ID: 1098688659

View in Genome Browser
Species Human (GRCh38)
Location 12:73458360-73458382
Sequence AACGAATTGAAAAAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098688659_1098688661 -2 Left 1098688659 12:73458360-73458382 CCATCAGACTTTTTCAATTCGTT No data
Right 1098688661 12:73458381-73458403 TTCCAATTGCACAGGCCCTTTGG No data
1098688659_1098688660 -10 Left 1098688659 12:73458360-73458382 CCATCAGACTTTTTCAATTCGTT No data
Right 1098688660 12:73458373-73458395 TCAATTCGTTCCAATTGCACAGG No data
1098688659_1098688665 13 Left 1098688659 12:73458360-73458382 CCATCAGACTTTTTCAATTCGTT No data
Right 1098688665 12:73458396-73458418 CCCTTTGGCTCAGATTTATAGGG No data
1098688659_1098688663 12 Left 1098688659 12:73458360-73458382 CCATCAGACTTTTTCAATTCGTT No data
Right 1098688663 12:73458395-73458417 GCCCTTTGGCTCAGATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098688659 Original CRISPR AACGAATTGAAAAAGTCTGA TGG (reversed) Intergenic
No off target data available for this crispr