ID: 1098676162

View in Genome Browser
Species Human (GRCh38)
Location 12:73292698-73292720
Sequence ATGTATCAGAAGAGACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098676158_1098676162 20 Left 1098676158 12:73292655-73292677 CCAAGTTTATTCTCCAGATTCTA No data
Right 1098676162 12:73292698-73292720 ATGTATCAGAAGAGACAGAGTGG No data
1098676157_1098676162 23 Left 1098676157 12:73292652-73292674 CCTCCAAGTTTATTCTCCAGATT No data
Right 1098676162 12:73292698-73292720 ATGTATCAGAAGAGACAGAGTGG No data
1098676159_1098676162 7 Left 1098676159 12:73292668-73292690 CCAGATTCTAAAATGCTCATGCC No data
Right 1098676162 12:73292698-73292720 ATGTATCAGAAGAGACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098676162 Original CRISPR ATGTATCAGAAGAGACAGAG TGG Intergenic
No off target data available for this crispr