ID: 1098652585

View in Genome Browser
Species Human (GRCh38)
Location 12:72991664-72991686
Sequence CTGTCTCACCAAAAGGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098652585_1098652590 12 Left 1098652585 12:72991664-72991686 CCCAAATCCTTTTGGTGAGACAG No data
Right 1098652590 12:72991699-72991721 CTGGAGTCTATGAAGAGAATTGG No data
1098652585_1098652589 -7 Left 1098652585 12:72991664-72991686 CCCAAATCCTTTTGGTGAGACAG No data
Right 1098652589 12:72991680-72991702 GAGACAGGAAGTCTAGTGACTGG No data
1098652585_1098652591 16 Left 1098652585 12:72991664-72991686 CCCAAATCCTTTTGGTGAGACAG No data
Right 1098652591 12:72991703-72991725 AGTCTATGAAGAGAATTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098652585 Original CRISPR CTGTCTCACCAAAAGGATTT GGG (reversed) Intergenic
No off target data available for this crispr