ID: 1098681686

View in Genome Browser
Species Human (GRCh38)
Location 12:73364215-73364237
Sequence TTTTATCTTGAGAAAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098681686_1098681694 28 Left 1098681686 12:73364215-73364237 CCATTCACTTTCTCAAGATAAAA No data
Right 1098681694 12:73364266-73364288 AGCACTTTGGAGGCCGAGGCGGG 0: 214
1: 963
2: 2105
3: 3635
4: 14409
1098681686_1098681689 18 Left 1098681686 12:73364215-73364237 CCATTCACTTTCTCAAGATAAAA No data
Right 1098681689 12:73364256-73364278 CTGTCATCCCAGCACTTTGGAGG 0: 51
1: 3753
2: 6230
3: 5581
4: 5889
1098681686_1098681690 24 Left 1098681686 12:73364215-73364237 CCATTCACTTTCTCAAGATAAAA No data
Right 1098681690 12:73364262-73364284 TCCCAGCACTTTGGAGGCCGAGG 0: 281
1: 1330
2: 2435
3: 3695
4: 9467
1098681686_1098681693 27 Left 1098681686 12:73364215-73364237 CCATTCACTTTCTCAAGATAAAA No data
Right 1098681693 12:73364265-73364287 CAGCACTTTGGAGGCCGAGGCGG 0: 187
1: 878
2: 1573
3: 2017
4: 3151
1098681686_1098681687 15 Left 1098681686 12:73364215-73364237 CCATTCACTTTCTCAAGATAAAA No data
Right 1098681687 12:73364253-73364275 CGCCTGTCATCCCAGCACTTTGG 0: 1398
1: 126029
2: 272391
3: 222835
4: 153144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098681686 Original CRISPR TTTTATCTTGAGAAAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr