ID: 1098682906

View in Genome Browser
Species Human (GRCh38)
Location 12:73380630-73380652
Sequence TGATAAGAATACATTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098682905_1098682906 -1 Left 1098682905 12:73380608-73380630 CCTTGAATCAAGGCACTGTTTCT No data
Right 1098682906 12:73380630-73380652 TGATAAGAATACATTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098682906 Original CRISPR TGATAAGAATACATTTTCTC TGG Intergenic
No off target data available for this crispr