ID: 1098652901

View in Genome Browser
Species Human (GRCh38)
Location 12:72995976-72995998
Sequence AAGTGTGTCAAAAGCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098652901_1098652904 27 Left 1098652901 12:72995976-72995998 CCTTCCAGGCTTTTGACACACTT No data
Right 1098652904 12:72996026-72996048 ATGTAATATTTTGCCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098652901 Original CRISPR AAGTGTGTCAAAAGCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr