ID: 1098621178

View in Genome Browser
Species Human (GRCh38)
Location 12:72601194-72601216
Sequence TGATAGGTTTAAAACTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 1, 1: 0, 2: 11, 3: 126, 4: 590}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098621176_1098621178 -3 Left 1098621176 12:72601174-72601196 CCAACTGTCTGGGATGACTTTGA 0: 1
1: 0
2: 5
3: 67
4: 528
Right 1098621178 12:72601194-72601216 TGATAGGTTTAAAACTTCAGTGG 0: 1
1: 0
2: 11
3: 126
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098621178 Original CRISPR TGATAGGTTTAAAACTTCAG TGG Intronic
901751288 1:11411142-11411164 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
902090788 1:13901572-13901594 TGAAAGGTTTGAAATTCCAGAGG + Intergenic
904863195 1:33555988-33556010 TGATGGGTTCAAGACTTCATTGG + Intronic
905782736 1:40727091-40727113 TGAGGGGTTTGAGACTTCAGTGG - Intronic
907056865 1:51377365-51377387 TGATGGATTCAAGACTTCAGTGG + Intronic
907366871 1:53968977-53968999 TGAGGGGTTCAAAACTTCAGTGG - Intergenic
907548218 1:55281480-55281502 TGAGGGGTTGAAGACTTCAGTGG + Intergenic
907633055 1:56104192-56104214 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
907916920 1:58879182-58879204 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
908333154 1:63091765-63091787 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
908336104 1:63125339-63125361 TTATAAGTTTAAAATATCAGTGG - Intergenic
909322221 1:74303887-74303909 TGAGGGATTTAAGACTTCAGTGG + Intronic
909767358 1:79372803-79372825 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
909796577 1:79746791-79746813 TGAGGAGTTTAAGACTTCAGTGG - Intergenic
909916009 1:81320272-81320294 TGAGGGGTTCAAGACTTCAGTGG - Intronic
910151429 1:84151824-84151846 TGAGCGGTTTAAAATTTCAGTGG - Intronic
910163122 1:84295313-84295335 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
910972727 1:92872881-92872903 TGAGAGGTTAAAAACCTCATTGG - Intronic
911296754 1:96126843-96126865 TGATAGGTTCAAGATTTTAGTGG + Intergenic
911778119 1:101841115-101841137 TGATAGTTCTAAGGCTTCAGGGG + Intronic
911833767 1:102589529-102589551 TGAGGGGTTCAAAATTTCAGTGG - Intergenic
912051003 1:105527463-105527485 GGGTAGGTTTATATCTTCAGAGG + Intergenic
912902412 1:113666580-113666602 TGAGAGGTTCAAGACTTCAGTGG - Intronic
913344965 1:117799533-117799555 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
913679526 1:121175611-121175633 TGAGAGGTTTTAGACTTCAGTGG + Intronic
914031359 1:143963257-143963279 TGAGAGGTTTTAGACTTCAGTGG + Intronic
914158087 1:145104706-145104728 TGAGAGGTTTTAGACTTCAGTGG - Intronic
914960346 1:152200373-152200395 TGAGAGATTCAAGACTTCAGTGG - Intergenic
915845203 1:159256018-159256040 TGAAAGGTTCAAGACTTCAGTGG - Intergenic
916553027 1:165867752-165867774 TGAGGGGTTCAAGACTTCAGTGG - Intronic
916799827 1:168206210-168206232 TGAGAGGTTCAGGACTTCAGTGG - Intergenic
917193021 1:172438409-172438431 TGAGAGGTTCGAGACTTCAGCGG + Intronic
917298986 1:173553063-173553085 TGAGGGGTTCAAGACTTCAGTGG + Intronic
917950996 1:180036071-180036093 TGAGGGGTTCAGAACTTCAGTGG + Intronic
918123797 1:181564514-181564536 TGAGGAGTTGAAAACTTCAGTGG - Intronic
918632426 1:186733801-186733823 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
919113399 1:193248702-193248724 TGAGGGGTTCAAGACTTCAGTGG + Intronic
919184917 1:194133282-194133304 TGAGGGGTTCAGAACTTCAGTGG - Intergenic
919350086 1:196440217-196440239 TGATGGGTTTAAAAATCCTGTGG - Intronic
920024198 1:202980691-202980713 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
920466831 1:206194156-206194178 TGAGAGGTTTTAGACCTCAGTGG + Intronic
920620030 1:207536282-207536304 TGAGAGGTTCAAGACTTCAGCGG + Intronic
920621812 1:207554837-207554859 TGAGAGGTTCAAGACTTCAGCGG + Intronic
920623437 1:207571932-207571954 TGAGAGGTTCAAGACTTCAGCGG + Intronic
920636006 1:207704183-207704205 TGAGAGGTTCAAGACTTCAGCGG + Intronic
921224240 1:213001933-213001955 TGAGGGGTTCAAGACTTCAGGGG - Intronic
921226112 1:213021165-213021187 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
921233275 1:213096336-213096358 TGAGGGGTTCAAGACTTCAGTGG - Intronic
921828962 1:219705616-219705638 TGAGGGGTTCAAGACTTCAGTGG + Intronic
921885610 1:220302249-220302271 TGCTAGATTTTAAACTCCAGGGG - Intergenic
922012791 1:221608181-221608203 TGAGGGGTTTAAGACTTGAGTGG + Intergenic
922333460 1:224598200-224598222 TGAGGGGTTCAAGACTTCAGTGG + Intronic
922588809 1:226756849-226756871 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1064008365 10:11715515-11715537 TTGGTGGTTTAAAACTTCAGAGG + Intergenic
1064071356 10:12231115-12231137 TCATAAATTTAAAATTTCAGTGG - Intronic
1064099811 10:12453753-12453775 TGTTACATTTAAAACTTTAGGGG - Intronic
1064950056 10:20838310-20838332 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1065263404 10:23950440-23950462 TTATGTGTTTAAAACCTCAGTGG - Intronic
1065546400 10:26825952-26825974 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1065687195 10:28298076-28298098 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1066056853 10:31689984-31690006 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1066293476 10:34034646-34034668 TGATAGGTTTAAAAGCCCATAGG - Intergenic
1069303907 10:66944433-66944455 TGAGAGGTTCAAGACTTCAGTGG - Intronic
1069946931 10:71993406-71993428 TGAGGGGTTTAAGACTTCAGTGG - Intronic
1070489314 10:76961247-76961269 TGAGGGCTTTAAGACTTCAGTGG + Intronic
1071132631 10:82412991-82413013 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1071377798 10:85027879-85027901 TGATAATTTTAAAACCTCAAAGG - Intergenic
1071438981 10:85673085-85673107 TGAGAGGTTCAAGACTTCAGTGG + Intronic
1071851549 10:89576470-89576492 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1071871689 10:89802409-89802431 TGACAGGTTCAAGACTTCAGTGG - Intergenic
1072184964 10:93028336-93028358 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1072325601 10:94295500-94295522 GGAGGGGTTTAAAACCTCAGTGG - Intronic
1073067326 10:100770485-100770507 GCATAGGTTTAAAAATTAAGGGG - Intronic
1073598886 10:104827082-104827104 TGAGGGGTTTAAGACTTCAGTGG - Intronic
1073615016 10:104985431-104985453 TGAGAGGTTCAAGACTTCAGTGG - Intronic
1073696198 10:105871456-105871478 TGAGGAGTTTAAGACTTCAGTGG - Intergenic
1074429930 10:113385804-113385826 TGAGATATTTAAAACTTGAGTGG + Intergenic
1075841191 10:125505482-125505504 TGAGGGGTTTAAGACTTCAGTGG + Intergenic
1076050149 10:127326574-127326596 TGACCGGTTCAAGACTTCAGAGG - Intronic
1077757040 11:5042601-5042623 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1078193552 11:9114621-9114643 TGACAGGTTCAAGATTTCAGTGG - Intronic
1078847797 11:15136760-15136782 TGAGAGTTTCAAAACTTCAGTGG - Intronic
1079325772 11:19490643-19490665 TGAGAGGTTCAAGACCTCAGTGG - Intronic
1079784983 11:24660242-24660264 TTATTGGTTTAAAACTACATGGG - Intronic
1079933039 11:26588853-26588875 TGAAACATTTAAAACTTAAGAGG - Intronic
1080143849 11:28955440-28955462 TGAGAGATTCAAAACTTTAGTGG + Intergenic
1081161390 11:39754434-39754456 TGAGAGGTTCAAGACTTCAGTGG - Intergenic
1081162098 11:39761581-39761603 TGATAGGGAGAAAACTTTAGCGG - Intergenic
1081232380 11:40601458-40601480 TCATATGTTTGCAACTTCAGAGG + Intronic
1081256530 11:40903669-40903691 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1081457412 11:43237946-43237968 TGAGAGGTTCAAGATTTCAGTGG + Intergenic
1083039863 11:59675582-59675604 TGAGAGGTTCAAGACTTCGGTGG - Intergenic
1084011742 11:66354229-66354251 TGAAGGGTTCAAGACTTCAGTGG + Intronic
1084138073 11:67202067-67202089 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1085373073 11:76029565-76029587 TGAAGGGTTCAAGACTTCAGTGG + Intronic
1086774980 11:90819447-90819469 TGAGTAGTTTAAGACTTCAGTGG - Intergenic
1087064473 11:94014479-94014501 TGAGAGGTTCAAGACTTCAATGG + Intergenic
1087064732 11:94017188-94017210 TGAGAGGTTCAAGACTTCAATGG + Intergenic
1087339812 11:96889662-96889684 TGAGAGGTTCAAGACTTCAATGG - Intergenic
1088389278 11:109296452-109296474 TGAGGGTTTTAAGACTTCAGTGG - Intergenic
1089311962 11:117564161-117564183 AGCTTGGTTTAAAGCTTCAGAGG + Intronic
1090442420 11:126735500-126735522 TGAGAGGTTTTATTCTTCAGTGG - Intronic
1091093843 11:132798607-132798629 TGAGGGGTTTAAGACTTCAATGG - Intronic
1091869662 12:3878116-3878138 TGAGGGATTTAAGACTTCAGTGG - Intergenic
1092038089 12:5358443-5358465 TGAGGAGTTCAAAACTTCAGTGG - Intergenic
1092364705 12:7867394-7867416 TGATGGGTTCAAGACTTAAGTGG + Intronic
1092382542 12:8009365-8009387 TGATGGGTTCAAGACTTGAGTGG + Intergenic
1093137797 12:15472928-15472950 TTCTAGTTATAAAACTTCAGAGG + Intronic
1093435041 12:19127053-19127075 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1093450844 12:19311728-19311750 TGAGGGGTTTAGAACTTCAGTGG - Intronic
1093658459 12:21724935-21724957 CGAGAGGTTCAAGACTTCAGTGG + Intronic
1093662179 12:21769727-21769749 TGAGGGGTTCAATACTTCAGTGG + Intronic
1093677378 12:21959384-21959406 TAAAAAGTTTAAAACTTCATGGG - Intergenic
1094167398 12:27456719-27456741 TGGTAGGTTTTATACATCAGTGG - Intergenic
1094205455 12:27835211-27835233 TGAGGGGTTCAAGACTTCAGAGG + Intergenic
1094280000 12:28726170-28726192 CGAGGGGTTCAAAACTTCAGTGG - Intergenic
1094440012 12:30464790-30464812 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1094632738 12:32192792-32192814 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1094721484 12:33069120-33069142 TGAGGGGTTCAAACCTTCAGTGG + Intergenic
1095719290 12:45383318-45383340 TGAGAAGTTCAAGACTTCAGTGG - Intronic
1096013532 12:48244629-48244651 TGAGTGGTTCAAGACTTCAGTGG + Intergenic
1097327197 12:58290164-58290186 CGCTAGTTTTCAAACTTCAGGGG - Intergenic
1097355676 12:58598633-58598655 TGATATTTTTAAAACTTCAGTGG - Intronic
1097439247 12:59589293-59589315 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1097518280 12:60634982-60635004 TGAGGGGTTCACAACTTCAGTGG + Intergenic
1097659425 12:62412781-62412803 TGAGAAGTTCAAAACCTCAGTGG - Intronic
1098391024 12:69970048-69970070 AGATTGGTCTAAAACTTCAAAGG - Intergenic
1098621178 12:72601194-72601216 TGATAGGTTTAAAACTTCAGTGG + Intronic
1098688034 12:73450829-73450851 TGATAGGTTTAAACCTGGTGAGG + Intergenic
1098800551 12:74951981-74952003 TTAAAGGTTCAATACTTCAGTGG - Intergenic
1099162095 12:79254776-79254798 TGAGAGGTTCAGAACTTCAGTGG + Intronic
1099633044 12:85175185-85175207 TTATTGGTTTACCACTTCAGTGG - Intronic
1100021841 12:90078282-90078304 TGATAGATTTTAAAATTAAGTGG + Intergenic
1100468332 12:94868811-94868833 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
1100791028 12:98130227-98130249 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
1100927155 12:99561746-99561768 TGAGAGGTTCAAGACTTCAGTGG - Intronic
1101685237 12:107012826-107012848 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1105417890 13:20228959-20228981 TGATTGTTTTAAAACTTCTTAGG + Intronic
1105652400 13:22393652-22393674 TAATAGCATTAAAACTTAAGAGG + Intergenic
1105998480 13:25695789-25695811 TGAAAAGTTTGAGACTTCAGTGG - Intronic
1106071758 13:26418931-26418953 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1107287175 13:38807080-38807102 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1107461271 13:40606141-40606163 TGATAGGTTTAAAACCACCTTGG - Intronic
1107772364 13:43802463-43802485 TGATAGTTTTAAATTTTGAGAGG - Intergenic
1108331028 13:49384372-49384394 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1108504056 13:51094129-51094151 TGTTATGTCTAAAAGTTCAGAGG - Intergenic
1109080606 13:57895116-57895138 TGAGAGGTTCAAGACTTTAGTGG + Intergenic
1109259465 13:60126095-60126117 TGGTTAGTTGAAAACTTCAGAGG + Intronic
1109889680 13:68593040-68593062 TGACATCATTAAAACTTCAGAGG - Intergenic
1109984894 13:69967355-69967377 TGAAGGGTTTAAGACATCAGTGG + Intronic
1110382423 13:74868756-74868778 TGAGGGTTTTAAGACTTCAGTGG - Intergenic
1110447348 13:75600994-75601016 TGAGGGGTTTAAGACTTCATTGG + Intronic
1110640201 13:77814870-77814892 TGAGGGGTTTGAGACTTCAGTGG + Intergenic
1110640510 13:77818757-77818779 AGAGAGGCTTAAAACTGCAGAGG + Intergenic
1110724006 13:78798456-78798478 TGAGGGGTTCAAGACTTCAGCGG - Intergenic
1110786259 13:79530821-79530843 TGAGGGGTTTAAGACTTCAGTGG - Intronic
1110963967 13:81667276-81667298 TGATATGTTGAGAACTTCTGAGG + Intergenic
1111146221 13:84184301-84184323 TGAGAGGTTTAAGACATCAGTGG - Intergenic
1111172744 13:84550064-84550086 TGAAGGATTCAAAACTTCAGTGG - Intergenic
1111278335 13:85983246-85983268 TGAATGGTTCAGAACTTCAGTGG - Intergenic
1111437545 13:88229955-88229977 TGAGTGGTTCAATACTTCAGTGG - Intergenic
1112653290 13:101421424-101421446 TGAGGGGTTCAAAACTTCAGTGG - Intergenic
1112846881 13:103654609-103654631 AGATGGTTTTAAAACTGCAGAGG + Intergenic
1113367336 13:109688543-109688565 TGATATTAGTAAAACTTCAGAGG - Intergenic
1114368698 14:22060118-22060140 TGAAAGGTTCAAGACTTCAGTGG + Intergenic
1114886082 14:26853335-26853357 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1115121474 14:29942262-29942284 TGATGGGTTTCAGACTTCTGTGG + Intronic
1115379035 14:32712786-32712808 TGAGGGGTTCAACACTTCAGTGG - Intronic
1115486910 14:33919585-33919607 TGAGAGGTTTAAGACTCCAGTGG + Intergenic
1116193838 14:41696085-41696107 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1116299898 14:43165148-43165170 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1116332066 14:43609883-43609905 TGGTTGCTTTAAAAATTCAGTGG + Intergenic
1116476044 14:45340912-45340934 TGAAAGCTTCAAAACTTCAGTGG - Intergenic
1116562319 14:46395963-46395985 TGAGGGGTTAAAGACTTCAGTGG + Intergenic
1116667902 14:47800923-47800945 TGCTATGTTTTTAACTTCAGGGG - Intergenic
1116687907 14:48065891-48065913 TGAGAGGTTCAATATTTCAGTGG - Intergenic
1116873184 14:50086950-50086972 TTATAGTTTTAACACTTAAGAGG + Intronic
1117887119 14:60376395-60376417 TGAGGGGTTTAAGACTTCAGTGG + Intergenic
1118445395 14:65846464-65846486 AGTTAGTTTTTAAACTTCAGAGG - Intergenic
1118655998 14:67949525-67949547 TGAAGGTTTTAAGACTTCAGTGG - Intronic
1119005009 14:70917160-70917182 TGAGGGGTTTAAGACTTCAGTGG - Intronic
1119091697 14:71788376-71788398 TGAGAGGCTGAAGACTTCAGTGG + Intergenic
1119964136 14:78894516-78894538 TGAAGGGTTCAAAACATCAGTGG - Intronic
1120152368 14:81051317-81051339 TGAGGGGTTAAAAACTTCAGTGG - Intronic
1120303424 14:82737103-82737125 TGAGAGGATTAGAACTCCAGAGG - Intergenic
1120430788 14:84411772-84411794 TGAGGGGTTCAAAACTTTAGTGG + Intergenic
1120577575 14:86202427-86202449 TGAGGGGTTCAAAACTTCAGTGG + Intergenic
1122481462 14:102050065-102050087 TCACAGGTTTGAAACTTCAAGGG + Exonic
1122557526 14:102589781-102589803 TGACAGGTTGAAAGCTGCAGAGG + Intergenic
1122662342 14:103305735-103305757 TGAGGGGTTTGAGACTTCAGTGG - Intergenic
1122714963 14:103690691-103690713 CTTTAGCTTTAAAACTTCAGGGG + Intergenic
1122765290 14:104065204-104065226 TAATATGTTTTAAACTTAAGTGG + Intergenic
1125875648 15:43141829-43141851 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1126213433 15:46126776-46126798 TGAAGGGTTTAAGTCTTCAGTGG + Intergenic
1127113755 15:55702949-55702971 AGATAGGTTTAGAATGTCAGGGG - Intronic
1127447025 15:59073640-59073662 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1127948701 15:63782853-63782875 TGAGAGGTTCAAGACTTCAGTGG + Intronic
1128174071 15:65538367-65538389 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1128629201 15:69246194-69246216 TGAGGGGTTCAAAACTTCAGTGG - Intronic
1128969681 15:72096841-72096863 TGATGGCTTCAAGACTTCAGTGG + Intronic
1129090181 15:73141638-73141660 AGTGAGGTTTAAAACTTAAGTGG - Intronic
1129948924 15:79568671-79568693 TGAAGGGTTCAAGACTTCAGTGG + Intergenic
1129991255 15:79965425-79965447 CGATATTTTTAAAACTTGAGGGG - Intronic
1130408051 15:83620181-83620203 TGAAGGGCTTAAGACTTCAGTGG - Intergenic
1131219293 15:90568075-90568097 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1131955054 15:97726525-97726547 AGACAGGTATAAAACATCAGTGG - Intergenic
1132228025 15:100158477-100158499 TGTAAGCTTAAAAACTTCAGAGG - Intronic
1132292099 15:100710985-100711007 CGATAGATTTAACACTTCAGAGG - Intergenic
1133512832 16:6477098-6477120 TGAAGGGTTCAAGACTTCAGTGG - Intronic
1133865458 16:9637802-9637824 TGACAGGTTACAAACTACAGAGG - Intergenic
1135651375 16:24209446-24209468 TGATAAGTTCAAAATTCCAGAGG - Intronic
1137261486 16:46833500-46833522 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1137465970 16:48709786-48709808 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1138073122 16:54013197-54013219 TGAGGGGCTTAAGACTTCAGTGG + Intronic
1138246787 16:55473121-55473143 TCAGAGGTTCAAGACTTCAGTGG - Intronic
1138518252 16:57551641-57551663 TGAGGGGTTCAAAACTTCAGTGG - Intronic
1138835122 16:60425459-60425481 TGGTAGGTTTAAAATGTTAGAGG + Intergenic
1139148347 16:64349881-64349903 TTATACTTTTAACACTTCAGTGG - Intergenic
1140595698 16:76407531-76407553 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1141250480 16:82352222-82352244 TAAAAGGTTTAAGACTTCAGTGG - Intergenic
1141304612 16:82850297-82850319 TGAGAGGTTCAAGACTTCAGTGG + Intronic
1142479627 17:211036-211058 TCATAGGTGTAATACTTCAGGGG + Intergenic
1144136628 17:12301471-12301493 TGATAGCTCTCAGACTTCAGGGG + Intergenic
1144324615 17:14167135-14167157 TGAGGAGTTTAATACTTCAGTGG + Intronic
1145277617 17:21443233-21443255 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
1145713887 17:27001052-27001074 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
1146817455 17:35954315-35954337 TGAGAGGTTCAAGACTTCAGTGG - Intergenic
1147532664 17:41294323-41294345 TGATATATTTAAAACCCCAGAGG + Intergenic
1148692425 17:49538028-49538050 TGAGGGGTTTAACACTTCAGTGG - Intergenic
1149147934 17:53520248-53520270 TGAGAGGTTCAAGATTTCAGTGG - Intergenic
1150198966 17:63333352-63333374 AGAGAGGTTCAAGACTTCAGTGG + Intronic
1150833771 17:68546310-68546332 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1153087469 18:1304285-1304307 TGATAGTTTTAATTTTTCAGGGG + Intergenic
1153270464 18:3316127-3316149 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1153292583 18:3516072-3516094 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1153492716 18:5666127-5666149 TGAAGGGTTCAAGACTTCAGAGG - Intergenic
1153614625 18:6923093-6923115 TGTTATGAATAAAACTTCAGTGG - Intergenic
1153877846 18:9391300-9391322 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1154096479 18:11421035-11421057 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1155102203 18:22622561-22622583 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1155233589 18:23797311-23797333 TGATTGGTTGTAAATTTCAGTGG - Intronic
1155266012 18:24094317-24094339 TGAGAGGTTCAAGACTTCAGTGG - Intronic
1155480572 18:26283040-26283062 TGAGGGGTTCAGAACTTCAGTGG - Intronic
1155580126 18:27295377-27295399 TGAGAAGTTTGAGACTTCAGTGG - Intergenic
1155809853 18:30218445-30218467 TGACAGATTTAACACTTCAGTGG - Intergenic
1155855864 18:30833754-30833776 TGAGAGATTAAAAACTCCAGGGG + Intergenic
1155861412 18:30905496-30905518 TTAGAGGTTGAAAAGTTCAGAGG + Intergenic
1156181902 18:34614594-34614616 TGAGGGGTCCAAAACTTCAGTGG + Intronic
1156647823 18:39187813-39187835 TGATACATCTAAAACTTCAGTGG - Intergenic
1158211960 18:55061260-55061282 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
1159656963 18:71041597-71041619 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1159740846 18:72168155-72168177 TGAGAGGTCTAATATTTCAGTGG + Intergenic
1159906111 18:74093710-74093732 TGAGAGGTTCAAGACTTCACTGG - Intronic
1160497150 18:79382397-79382419 TTTTAGGTTTACAACTTCTGAGG - Intergenic
1164901093 19:31924691-31924713 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1164940351 19:32247924-32247946 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1165686646 19:37827461-37827483 TCAGAGGTTCAAGACTTCAGTGG + Intergenic
1168323468 19:55524662-55524684 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1168533331 19:57147843-57147865 TGAGGGGTTCAAAAATTCAGTGG + Intergenic
925081612 2:1072891-1072913 TGAGGGATTTAAGACTTCAGTGG + Intronic
925153117 2:1630180-1630202 TGAGGGGTTTAAGACTTCAGTGG + Intergenic
925871328 2:8273678-8273700 TGAGGGGTTCAAAACTTCTGTGG - Intergenic
925954384 2:8948110-8948132 TGAGGGGTTCAAGACTTCAGTGG + Intronic
926493392 2:13553949-13553971 TGAGGGGTTTAAAACTTCAGTGG - Intergenic
927322333 2:21762139-21762161 TGAGAGGTTCAAGATTTCAGTGG - Intergenic
927396547 2:22657600-22657622 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
927652566 2:24920931-24920953 TGATAGGTTTAACTATTCAAAGG - Intergenic
928050527 2:27989694-27989716 GGATAGTTGTAAAAATTCAGTGG + Intronic
928227274 2:29462005-29462027 TGAGGGGTTTAAGACTTCATTGG + Intronic
928657361 2:33466370-33466392 TGAGGGGTTTAAGATTTCAGCGG + Intronic
929339524 2:40797437-40797459 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
929340332 2:40808044-40808066 TGATACTTATAAAATTTCAGCGG + Intergenic
929520537 2:42646556-42646578 TGAAGGGTTTACGACTTCAGTGG + Intronic
929529604 2:42739975-42739997 TGAAAGGTTCAGGACTTCAGTGG - Intronic
929840572 2:45458085-45458107 TGATAGGTTTAAAATTATAATGG - Intronic
929973555 2:46608399-46608421 TGAGAGGTTCAGGACTTCAGTGG - Intronic
930351284 2:50258529-50258551 TGACAGGCTCAAGACTTCAGTGG - Intronic
930583247 2:53237995-53238017 TGATGGGTTAAAGACTTCAGTGG + Intergenic
930799911 2:55433281-55433303 TGAGGGGTTCAAGACTTCAGGGG - Intergenic
930919549 2:56735517-56735539 TCAGGGGTTTAAAACTTTAGTGG + Intergenic
931498110 2:62833970-62833992 TGAGGGGTTTAAGACTTCAGTGG + Intronic
931499775 2:62853486-62853508 TGAGACGTTCAAGACTTCAGTGG - Intronic
931687869 2:64810102-64810124 TGAAGAGTTTAAACCTTCAGGGG + Intergenic
932107215 2:68955011-68955033 TAGTAGGTCTAAAACTTCCGTGG + Intergenic
933082250 2:78005392-78005414 TGATATGTTTTAAACTTTTGTGG + Intergenic
933219735 2:79675022-79675044 TGTTATGTTTAAAAAATCAGAGG + Intronic
933301935 2:80550776-80550798 TGAAGGGTTCAAGACTTCAGTGG - Intronic
933414313 2:81966560-81966582 TGAAAGGTTTAATACTTCAGTGG + Intergenic
933576134 2:84070659-84070681 TCAGAGATTTAAATCTTCAGGGG - Intergenic
933626628 2:84608218-84608240 TGAGAGATTCAAGACTTCAGTGG - Intronic
933906424 2:86898109-86898131 TGAGGGGCTCAAAACTTCAGTGG + Intergenic
934043969 2:88155970-88155992 TGAAGGGTTCAAGACTTCAGTGG + Intergenic
934169478 2:89327840-89327862 TGTTAGGTTTAAAAGTTGCGTGG - Intergenic
934197816 2:89854745-89854767 TGTTAGGTTTAAAAGTTGCGTGG + Intergenic
934691340 2:96362324-96362346 TGAGGGGTTCAAGACTTCAGTGG + Intronic
934737459 2:96697031-96697053 TGAGAGTTTTAAAACTCCTGAGG + Intergenic
934790153 2:97052621-97052643 TGTTAGGTTTAAAAGTTCCATGG - Intergenic
934816317 2:97329916-97329938 TGTTAGGTTTAAAAGTTCCATGG + Intergenic
934821379 2:97378568-97378590 TGTTAGGTTTAAAAGTTCCATGG - Intergenic
934869708 2:97852104-97852126 TGATAGGGATAAAGCTTTAGTGG + Intronic
935176196 2:100651242-100651264 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
935776124 2:106473635-106473657 TGAGGGGCTCAAAACTTCAGTGG - Intergenic
935796801 2:106650118-106650140 TAAGGGGTTTAAAACTTCAGTGG - Intergenic
936005228 2:108881014-108881036 TGAGGGGTTTAAGACTTCAGTGG + Intronic
936365743 2:111853573-111853595 TGAGGGGCTCAAAACTTCAGTGG - Intronic
936920345 2:117682288-117682310 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
937161047 2:119760803-119760825 TAACAGGCTTAAAACTTCAATGG - Intronic
937174134 2:119909809-119909831 TGAGGGGGTTAAGACTTCAGGGG + Intronic
937461521 2:122092271-122092293 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
937471429 2:122176998-122177020 TGATGGGTGTAAAACCTCAATGG + Intergenic
937830237 2:126412208-126412230 TGATGGGTTCAAGATTTCAGTGG - Intergenic
937950599 2:127384535-127384557 TGAGGGGTTTAAGACTTCAGTGG + Intronic
938022296 2:127915936-127915958 CGAGAGGTTCAAGACTTCAGTGG - Intergenic
938158727 2:128964196-128964218 TGAGGAGTTTAAAACTTCAGTGG + Intergenic
938311401 2:130291087-130291109 TGAGAGGTTCAGGACTTCAGTGG - Intergenic
938364344 2:130722574-130722596 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
939486473 2:142818558-142818580 TGAGAAGTTCAAGACTTCAGTGG - Intergenic
939933548 2:148260451-148260473 TAATGAGTTCAAAACTTCAGTGG - Intronic
940126965 2:150337026-150337048 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
940841493 2:158587224-158587246 TAATACTTTTAAAAATTCAGAGG + Intronic
941727536 2:168879558-168879580 TGAGAGGTTCAAGACTTCAATGG - Intronic
941801711 2:169667026-169667048 TGAGGGGTTCAAGACTTCAGTGG - Intronic
942258796 2:174136565-174136587 TGAGAGGCTCAAGACTTCAGTGG - Intronic
942540032 2:177006537-177006559 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
942614758 2:177779731-177779753 TGAAGGGTTTAAGACTTCAGTGG - Intronic
943084065 2:183290946-183290968 TGATGGGTTGAAGACCTCAGTGG + Intergenic
943258033 2:185621907-185621929 TGGTATGTTTAAAACTACATGGG - Intergenic
943292923 2:186098325-186098347 AGAGTGGTTTAAAACTTCGGAGG + Intergenic
943672073 2:190673578-190673600 TTACAGATTTAAAACTTCACGGG + Intronic
943993125 2:194722898-194722920 TGTTAGGCTAAAAACATCAGTGG - Intergenic
944338591 2:198567645-198567667 TGAGTGGTTCAAGACTTCAGTGG + Intronic
944720187 2:202416128-202416150 TGATAGGTTAAAGACTTCAGTGG + Intronic
944956901 2:204822189-204822211 TGAGAGGTTCAAGACTTCAGTGG + Intronic
945004272 2:205386896-205386918 TTATTGGTTTAAAAATTAAGAGG - Intronic
945189427 2:207171154-207171176 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
945330500 2:208534374-208534396 TGAGGGGTTCAAGACTTCAGTGG + Intronic
945557843 2:211301159-211301181 GGAGAGGTTTAAAACTAGAGCGG + Intergenic
945674382 2:212838085-212838107 TGAGGGGTTTAAAACTTTAGTGG - Intergenic
945772117 2:214057045-214057067 TGAGAAGTTCAAAACTCCAGTGG - Intronic
945830106 2:214774169-214774191 TGAGAGGTTCAGAACTTAAGTGG - Intronic
945858498 2:215094432-215094454 TGATAGGTGGACAACTTCAGTGG - Intronic
945892611 2:215445701-215445723 TGATATTTTTAAAACTTCTCTGG + Intergenic
946645288 2:221826849-221826871 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
946747192 2:222858171-222858193 TGAAGGGTTTGAGACTTCAGTGG + Intergenic
947468260 2:230373960-230373982 TGATGGGTTTAAGACTTCAGTGG + Intronic
947754057 2:232548619-232548641 TGAGGGGTTCAAGACTTCAGTGG - Exonic
947786414 2:232825415-232825437 TGAGGGGTTCAAGACTTCAGTGG + Intronic
948955193 2:241284314-241284336 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1169518363 20:6343396-6343418 TGAGGGGTTCAAAATTTCAGTGG - Intergenic
1169789758 20:9397359-9397381 TGAGAGGTTCAAGACTTCAGTGG - Intronic
1170317041 20:15053942-15053964 TGAGAAGTTTAAGAGTTCAGTGG + Intronic
1170642866 20:18171203-18171225 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1170650384 20:18234723-18234745 TGAGCGGTTCAAGACTTCAGTGG - Intergenic
1170682643 20:18540004-18540026 TGAGGGGTTTGAGACTTCAGTGG - Intronic
1171176361 20:23052919-23052941 TGCATGGTTTAAAACCTCAGTGG - Intergenic
1171323709 20:24271272-24271294 TGATGGGTTCAAGACTTTAGTGG - Intergenic
1172471446 20:35199957-35199979 TGAGAGGTTCAAGTCTTCAGTGG + Intergenic
1172923062 20:38503424-38503446 TGAGGGGTTCAAAGCTTCAGTGG + Intronic
1173313254 20:41919562-41919584 CGAAAGGTTCAAGACTTCAGTGG - Intergenic
1173941963 20:46918636-46918658 TGAGAGGTTCAAGATTTCAGTGG - Intronic
1175007753 20:55703683-55703705 TGATTGGTTTAAAGGTTGAGGGG - Intergenic
1176689649 21:9889265-9889287 TGAGGGGTTCAAGACTTCAGAGG - Intergenic
1177286436 21:19057480-19057502 TGAAGGGTTCAAGACTTCAGAGG + Intergenic
1177540180 21:22482501-22482523 TGAGTGGTTTAAGACATCAGTGG + Intergenic
1177560591 21:22746069-22746091 TGAATGGGTTAATACTTCAGTGG - Intergenic
1177645638 21:23897211-23897233 AGATAAATTCAAAACTTCAGAGG + Intergenic
1178100434 21:29262734-29262756 TGAGGGGTTCAAGACTTCAGAGG - Intronic
1179148610 21:38791212-38791234 TGAGAGGCTCAAGACTTCAGTGG - Intergenic
1180651864 22:17384032-17384054 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1180900275 22:19366543-19366565 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1182514106 22:30843163-30843185 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1182731292 22:32496988-32497010 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1182734812 22:32525217-32525239 TGAGGGGTTCAAAACTTCAGTGG + Intronic
1183764432 22:39858384-39858406 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1184006002 22:41709586-41709608 TGAAAGGTCTGAATCTTCAGTGG + Intronic
1184831092 22:46988232-46988254 TGAGGGGTTCAATACTTCAGTGG - Intronic
949216764 3:1579708-1579730 TGAAAGTTTAAAAAATTCAGTGG - Intergenic
950112749 3:10430451-10430473 TGAGGGGTTCAAGACTTCAGTGG + Intronic
950294654 3:11818526-11818548 TGCTAGGTTTTAAGCTTCAAAGG + Intronic
950928038 3:16762468-16762490 TGAGGGGTTCAAGACTTCAGGGG - Intergenic
951180071 3:19649343-19649365 TTAAAGCTTTAAAACTTCTGGGG + Intergenic
951306722 3:21072496-21072518 TCAGGGGTTCAAAACTTCAGGGG + Intergenic
951307129 3:21078404-21078426 TCAAGGGTTCAAAACTTCAGTGG - Intergenic
952261420 3:31744097-31744119 AGGTTGTTTTAAAACTTCAGGGG + Intronic
952515542 3:34101036-34101058 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
952555864 3:34529959-34529981 TGAAGGATTCAAAACTTCAGTGG + Intergenic
952593937 3:34991099-34991121 TAAGGGGTTTAAGACTTCAGTGG + Intergenic
952775012 3:37037081-37037103 TGAGGGGTTCAAGACTTCAGTGG + Intronic
953174634 3:40538878-40538900 TGAGGGGTTCAAGACTTCAGTGG + Intronic
955604245 3:60682962-60682984 TGAGGGGTTCAAGACTTCAGTGG + Intronic
956104353 3:65801675-65801697 AGATAGGTTTTAAAGTTTAGTGG + Intronic
956180369 3:66512240-66512262 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
956889153 3:73593384-73593406 GGACAGATTTAAAACTTCTGTGG + Intronic
957115694 3:76022238-76022260 TGAGGGGTTTAACTCTTCAGAGG - Intronic
957136291 3:76293739-76293761 TGATAGGATTAGAACTTCCTTGG + Intronic
957334928 3:78815832-78815854 TGACGGGTTTAAAACTTCATTGG - Intronic
957334997 3:78816681-78816703 TGAGGGGCTTAAGACTTCAGTGG + Intronic
957928872 3:86851328-86851350 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
957946210 3:87066739-87066761 TGGTAGGTTTCAAAGTTTAGAGG + Intergenic
958698859 3:97562401-97562423 TGAGGGGTTCAAGACTTCAGTGG + Intronic
958718143 3:97812483-97812505 TGACGGGTTCAAGACTTCAGTGG - Intergenic
958741064 3:98072755-98072777 TCATATGAATAAAACTTCAGTGG - Intergenic
959134007 3:102393924-102393946 TGATAGGTTGAAAATTGCTGTGG + Intronic
959210118 3:103368102-103368124 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
959793656 3:110395591-110395613 TGAAGGGTTCAAAACTTTAGTGG - Intergenic
959873621 3:111356775-111356797 TGAGGGGTTCAAGACTTCAGTGG + Intronic
959923765 3:111898884-111898906 TGAGGGGTTTAAGACTTCAGTGG - Intronic
960599578 3:119442695-119442717 TGAGAGGTTCAAGACTTCACTGG + Intronic
960657472 3:120021595-120021617 TGAGGAGTTCAAAACTTCAGTGG + Intronic
961613261 3:128158071-128158093 TGAGGGGTTCAAGACTTCAGTGG + Intronic
961950265 3:130742358-130742380 TCATAGGTTTAAAATTTCAGTGG - Intronic
963013148 3:140794408-140794430 TGAGAGATTAAAAACTCCAGAGG + Intergenic
963081271 3:141396438-141396460 TGAGAGATTCAAGACTTCAGTGG - Intronic
963183691 3:142389354-142389376 TGAGAGGTTCAAAACTTCAGTGG - Intronic
963195328 3:142521644-142521666 TGAGAGGCTCAAAATTTCAGTGG + Intronic
963549966 3:146707511-146707533 TGAGGGATTCAAAACTTCAGTGG - Intergenic
963946349 3:151149971-151149993 TGAGAGGTTCAAGACTTCAGTGG - Intronic
964076506 3:152699452-152699474 TGAGAGGTTCAATACTTCAGTGG - Intergenic
964126855 3:153242674-153242696 TGAGGAGTTTAAAACTTCAGTGG + Intergenic
964212348 3:154242384-154242406 TGAGGGGTTCAAGACTTCAGCGG + Intronic
964324376 3:155530632-155530654 TGAGGGGTTCAAGACTTCAGTGG - Intronic
964440046 3:156698967-156698989 TGAAGGGTTAAAGACTTCAGTGG + Intronic
964469229 3:157034424-157034446 TTGAAGGTTTAAAACTTCAGTGG + Intronic
964535108 3:157712582-157712604 TGAGAGGTTAAAGACTTCAGTGG + Intergenic
964617128 3:158678487-158678509 TGAGGAGTTTAAGACTTCAGTGG + Intronic
964930072 3:162008466-162008488 TGATGAGGTTAAGACTTCAGTGG - Intergenic
964948776 3:162261280-162261302 TGAGGGGTGCAAAACTTCAGTGG + Intergenic
965005488 3:163017594-163017616 TGAGAGGGTCAAGACTTCAGTGG + Intergenic
965269748 3:166600044-166600066 TGAGAGGTTCAAAATTTCAGTGG - Intergenic
965424417 3:168503992-168504014 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
965885439 3:173440267-173440289 TGAGTGGTTTAAGTCTTCAGTGG - Intronic
965998668 3:174919593-174919615 TGAGAGGTTGAGGACTTCAGTGG - Intronic
966065687 3:175818735-175818757 TGAGAGATTCAAGACTTCAGTGG - Intergenic
966282470 3:178248468-178248490 TGAGAGGTTCAAAAATTTAGTGG - Intergenic
966288677 3:178328566-178328588 TGCTTTCTTTAAAACTTCAGGGG + Intergenic
966503504 3:180672950-180672972 TGAGAGGTTCAAGACTTCAGTGG + Intronic
967639388 3:191842971-191842993 GGAAAGATTCAAAACTTCAGTGG - Intergenic
969062915 4:4452908-4452930 TGAGGGGTTCAAGACTTCAGTGG + Intronic
969152534 4:5182238-5182260 TGACAGGTTCAAGACTTCAGTGG - Intronic
969167240 4:5327194-5327216 TGAGGGGTTCAAGACTTCAGTGG - Intronic
970619750 4:17805188-17805210 TGATAGGATCACAACTTCTGAGG - Exonic
970751110 4:19362855-19362877 AGAGAGGTTCAAGACTTCAGTGG + Intergenic
970944962 4:21680387-21680409 TGAGAGGTTCAAGCCTTCAGTGG - Intronic
971441374 4:26691076-26691098 TGAGGGGTTCAAGACTTCAGTGG + Intronic
971525073 4:27606518-27606540 TGAGATGTTTAAGACTTAAGAGG + Intergenic
971587713 4:28426030-28426052 TGATGGGTTTAAGTCTTCAATGG - Intergenic
972837477 4:42890554-42890576 CGAGGGGTTCAAAACTTCAGTGG + Intergenic
972952227 4:44341724-44341746 TGTAGGGTTCAAAACTTCAGTGG - Intronic
973165037 4:47066739-47066761 TGAGGGGTTCAAGACTTCAGTGG - Intronic
973697307 4:53503135-53503157 TGAGGGGTTCAAGACTTCAGTGG - Intronic
974423145 4:61704974-61704996 TGAAGGGTTCAAGACTTCAGTGG - Intronic
974531358 4:63111589-63111611 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
974816844 4:67015986-67016008 TGAGGGGTTTGAAACTTCAGTGG - Intergenic
974849716 4:67389997-67390019 TTATAGGTTTAAAACTTCAAAGG + Intergenic
974911023 4:68120015-68120037 TGAGGGGTTCAAAACTTTAGTGG + Intronic
975240811 4:72056766-72056788 TGAGAAGTTGAAGACTTCAGTGG + Intronic
975456833 4:74601167-74601189 TGAGGGGATTAAAACTTCAGTGG - Intergenic
975761931 4:77628899-77628921 TGAGGGGTTCAAAACTTCAGTGG - Intergenic
975900283 4:79143336-79143358 TGAGGGGTTCACAACTTCAGTGG - Intergenic
975974406 4:80078815-80078837 TGATTGGTTTTATGCTTCAGGGG - Intronic
976683073 4:87778957-87778979 TGATAGGTATAAAAATTAAATGG - Intergenic
977105838 4:92883353-92883375 TGAGAAGTTCAAGACTTCAGTGG - Intronic
977362066 4:96017866-96017888 TGTTAGGTTTTGAACTTCTGGGG + Intergenic
978686219 4:111447167-111447189 TGAGTGGTTCAAGACTTCAGTGG - Intergenic
978790019 4:112653142-112653164 TGCTAGATTTAAAACTCCTGAGG + Exonic
979190164 4:117847080-117847102 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
979374464 4:119929342-119929364 TGAAGGGTTCAAGACTTCAGTGG + Intergenic
979620208 4:122790200-122790222 TGAGGGGTTTAAGACTTCAGTGG + Intergenic
979658967 4:123230502-123230524 TGAGGGGTTTAAGACTTCAGTGG - Intronic
979811678 4:125043990-125044012 TGAGGGGTTTAAGACTTCAGTGG + Intergenic
980029989 4:127816225-127816247 TGATAGATTTTAAACTCCATGGG - Intronic
980166255 4:129231581-129231603 ACATAGTTTTAAAATTTCAGTGG + Intergenic
980221408 4:129920945-129920967 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
980353052 4:131707124-131707146 TGAGGGGTTCAAGACTTCAGAGG - Intergenic
980706930 4:136510292-136510314 TAAAAGGTTCAAGACTTCAGTGG - Intergenic
981391722 4:144198564-144198586 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
981459229 4:144992511-144992533 TGAGGGGTTTACGACTTCAGTGG + Intronic
981526661 4:145713440-145713462 TGAGGGGTTTAAGACTTCTGTGG + Intronic
981564644 4:146086726-146086748 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
981628777 4:146792901-146792923 TGAGAGGTTTGAGATTTCAGTGG + Intronic
982036505 4:151351214-151351236 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
982149506 4:152437235-152437257 TGAGGGGTTCAAGACTTCAGTGG + Intronic
982300546 4:153874360-153874382 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
982575801 4:157108458-157108480 TGAGTAGTTCAAAACTTCAGTGG + Intronic
982697005 4:158613676-158613698 TGAAGGGTTCAAGACTTCAGTGG - Intronic
983086359 4:163449996-163450018 TGAGAGGTTTAAGACTTCACGGG - Intergenic
983813827 4:172097960-172097982 TGGAAGGTTTAAAATTTCATAGG + Intronic
984038678 4:174701752-174701774 TGAGGGGTTTAAGACTTCAGTGG + Intronic
984299536 4:177897032-177897054 TGAGGGGTTCAAGACTTCAGTGG + Intronic
984479283 4:180277984-180278006 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
984544988 4:181090908-181090930 TGAGGGGTTCAAGACTTCAGCGG - Intergenic
985330571 4:188827693-188827715 TGAGGGGTTTAAGACTTCAGTGG + Intergenic
985991803 5:3567989-3568011 TGATAGGTTTAAAAAGTCACTGG - Intergenic
986136993 5:4989617-4989639 GAATACTTTTAAAACTTCAGTGG + Intergenic
986925306 5:12741325-12741347 TGAGGGGTTTAAGACTTTAGTGG + Intergenic
987329059 5:16839331-16839353 TGAGGGGTTCAAGACTTCAGTGG + Intronic
987780514 5:22428050-22428072 TTATAGCCTTAAAATTTCAGTGG + Intronic
987851136 5:23356238-23356260 TGAGAGGTTTGAAACTTTAATGG + Intergenic
987952658 5:24695374-24695396 TGAGAAGTTCAAGACTTCAGTGG + Intergenic
988274547 5:29064123-29064145 TGAGGGGTTTAAGACTTCAATGG + Intergenic
988669662 5:33367549-33367571 TGAGGGATTTACAACTTCAGGGG - Intergenic
989359729 5:40587003-40587025 AAATAGGTGTAAAACTACAGTGG + Intergenic
989374924 5:40750962-40750984 TGAGGGGTTCAAGACTTCAGTGG - Intronic
989458866 5:41673141-41673163 AGATATGTTTAAATGTTCAGAGG + Intergenic
989953027 5:50323458-50323480 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
990031583 5:51266451-51266473 TGATTAGTTTAACACCTCAGAGG - Intergenic
990629914 5:57657171-57657193 TGAGAGGTTCAATACTTCAGTGG + Intergenic
991936104 5:71802201-71802223 TGAGAGGTTCAAGACTTCAGTGG - Intergenic
992074663 5:73180331-73180353 TGAGAGGCTCAAGACTTCAGTGG + Intergenic
992642754 5:78782652-78782674 TAATTGGTTTCAAACTTAAGAGG - Intronic
992708250 5:79420575-79420597 TTATAGTGTTTAAACTTCAGTGG - Intronic
992730476 5:79662260-79662282 TGAGAGGTTCAAGACTTCAGTGG - Intronic
993293307 5:86102826-86102848 TGAGAGGTTTCAACTTTCAGAGG - Intergenic
993594630 5:89837547-89837569 TGATAAATTTGAAAATTCAGTGG + Intergenic
993771693 5:91936219-91936241 TGAGGGGTTCAAGACTTCAGAGG - Intergenic
993877081 5:93319839-93319861 TGATTGTTTTAAAATGTCAGAGG - Intergenic
993956233 5:94236292-94236314 TGAGATGTTTAGGACTTCAGTGG + Intronic
994020200 5:95014371-95014393 TGAGGGGTTCAAGACTTCAGTGG + Intronic
994105295 5:95941202-95941224 TGATGGGTTTAAATCTTAATGGG - Intronic
994431202 5:99663534-99663556 TGAGAGATTTCAGACTTCAGGGG - Intergenic
994736985 5:103567520-103567542 TGAGTGGTTCAAGACTTCAGTGG + Intergenic
995448223 5:112270535-112270557 TCATTGGTTTTAAACTTTAGAGG - Intronic
995754348 5:115486703-115486725 TGACAATGTTAAAACTTCAGAGG - Intergenic
996194571 5:120588021-120588043 TGAGAGGTTAAAGACTTCAGTGG + Intronic
996482840 5:123994651-123994673 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
996512408 5:124331471-124331493 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
996607402 5:125339914-125339936 TGATAGATTTAAAACCTAAATGG - Intergenic
996847496 5:127916301-127916323 TGAGGGGTTTAAGACTTCAGTGG - Intergenic
998610233 5:143680705-143680727 TGGTGGTTTTAAAAATTCAGGGG - Intergenic
998831256 5:146162039-146162061 TGAAAGGTTCAAGACTTCAGGGG - Intronic
999389829 5:151181946-151181968 TTCTAGGTTTAGAAGTTCAGAGG - Exonic
999497193 5:152110669-152110691 TGAGGGGTTTAAGACTTCAGTGG - Intergenic
999882493 5:155881994-155882016 TGAGGGGTTCAAGACTTCAGAGG - Intronic
999884616 5:155907560-155907582 TGAGGAGTTTAAGACTTCAGAGG + Intronic
1000549756 5:162646390-162646412 TGAGGGGTTCAAAATTTCAGTGG - Intergenic
1000661270 5:163941692-163941714 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1001091506 5:168745124-168745146 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1001183414 5:169542587-169542609 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1001418777 5:171570871-171570893 TAATATGTTTAAAATTTTAGAGG - Intergenic
1001655996 5:173350498-173350520 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1003323548 6:5074471-5074493 TGAGAGGTTCAAGGCTTCAGTGG + Intergenic
1004756662 6:18617916-18617938 TGCTGGGTTTTAAACTTGAGTGG - Intergenic
1005216005 6:23529107-23529129 TGATGGGTTCAAGACTTCAGTGG - Intergenic
1005689992 6:28295111-28295133 TGAGAGGTTTAGGACTTCAGTGG + Intronic
1005703165 6:28424797-28424819 TCACAGGTTCAAGACTTCAGTGG - Intergenic
1006245325 6:32729340-32729362 TGAGATGTTTAAGACTTCAGTGG + Intergenic
1006598922 6:35213288-35213310 TGGTAGGTGTAAAAGTTGAGAGG + Intergenic
1007434757 6:41801771-41801793 TGACAGTTTTGAAACTTCACAGG + Intronic
1007684902 6:43660343-43660365 TGACAGGTTCAAGACGTCAGTGG - Intronic
1008831529 6:55769524-55769546 TGATGGGTTCAAGACTTCAGTGG - Intronic
1009461218 6:63915742-63915764 TGAGGGGTTCAGAACTTCAGTGG + Intronic
1009576756 6:65473450-65473472 TTATAGCTTTAAAAATACAGTGG - Intronic
1009766935 6:68089715-68089737 TGAAAGATTTAACACCTCAGAGG - Intergenic
1010173281 6:72997473-72997495 CGATATTTTTAAAACTTCACAGG + Intronic
1010608377 6:77920474-77920496 TGATGGCTTCAAGACTTCAGTGG - Intronic
1010729254 6:79370931-79370953 TGAGGGGTTCAACACTTCAGTGG + Intergenic
1011119079 6:83930614-83930636 TGAAGGGTTCAAGACTTCAGTGG - Intronic
1011178492 6:84591866-84591888 TGAAAGGTTCAAGACTTTAGTGG - Intergenic
1011653483 6:89528510-89528532 TGAGAAGTTCAAGACTTCAGTGG - Intronic
1011829237 6:91350796-91350818 TAAGAGGTTCAAGACTTCAGTGG + Intergenic
1011908271 6:92401811-92401833 TGAGGGGTTGAAGACTTCAGTGG - Intergenic
1012080176 6:94748294-94748316 TGAAGGGTTCAAGACTTCAGTGG - Intergenic
1012365835 6:98439000-98439022 TGAGAGATTCAATACTTCAGTGG - Intergenic
1012597824 6:101060597-101060619 AAAGAGGTTTAAAAATTCAGCGG + Intergenic
1013031021 6:106332976-106332998 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
1013739921 6:113270515-113270537 TGAGGGGTTTAGGACTTCAGTGG + Intergenic
1013796248 6:113892631-113892653 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1014262633 6:119236970-119236992 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1014309913 6:119787079-119787101 AGATTGGTTTACAACATCAGGGG + Intergenic
1014558905 6:122866572-122866594 TGATACTTTTAAAACTTCTGTGG + Intergenic
1014794914 6:125713755-125713777 TGTTAGGTTTATGATTTCAGAGG - Intergenic
1015640824 6:135329886-135329908 TGAGGGTTTTAAGACTTCAGTGG + Intronic
1016148384 6:140704786-140704808 TGAGGGGCTTAACACTTCAGTGG - Intergenic
1016616775 6:146058971-146058993 TGAGAGGTTTAAGACTTCAATGG - Intronic
1016754572 6:147669790-147669812 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1016846972 6:148578198-148578220 TGATATGTATACAAATTCAGTGG - Intergenic
1016931662 6:149417032-149417054 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1017037967 6:150284198-150284220 TGATCGTTGTAAAAATTCAGTGG + Intergenic
1017734781 6:157351828-157351850 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
1020181389 7:5925138-5925160 TGATAGGCTCAAAACTCCTGAGG + Intronic
1020301544 7:6799752-6799774 TGATAGGCTCAAAACTCCTGAGG - Intronic
1020459769 7:8415795-8415817 TGAAATGTTCAAGACTTCAGTGG + Intergenic
1021132635 7:16929603-16929625 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1021608136 7:22430154-22430176 TGAAAGTTTTAAAAATACAGTGG + Intronic
1021614088 7:22484859-22484881 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1021678226 7:23102886-23102908 TGAGAGGTTTGAAATTTCTGTGG + Intergenic
1021732939 7:23614422-23614444 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1021933995 7:25612031-25612053 TGAGTGGTTCAAGACTTCAGTGG - Intergenic
1022548803 7:31216452-31216474 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1022594676 7:31701279-31701301 TGAGAGGTTCAAGACTTCAGTGG + Intronic
1023099620 7:36703179-36703201 TGAGGGGTTTAAGACTTCAGTGG - Intronic
1023424883 7:40025201-40025223 TGATAGGCTTAAAAATGCAGTGG - Intronic
1023667425 7:42538580-42538602 TGAAAGCTTCAAGACTTCAGTGG + Intergenic
1023951060 7:44846183-44846205 TGATAGATTTTAAACCTGAGAGG - Intronic
1025196122 7:56935203-56935225 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1025675825 7:63641731-63641753 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1025968615 7:66300434-66300456 TGAGAGGTTCAAGACTTCAGTGG - Intronic
1026641988 7:72135145-72135167 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1027351040 7:77311640-77311662 TGACTCTTTTAAAACTTCAGAGG + Intronic
1027855504 7:83506154-83506176 TGATAGGCTTCAAACATAAGTGG + Intronic
1027944838 7:84731563-84731585 TGAGGGGTTTAAGCCTTCAGTGG - Intergenic
1028300228 7:89190078-89190100 TGAGGGGTTCAAAACTTCAGTGG + Intronic
1028349569 7:89828839-89828861 TGAAAGGTTCAAGACTTCAGTGG + Intergenic
1028578197 7:92376944-92376966 TGATATGTTGAAAATTTGAGTGG - Intronic
1028642429 7:93058088-93058110 TGAGGGGCTCAAAACTTCAGTGG - Intergenic
1028661020 7:93274984-93275006 TGAGGGGTTCAAAACTTCAGTGG + Intronic
1029050033 7:97676297-97676319 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1030432455 7:109468189-109468211 TGATTGATTCACAACTTCAGTGG + Intergenic
1030587599 7:111440108-111440130 TGAGGGTTTTAAGACTTCAGGGG - Intronic
1030635160 7:111939828-111939850 TGCTAGGTTTATAAATTCAAAGG + Intronic
1030769655 7:113458149-113458171 TGATTGGTTTTATACTTCAGTGG - Intergenic
1031669746 7:124528428-124528450 TGATATGTTTCAAACTTGTGTGG - Intergenic
1031879842 7:127185125-127185147 TTCTAGGTTTAAAACTTAAATGG - Intronic
1032321096 7:130887444-130887466 TTTTATGTTTTAAACTTCAGTGG - Intergenic
1032861912 7:135888166-135888188 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1033241792 7:139686160-139686182 TGAAGGGTTCAAGACTTCAGTGG + Intronic
1034021969 7:147654594-147654616 TGAGAGGTTCAAAACTTCAGTGG - Intronic
1034582645 7:152058958-152058980 CGACAGGTTCAAGACTTCAGTGG - Intronic
1034873454 7:154704148-154704170 TGAGAGATTCAAGACTTCAGTGG + Intronic
1035426143 7:158775694-158775716 TGAGGGGTTTAAGACTTCAGTGG - Intronic
1035455139 7:159003648-159003670 TGAGGGGTTTAAGACTTCAGTGG - Intergenic
1036964624 8:13282561-13282583 AGATACAGTTAAAACTTCAGGGG + Intronic
1037089125 8:14891371-14891393 TGAGAGGTTCAAGACTTCAGTGG + Intronic
1037218449 8:16486624-16486646 TGTGAGGTTCAAGACTTCAGCGG - Intronic
1040036993 8:42880064-42880086 TGAGAGGTTCAGGACTTCAGAGG + Intronic
1040441421 8:47447042-47447064 TCAGGGGTTTAAAACTTCAGTGG + Intronic
1040636368 8:49278442-49278464 TGAGAGGTTCAAGACTTCAATGG + Intergenic
1040685725 8:49870338-49870360 TGAGAGGTTCAAGACTTCAGTGG - Intergenic
1041404290 8:57480671-57480693 TGAGAAATTTAAGACTTCAGTGG + Intergenic
1041779880 8:61566250-61566272 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1041907514 8:63049881-63049903 TGAGTGGTTTAAGATTTCAGTGG + Intronic
1042150065 8:65772388-65772410 GGATGTGTTTAAACCTTCAGAGG - Intronic
1043099153 8:76017846-76017868 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
1043420986 8:80098478-80098500 TGAGAGGCTTAAGACTTCAGTGG + Intronic
1043944676 8:86236194-86236216 TGATGGGTTCAAGACTTCAGTGG - Intronic
1044089682 8:87983723-87983745 TGAGGGGTTCAAAACTTCAGTGG - Intergenic
1044223234 8:89694379-89694401 TGAGGGGTTCAAAACTTCAGTGG + Intergenic
1044616051 8:94142900-94142922 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1044889355 8:96816425-96816447 TGAGGGGTTCAAGACTTCAGAGG - Intronic
1045232833 8:100321494-100321516 TGAGGGGTTCAAGACTTCAGGGG - Intronic
1045541676 8:103092530-103092552 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1045967156 8:108038210-108038232 TCAGGGGTTCAAAACTTCAGTGG + Intronic
1046248522 8:111599423-111599445 TGTTAGGATTAAATCTTCAATGG - Intergenic
1046471783 8:114684621-114684643 AGATAGGTTTCAAACTTGAGAGG - Intergenic
1046540546 8:115575779-115575801 TTATAGTTTTAAGATTTCAGTGG + Intronic
1046653025 8:116860049-116860071 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1047800811 8:128307632-128307654 TTATGGGTGTAAAAATTCAGAGG - Intergenic
1048479348 8:134773706-134773728 TGAAAGGTTCAAGCCTTCAGTGG + Intergenic
1048823900 8:138404839-138404861 TAAGAGGTTCAAGACTTCAGTGG - Intronic
1049628926 8:143641089-143641111 TGAGGGGTTTGAGACTTCAGTGG - Intronic
1050087411 9:1980354-1980376 TCAGAAGTTTAAATCTTCAGGGG + Intergenic
1050755568 9:8998880-8998902 TGAGAGGTTCAAGACTTCAGTGG + Intronic
1051019459 9:12524418-12524440 TGAAGGGTTCAAAAGTTCAGTGG + Intergenic
1051201425 9:14630438-14630460 TGAAGGGTTCAAGACTTCAGTGG - Intronic
1051254289 9:15196483-15196505 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1051767629 9:20541880-20541902 TGAGGGGTTGAAGACTTCAGTGG - Intronic
1051770657 9:20575132-20575154 TGAAAGGTTGAAGACTTCCGTGG - Intronic
1052050694 9:23845466-23845488 TGAGAGGGGTAAAAATTCAGGGG + Intergenic
1052499108 9:29266307-29266329 TGAGAGATTCAAGACTTCAGTGG + Intergenic
1052760497 9:32585981-32586003 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1052869534 9:33490273-33490295 TGATTCTTTTAAAAGTTCAGGGG - Intergenic
1053465468 9:38304418-38304440 TGAGGAGTTTAAAAATTCAGTGG - Intergenic
1053779612 9:41592217-41592239 TGAGGGGTTCAAGACTTCAGAGG + Intergenic
1054167568 9:61802458-61802480 TGAGGGGTTCAAGACTTCAGAGG + Intergenic
1054669974 9:67778442-67778464 TGAGGGGTTCAAGACTTCAGAGG - Intergenic
1054994606 9:71371440-71371462 TGAGAGGTTTAAAGCATCAGTGG + Intronic
1055039276 9:71851540-71851562 TGAGGAGTTTAAGACTTCAGTGG - Intergenic
1055296949 9:74843287-74843309 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1055534506 9:77224506-77224528 TGAGAGGTTCAAGATTTCAGTGG + Intronic
1055567323 9:77582267-77582289 TTATAAGTTCACAACTTCAGTGG + Intronic
1055608465 9:77996270-77996292 TGATAAGTTTAAAACTTGATGGG + Intronic
1056227368 9:84509028-84509050 TGAGGGGTTTGAAACATCAGTGG + Intergenic
1056274313 9:84978344-84978366 TGATAGGGAGAAAGCTTCAGTGG + Intronic
1056502410 9:87223083-87223105 TCATAGGTTAAAAATCTCAGGGG - Intergenic
1056959264 9:91107650-91107672 TGAAAGGTTTAACACTTCAGTGG - Intergenic
1057323965 9:94043072-94043094 GGAGAGGTTCAAGACTTCAGTGG - Intronic
1058285772 9:103176325-103176347 TGAGTGGTTCAAGACTTCAGTGG - Intergenic
1058324687 9:103680579-103680601 TGTTATGTTTAAAACTTCAGAGG + Intergenic
1058567414 9:106301178-106301200 TGATAGGATTAAAAGCTGAGGGG - Intergenic
1059049722 9:110910761-110910783 TGAAGGGTTCAAGACTTCAGTGG + Intronic
1059082076 9:111260809-111260831 TGATAGGTTGAAACCTTGGGAGG - Intergenic
1059936568 9:119317316-119317338 TGAGGGGTTCAAGACTTCAGTGG + Intronic
1061494819 9:130966743-130966765 TGAGAAGTTCAAGACTTCAGTGG + Intergenic
1203624818 Un_KI270750v1:5357-5379 TGTTGGGTTTAAAAATTCAACGG - Intergenic
1186255907 X:7719388-7719410 TGAGGGGTTCAAGACTTCAGCGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1187480150 X:19647984-19648006 TTCTTGGATTAAAACTTCAGGGG + Intronic
1187502172 X:19848499-19848521 TGATACTTTTAAAACATCATTGG + Intronic
1187516735 X:19978396-19978418 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1187760230 X:22575246-22575268 TGAGGGGTTGAAGACTTCAGTGG + Intergenic
1187814840 X:23220112-23220134 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1188278760 X:28236924-28236946 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1188732727 X:33671464-33671486 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1189014640 X:37084442-37084464 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1189174675 X:38943907-38943929 TGAGGGGTTCAAAACTCCAGTGG + Intergenic
1189942719 X:46142472-46142494 CGAGAGGTTGAAGACTTCAGGGG + Intergenic
1191728675 X:64310390-64310412 TGATGAGTTCAAGACTTCAGTGG - Intronic
1191926260 X:66313905-66313927 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1192078815 X:68027770-68027792 TGAAGGGTTCAAGACTTCAGTGG + Intergenic
1192301769 X:69912240-69912262 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1192733821 X:73829331-73829353 TTATAGGTTTCAAAGTTCTGTGG - Intergenic
1193140476 X:78021814-78021836 TGAAAGTTTTCAACCTTCAGGGG - Intronic
1194059495 X:89179901-89179923 TGATAGGATTCAAACTTTATTGG - Intergenic
1194100354 X:89695746-89695768 TGAGAGGTTTAAGACTTAAGTGG - Intergenic
1194142194 X:90220664-90220686 TGATAGGTTTAAGGCCCCAGAGG + Intergenic
1194846397 X:98814580-98814602 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1194862959 X:99027292-99027314 TGAGGGTTTGAAAACTTCAGTGG + Intergenic
1195011197 X:100733712-100733734 TGAAGGGTTCAAGACTTCAGTGG + Intergenic
1195338841 X:103884779-103884801 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1195511261 X:105717860-105717882 TCATAAGTGTAAAACTGCAGTGG + Intronic
1196260106 X:113569136-113569158 TGAAGGGTTCAATACTTCAGTGG - Intergenic
1196535638 X:116840217-116840239 GGTTAGGTTTTAAACTTCAGGGG + Intergenic
1196721675 X:118860117-118860139 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1197129248 X:122985462-122985484 TGAGGGGCTTAATACTTCAGTGG - Intergenic
1197133971 X:123039209-123039231 TGATGAGGTTAAGACTTCAGGGG - Intergenic
1197358365 X:125466301-125466323 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1197456267 X:126679532-126679554 TGAGGGGTTCAAGACTTCAGTGG - Intergenic
1197505840 X:127303985-127304007 TGATAGCATTTAAATTTCAGTGG - Intergenic
1197561502 X:128027999-128028021 TTAAAGGTTCAAGACTTCAGTGG - Intergenic
1197628294 X:128828396-128828418 TGAAGGGTTCAAGACTTCAGTGG + Intergenic
1198199794 X:134404282-134404304 TGAGAGGTTCAAGACTTCGGTGG + Intronic
1198607095 X:138353063-138353085 TGAGAGGTTCAAGACTTCAGTGG + Intergenic
1199815087 X:151390248-151390270 TGAAGGGTTCAAGACTTCAGTGG + Intergenic
1200367513 X:155682935-155682957 TGAGGGGTTCAAGACTTCAGTGG + Intergenic
1200389051 X:155925126-155925148 TGAGGGGTTCAAGACTTCAGTGG - Intronic
1200453358 Y:3357108-3357130 TGAGAGGTTTAAGACTTAAGTGG - Intergenic
1201784985 Y:17766082-17766104 CTACAGGTTTAAAACTTAAGAGG + Intergenic
1201816567 Y:18139905-18139927 CTACAGGTTTAAAACTTAAGAGG - Intergenic