ID: 1098672526

View in Genome Browser
Species Human (GRCh38)
Location 12:73248996-73249018
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098672524_1098672526 18 Left 1098672524 12:73248955-73248977 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1098672526 12:73248996-73249018 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1098672525_1098672526 17 Left 1098672525 12:73248956-73248978 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1098672526 12:73248996-73249018 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098672526 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr