ID: 1098688650

View in Genome Browser
Species Human (GRCh38)
Location 12:73458270-73458292
Sequence TGCCTTTTAACGAGATTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098688649_1098688650 -7 Left 1098688649 12:73458254-73458276 CCTATGAAACAGGATCTGCCTTT No data
Right 1098688650 12:73458270-73458292 TGCCTTTTAACGAGATTCTCAGG No data
1098688648_1098688650 2 Left 1098688648 12:73458245-73458267 CCACTTCAGCCTATGAAACAGGA No data
Right 1098688650 12:73458270-73458292 TGCCTTTTAACGAGATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098688650 Original CRISPR TGCCTTTTAACGAGATTCTC AGG Intergenic
No off target data available for this crispr