ID: 1098624657

View in Genome Browser
Species Human (GRCh38)
Location 12:72648919-72648941
Sequence TCCAATCCATGAACATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 3, 2: 4, 3: 26, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098624657 Original CRISPR TCCAATCCATGAACATCAGA TGG (reversed) Intronic
900942005 1:5805064-5805086 ACCAATGCCTGAACTTCAGAGGG + Intergenic
902611231 1:17598356-17598378 TCTAATCCCTGAACTTCGGAAGG - Intronic
904989591 1:34581029-34581051 GTCAATCCATGAACAGGAGAAGG - Intergenic
905896614 1:41550491-41550513 TCCTATCCATGAGCATGAAATGG + Intronic
905920198 1:41714184-41714206 TCCCAGCCAGTAACATCAGAGGG - Intronic
906882759 1:49610502-49610524 TTCAATACATGAATTTCAGAGGG - Intronic
906975304 1:50563914-50563936 TCCAAATCATCAACATCACAGGG + Intronic
907485403 1:54774559-54774581 TCCAACCTATGAATTTCAGAGGG + Intergenic
907741845 1:57173972-57173994 TCCAATCCAGGGACTTCATAAGG - Intronic
907832317 1:58076876-58076898 TTCATTCCATGAACATCACTAGG - Intronic
908537824 1:65094672-65094694 TCCAATCCATAAGCATGGGATGG + Intergenic
908947955 1:69522893-69522915 TCCAGACCATGAACATCTTATGG + Intergenic
909363513 1:74793138-74793160 TCCAATCAATGAGCATCTCATGG + Intergenic
909515214 1:76499405-76499427 TCCAAATCATGCAAATCAGAAGG + Intronic
909625378 1:77709962-77709984 TCCAATCCAATAACAACACAAGG + Intronic
909706235 1:78587982-78588004 TCCAGTACATGATCCTCAGAGGG - Intergenic
910513433 1:88032726-88032748 TCCAATTCATGATCATAAGATGG - Intergenic
911821722 1:102432148-102432170 TATAAACCATGGACATCAGAAGG + Intergenic
918272690 1:182918526-182918548 TCCAATCCATGAACATGGGATGG - Intronic
919040709 1:192384454-192384476 TCTAATCCATGAACATGAAATGG - Intergenic
920025944 1:202996553-202996575 TCCAATCAATGAACATAGGATGG - Intergenic
920892129 1:209998321-209998343 TCCAATCCATGAGCACGGGATGG - Intronic
921042255 1:211444525-211444547 TCCAATCCATGAACATGGGGTGG - Intergenic
921467969 1:215513832-215513854 TCTGATCCATGAGCATGAGATGG - Intergenic
922159642 1:223069508-223069530 TCCAATCCATCAGCATGTGAAGG + Intergenic
922663635 1:227450950-227450972 TCCATTTCATGAACCTCAGATGG + Intergenic
923629813 1:235642463-235642485 GCCAATCCGTAAGCATCAGAGGG + Intronic
924192906 1:241573887-241573909 TCCAATCCATGAACTTGGAATGG + Intronic
1062933849 10:1370823-1370845 TCCAATCCATGAGCATGGGATGG - Intronic
1063625272 10:7683483-7683505 TCCAATCCATGAGCATGGAATGG - Intergenic
1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG + Intronic
1065405805 10:25362567-25362589 TTCAATCCATGAACATGGGATGG + Intronic
1067788268 10:49268533-49268555 TTCAATACATGAATTTCAGAGGG + Intergenic
1068185260 10:53577045-53577067 ACAAAATCATGAACATCAGAAGG - Intergenic
1068270943 10:54722915-54722937 TCCAATCCATGAGCATAGGATGG - Intronic
1069611395 10:69774887-69774909 TCCAGGCCATGACCATCAGCAGG - Intergenic
1070444640 10:76484427-76484449 TTCATTCCATGAACATGATATGG + Intronic
1070574198 10:77665217-77665239 TCCATTCCATGAAAGTGAGATGG + Intergenic
1071183650 10:83015843-83015865 TATAATCCATGAAGCTCAGAAGG + Intergenic
1079549707 11:21679321-21679343 TTCAATCCATGAACTTGGGATGG + Intergenic
1080915346 11:36652172-36652194 TCCTATCCATGAACATGGAATGG + Intronic
1082985436 11:59165744-59165766 TCCAATCCATAAACACGATATGG - Intergenic
1084435855 11:69139095-69139117 TCCAATTTAGGAACATTAGACGG + Intergenic
1088139485 11:106598228-106598250 TTCAATCCATGACCATGATATGG + Intergenic
1088424617 11:109689321-109689343 TCCAATCCATAAACAGAGGATGG - Intergenic
1089141745 11:116290618-116290640 TCCAAGCCATTATCATCTGATGG + Intergenic
1089669065 11:120039846-120039868 TGCAATGCAATAACATCAGAAGG - Intergenic
1089670016 11:120049274-120049296 TCCAGTCCATGAATACCATATGG - Intergenic
1089900751 11:121981329-121981351 TCCAATGCATGAACATGGCATGG - Intergenic
1091305497 11:134533317-134533339 TCCCCTCAATGACCATCAGATGG + Intergenic
1093283157 12:17221780-17221802 TCAAATGCAGAAACATCAGAAGG - Intergenic
1095042782 12:37461957-37461979 TTCAATTCATGAAAATGAGATGG + Intergenic
1095218955 12:39585140-39585162 TCCTATCCATGAACATGGGATGG + Intronic
1095430574 12:42129783-42129805 TTCATTCCACAAACATCAGAGGG + Exonic
1095542621 12:43328715-43328737 TCCTATCCATGAGCATGGGATGG + Intergenic
1095733704 12:45533926-45533948 TCCAATCCAGCAAGATCAGATGG + Intergenic
1095780560 12:46054482-46054504 TCCAATCCATGAACATGGAAAGG - Intergenic
1097071931 12:56361512-56361534 TCCCAGCCATGGTCATCAGAAGG + Exonic
1098624657 12:72648919-72648941 TCCAATCCATGAACATCAGATGG - Intronic
1099394381 12:82120371-82120393 TCCAATCCGTGAGCATGAAATGG - Intergenic
1099955048 12:89345415-89345437 ACCAATCCATGAACAGAAGCTGG + Intergenic
1100357797 12:93848471-93848493 TCCCATCCATCAGCATCACAGGG - Intronic
1100931786 12:99618311-99618333 TTCAATCCATGAACATGGAATGG - Intronic
1101079762 12:101170967-101170989 TAAAATGCATGAGCATCAGACGG - Intronic
1102614895 12:114145038-114145060 TCAAATGCATGACCATCACAAGG + Intergenic
1103022210 12:117543661-117543683 TCCAATCCATGAACATGGTATGG + Intronic
1105653970 13:22414246-22414268 TCTGATCCATGAACATGGGATGG + Intergenic
1107068608 13:36244612-36244634 TCTAATCCATGTACCTCACAGGG - Intronic
1107116229 13:36748852-36748874 TCCTATCCATGAACATGGAATGG + Intergenic
1108422707 13:50266990-50267012 TACTATCTATGAACATCACAGGG - Intronic
1112021518 13:95375371-95375393 TACAATCCATGATCATGGGATGG - Intergenic
1114988225 14:28255923-28255945 TACAATTCATGAACATGGGATGG - Intergenic
1115840923 14:37469614-37469636 TCCAATCCATAAACTTCTGGGGG - Intronic
1122246076 14:100404496-100404518 TCCCAGCCAGGAACACCAGAGGG - Intronic
1125097652 15:35873052-35873074 GCCAATCCAAAAGCATCAGATGG - Intergenic
1127251512 15:57243508-57243530 TCAAATCCATCAACACCAGTTGG + Exonic
1127383940 15:58452349-58452371 TCCAATCCATCAAGTTCAAAGGG + Intronic
1127668992 15:61176412-61176434 TCCATTTCCTGTACATCAGATGG + Intronic
1128916677 15:71569192-71569214 TCACATCCATGAATATCAGAGGG - Intronic
1129940486 15:79492329-79492351 CACAAAGCATGAACATCAGAAGG - Intergenic
1131608996 15:93941197-93941219 TCCCATTCAAGGACATCAGATGG - Intergenic
1131698306 15:94904201-94904223 TCCCATCCAGGAACAGAAGAGGG - Intergenic
1131886506 15:96920774-96920796 TCCAATGCATAAACATGGGATGG + Intergenic
1134075644 16:11289560-11289582 TCTAATCCATGGTCATCACATGG + Intronic
1135197159 16:20403921-20403943 TCGAATCCACGCTCATCAGAAGG + Intronic
1135962411 16:27007945-27007967 TCCAATCCATGAATAAGATATGG - Intergenic
1136090377 16:27915375-27915397 AGAAATCCATGAACAGCAGAAGG + Intronic
1140044150 16:71429359-71429381 TCCGAGCCATGAACTTCAGTGGG + Intergenic
1142384882 16:89757539-89757561 GCAAATCCATGAACATAAAATGG + Intronic
1142736919 17:1906962-1906984 TCCATTCCATCAACAAGAGAGGG - Intergenic
1142977627 17:3655320-3655342 TCCAATTCATGATCACCTGAGGG - Exonic
1144645175 17:16968244-16968266 TTCAATCCATGAGCATGGGATGG - Intronic
1149033466 17:52109031-52109053 TCCAATCCATGAACCTAGTAGGG - Intronic
1151930510 17:77228965-77228987 TCAGTTCCATGAACATCACAGGG - Intergenic
1155894570 18:31308747-31308769 TTGAATCCATGAACATGAAATGG - Intergenic
1156224540 18:35091083-35091105 TCCAATCCATAAACATGGCATGG - Intronic
1157398188 18:47361422-47361444 TCCTATCCATGAACATGACATGG + Intergenic
1157598870 18:48880568-48880590 TCCAGGCCATGAACATCACTAGG + Intergenic
1158102555 18:53846149-53846171 TCCAATCCATGAACAAAGAATGG - Intergenic
1160136063 18:76272830-76272852 TCCAATCCATAGACTTCAGGGGG + Intergenic
1162243172 19:9374500-9374522 TCCAATCCATGAACACTGGGTGG + Intronic
1163293710 19:16398251-16398273 ACCATTCCATGTTCATCAGATGG - Intronic
1165056472 19:33179698-33179720 TCTAATCCATGAACATGGAATGG + Intronic
925799267 2:7581578-7581600 TCTGATCCCTGAAGATCAGAGGG - Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
926598789 2:14819310-14819332 TCCAATCCTAGAAGACCAGAAGG + Intergenic
926691860 2:15741764-15741786 TCCAATCTATGAACATGGTATGG + Intronic
927893836 2:26768955-26768977 TCCATTCCATGGAGATGAGAGGG + Intronic
928322791 2:30296497-30296519 CCCTCTCCAGGAACATCAGAGGG - Intronic
930063896 2:47312899-47312921 TTCAAAACATGAACACCAGATGG + Intergenic
930549401 2:52813500-52813522 TCCAATCAATGAGCATTAAATGG + Intergenic
931254803 2:60561053-60561075 GCCACTCCATAAACATCAGGTGG + Intergenic
931646657 2:64428301-64428323 TCCAGTCCATGAACATGATATGG + Intergenic
932078072 2:68684813-68684835 TCCAATCCACAAACATTGGATGG - Intronic
934686717 2:96326706-96326728 TCCGATCACTGACCATCAGAGGG - Exonic
936499117 2:113051687-113051709 TCCAACCCAGCCACATCAGAGGG - Intronic
937060481 2:118977185-118977207 TCCAATGCATGAACTTTTGAGGG + Intronic
937184333 2:120025658-120025680 TCAAATTCATGAACATGGGATGG - Intronic
937777627 2:125798612-125798634 TCTAATAAATGAACAACAGATGG - Intergenic
939876015 2:147578818-147578840 TTCTATCCATGAACCCCAGATGG + Intergenic
943964499 2:194315681-194315703 TCCAATCTATGAACCTGGGATGG + Intergenic
945758370 2:213879265-213879287 TCCAATTCATGCGCATGAGATGG + Intronic
945823390 2:214691503-214691525 TCCAATTTATGAACATAGGATGG - Intergenic
946005660 2:216522566-216522588 TTCATTCCATTAACATCTGATGG + Intronic
946281453 2:218668650-218668672 TCCAATACTTCAACTTCAGAGGG + Exonic
946287380 2:218714345-218714367 TCCAAAACATGAGTATCAGATGG - Intronic
1170111839 20:12812863-12812885 TACAATCCATTAACATAGGATGG - Intergenic
1171179103 20:23078811-23078833 TCCAAGTCAGGAACAGCAGATGG - Intergenic
1171537211 20:25904719-25904741 TTCAATTCATGAAAATGAGATGG + Intergenic
1171840161 20:30200050-30200072 TTCAATTCATGAAAATTAGATGG + Intergenic
1172346845 20:34208737-34208759 TCCAATCTATGAACATGAGATGG + Intronic
1175020354 20:55840880-55840902 TCCAATCCATGAACATGAGATGG - Intergenic
1177101722 21:16906178-16906200 TCCAATCCATAAACATAGGAAGG - Intergenic
1177179785 21:17732620-17732642 CAAAATACATGAACATCAGAAGG + Intergenic
1178388030 21:32171866-32171888 TCTGATCCATGAACATGGGATGG - Intergenic
1180395172 22:12325221-12325243 TCCTATCCATGAGCATGAGGTGG + Intergenic
1180404568 22:12539530-12539552 TCCTATCCATGAGCATGAGGTGG - Intergenic
1181383441 22:22525473-22525495 TGGAATCCAAGAGCATCAGAAGG + Intergenic
1182886069 22:33775354-33775376 TCTAATCCAGGAACACCACATGG + Intronic
1184326594 22:43792255-43792277 TCGTGTCCATGAACCTCAGATGG - Intronic
1184710927 22:46249068-46249090 ACCCAACCATGAACATGAGAAGG - Intronic
949649254 3:6136399-6136421 TGCAATCCATGAAAATAAAATGG - Intergenic
950598491 3:14008449-14008471 TCCAATCCAGGAATATGACAAGG + Intronic
950606197 3:14083051-14083073 TCCAAACCGTTAACATCAGGAGG - Intergenic
952432996 3:33243832-33243854 TCCATTGCATGGACATCACATGG - Intergenic
953685476 3:45074842-45074864 CCCAATCTCTAAACATCAGAGGG - Intergenic
955031023 3:55218383-55218405 TCCAATCCATGACCATAGGATGG + Intergenic
955664516 3:61336154-61336176 CCCAAACAATGAACATAAGAGGG + Intergenic
958003331 3:87779544-87779566 TCCAATCCTTGAACATGGAATGG - Intergenic
959216925 3:103462839-103462861 TCTAATCCACAAACATGAGATGG + Intergenic
962025057 3:131539172-131539194 TGAAATCCATGAAGATAAGATGG + Intronic
963942386 3:151108086-151108108 TCCTATCCAAAAGCATCAGAAGG - Intronic
964877259 3:161381858-161381880 TCTGATCCATGAACATGGGAGGG + Intergenic
965151112 3:164976259-164976281 TCCCGTCCATAAACATAAGATGG - Intergenic
965439581 3:168696758-168696780 TCAAATGCATGAACATAAGTTGG + Intergenic
965533004 3:169794166-169794188 TCCAATTTATGAACATCTGTGGG - Intronic
966600595 3:181771299-181771321 TGCAATGAATGAACATCATAAGG + Intergenic
968537248 4:1141347-1141369 TGCAATCCATGAACCCGAGATGG - Intergenic
970721425 4:18993813-18993835 TCCAATACATGAACTTTTGAGGG - Intergenic
971065713 4:23030329-23030351 TCCATTCCATGAATACCAAAAGG + Intergenic
973006669 4:45016276-45016298 TCCAATCCATGAGCATGGAATGG + Intergenic
976157532 4:82163043-82163065 ACCCATCCATGAGCATGAGATGG - Intergenic
976350233 4:84052275-84052297 GCTAAACCATGAACATCAGTAGG + Intergenic
976364875 4:84222157-84222179 TCCAATCCAATAACTTCTGAGGG - Intergenic
977684186 4:99829169-99829191 TCCAATACATGAAAATAAGAAGG + Intronic
980647346 4:135659407-135659429 TCTTATCCATGAGCATAAGATGG + Intergenic
980749225 4:137067252-137067274 ACCAATCTATGAGCATGAGATGG + Intergenic
981556195 4:145997662-145997684 TCCAATCCATGAACATGAGATGG + Intergenic
983058685 4:163129743-163129765 TGCAAACAATGAACATCACATGG + Intronic
985006702 4:185541444-185541466 TCCAAAACATGAAAATCACATGG - Intergenic
990841902 5:60091054-60091076 TCCAATTCATGAGCATGGGATGG - Intronic
992776037 5:80090142-80090164 TCCAACACATGAACTTCAGGGGG - Intergenic
994002857 5:94801728-94801750 ACCAATCCATGGACATTACAAGG - Intronic
996690415 5:126334193-126334215 TCCACTCCAGGAAGATCAGCTGG + Intergenic
999847240 5:155497688-155497710 TTCAAACCATTAACATCAGAAGG - Intergenic
1000748854 5:165069946-165069968 TCCTATCCATGAGCATGAAATGG + Intergenic
1001039278 5:168321188-168321210 TTAATTCCATGAGCATCAGAAGG + Intronic
1003232409 6:4266467-4266489 TCAAAACCATGAATATCAAAAGG - Intergenic
1004442790 6:15670002-15670024 TCCCAGCCATGAACCTGAGATGG + Intergenic
1006643513 6:35500639-35500661 TCTAATCCATGAACGTGAGCAGG - Intronic
1006999209 6:38293190-38293212 TCCTATCCATGAAAAACAAATGG - Intronic
1007920335 6:45603609-45603631 TCTAATCTATGAACATGAAATGG - Intronic
1008608407 6:53163421-53163443 TCCAATCCATGAACATGGAATGG - Intergenic
1008642527 6:53479306-53479328 TCCAATCCATTAACACAAGACGG + Intergenic
1009816670 6:68745612-68745634 TATAATTCATGAAGATCAGAAGG - Intronic
1010903927 6:81462278-81462300 ACCCATCCATGAACATGGGATGG + Intergenic
1011958447 6:93054634-93054656 TCAAATCCATGAGCATGTGATGG + Intergenic
1013795904 6:113888554-113888576 CCCAGTCCAGGAACATCAGGAGG + Intergenic
1014297267 6:119635064-119635086 TCCAATCCATGAATATGGTAAGG - Intergenic
1017372692 6:153732056-153732078 TCCTATCCATGAACATGAAATGG - Intergenic
1021051882 7:15995396-15995418 TCCCATCCATGAACATGGAATGG + Intergenic
1021557595 7:21937164-21937186 TCCAATCCATGAACATGGGATGG - Intronic
1022475845 7:30709035-30709057 GCCCATCCATGAAGATGAGATGG + Intronic
1024197833 7:47076960-47076982 TCCAATCCATGAACATGGTATGG - Intergenic
1024564277 7:50668662-50668684 CTCACTCCATAAACATCAGATGG + Intronic
1030089528 7:105845415-105845437 TCCAACGCATGAACATGGGAAGG - Intronic
1030214102 7:107025802-107025824 TACAATCCCAGAACATTAGAAGG - Intergenic
1037154254 8:15680204-15680226 TCCAATCCATGAGCATGGGTTGG + Intronic
1038562585 8:28593385-28593407 TCCAATCCATGAGCATGGAATGG + Intergenic
1038609813 8:29049973-29049995 ACTAATCTGTGAACATCAGAAGG + Intronic
1039007126 8:33051583-33051605 TCCCATCCATCCACATCAAATGG + Intergenic
1040773366 8:51007995-51008017 TCTAATCCATGCACACAAGATGG - Intergenic
1041849253 8:62369712-62369734 TCAAATCCATAACCATCAGGGGG + Intronic
1042262560 8:66874373-66874395 TCTAATTCAACAACATCAGAGGG - Exonic
1043231584 8:77808845-77808867 TCCAATCCATGAGCATGGAATGG - Intergenic
1044614076 8:94121228-94121250 TTCAATCCATGATCATGTGAGGG + Intergenic
1045998481 8:108391582-108391604 TCCTATCCATGATCACAAGATGG + Intronic
1047834837 8:128677728-128677750 TGCAATGCATAAACTTCAGATGG - Intergenic
1048272471 8:133040539-133040561 CCCAATCCATTAACCTCACAGGG + Intronic
1049565641 8:143337096-143337118 TCCAGTCCGTGAACATGGGATGG - Intronic
1050693003 9:8249534-8249556 TCCAATCCATTAATATCTGTTGG + Intergenic
1050696793 9:8288265-8288287 TTCAACCCAAGAAAATCAGATGG + Intergenic
1052519884 9:29533091-29533113 TCCAATCAAAGCATATCAGATGG - Intergenic
1056987997 9:91382422-91382444 ACCATTTCATGACCATCAGATGG - Intergenic
1057241410 9:93414329-93414351 TCCAACAAATGAACTTCAGAGGG - Intergenic
1060294391 9:122333383-122333405 GACAGTCCATGAACATCACAAGG - Intergenic
1062561218 9:137142911-137142933 TCCAATCCTGGAACATCAGCTGG + Intronic
1203410225 Un_KI270581v1:1441-1463 TCCTATCCATGAGCATGAGGTGG - Intergenic
1186737453 X:12480736-12480758 TCCAATCCATCAACATTTGCAGG - Intronic
1186793935 X:13025589-13025611 TCCTATGCATGTACATCAGAGGG + Intergenic
1187451855 X:19404372-19404394 TCCAATCCATGAACACAAGATGG - Intronic
1187473943 X:19592991-19593013 CAGAATCCATGAACATAAGAAGG + Intronic
1192699625 X:73454526-73454548 TGAAATCCACGAACAGCAGATGG - Exonic
1192943586 X:75939715-75939737 TCCAATTCATGAGCATGGGACGG + Intergenic
1193617008 X:83701384-83701406 TTCTCTCCATGAACATGAGATGG + Intergenic
1194723539 X:97368331-97368353 GCCAAACCATGAACAAAAGATGG - Intronic
1197922139 X:131606549-131606571 TGCAAACCCTGGACATCAGAGGG - Intergenic
1198148494 X:133883239-133883261 TCCAATACAAGTACAGCAGAAGG + Intronic
1198619608 X:138491593-138491615 TCCAATAAATGAACATGACAAGG + Intergenic
1199077629 X:143542780-143542802 TTCAATCCATGAGCATAGGATGG - Intergenic
1199223007 X:145339429-145339451 TCAAATCCATGAAAGTCAAAAGG + Intergenic
1199619847 X:149689478-149689500 TCCAATTTATGAACATTAGAAGG + Intronic
1200328466 X:155267603-155267625 TTCAATCCATGAGCACAAGATGG + Intergenic