ID: 1098661571

View in Genome Browser
Species Human (GRCh38)
Location 12:73101038-73101060
Sequence CAGAGCTACAAGTCACCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098661571_1098661576 -6 Left 1098661571 12:73101038-73101060 CCCCCAGGTGACTTGTAGCTCTG No data
Right 1098661576 12:73101055-73101077 GCTCTGATCCACACTCTCCAGGG No data
1098661571_1098661575 -7 Left 1098661571 12:73101038-73101060 CCCCCAGGTGACTTGTAGCTCTG No data
Right 1098661575 12:73101054-73101076 AGCTCTGATCCACACTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098661571 Original CRISPR CAGAGCTACAAGTCACCTGG GGG (reversed) Intergenic
No off target data available for this crispr