ID: 1098688648

View in Genome Browser
Species Human (GRCh38)
Location 12:73458245-73458267
Sequence TCCTGTTTCATAGGCTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098688648_1098688650 2 Left 1098688648 12:73458245-73458267 CCACTTCAGCCTATGAAACAGGA No data
Right 1098688650 12:73458270-73458292 TGCCTTTTAACGAGATTCTCAGG No data
1098688648_1098688652 23 Left 1098688648 12:73458245-73458267 CCACTTCAGCCTATGAAACAGGA No data
Right 1098688652 12:73458291-73458313 GGTTATTTCTGTGCACCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098688648 Original CRISPR TCCTGTTTCATAGGCTGAAG TGG (reversed) Intergenic
No off target data available for this crispr