062472 Y:20901958-20901980 CTGCAATATCAGAAAAAAATGGG - Intergenic