ID: 1098659461

View in Genome Browser
Species Human (GRCh38)
Location 12:73074100-73074122
Sequence CTCTGTTATTTGCTCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098659459_1098659461 30 Left 1098659459 12:73074047-73074069 CCTCTTTTAATTTTTATTCAGGT No data
Right 1098659461 12:73074100-73074122 CTCTGTTATTTGCTCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098659461 Original CRISPR CTCTGTTATTTGCTCTGCAA AGG Intergenic
No off target data available for this crispr