ID: 1098639878

View in Genome Browser
Species Human (GRCh38)
Location 12:72825637-72825659
Sequence CAGCAAACAGCAGTGGTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098639871_1098639878 24 Left 1098639871 12:72825590-72825612 CCCTGCTGGATTGGGAGGGATGG No data
Right 1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG No data
1098639873_1098639878 23 Left 1098639873 12:72825591-72825613 CCTGCTGGATTGGGAGGGATGGA No data
Right 1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098639878 Original CRISPR CAGCAAACAGCAGTGGTAGA CGG Intergenic
No off target data available for this crispr