ID: 1098676539

View in Genome Browser
Species Human (GRCh38)
Location 12:73295930-73295952
Sequence CAGTTTCACCTGAACTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098676531_1098676539 28 Left 1098676531 12:73295879-73295901 CCATTAAGTTTTCACCAGATATT No data
Right 1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG No data
1098676532_1098676539 14 Left 1098676532 12:73295893-73295915 CCAGATATTTCATAGTACGCTGG No data
Right 1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098676539 Original CRISPR CAGTTTCACCTGAACTTTTG TGG Intergenic
No off target data available for this crispr