ID: 1098673038

View in Genome Browser
Species Human (GRCh38)
Location 12:73254217-73254239
Sequence AGTTAACTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098673038_1098673044 22 Left 1098673038 12:73254217-73254239 CCTGCCATCTTCTGCAGTTAACT No data
Right 1098673044 12:73254262-73254284 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1098673038_1098673042 15 Left 1098673038 12:73254217-73254239 CCTGCCATCTTCTGCAGTTAACT No data
Right 1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1098673038_1098673043 16 Left 1098673038 12:73254217-73254239 CCTGCCATCTTCTGCAGTTAACT No data
Right 1098673043 12:73254256-73254278 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1098673038_1098673040 4 Left 1098673038 12:73254217-73254239 CCTGCCATCTTCTGCAGTTAACT No data
Right 1098673040 12:73254244-73254266 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098673038 Original CRISPR AGTTAACTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr