ID: 1098690260

View in Genome Browser
Species Human (GRCh38)
Location 12:73479124-73479146
Sequence CCTCTCCCACCAAGCCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098690256_1098690260 9 Left 1098690256 12:73479092-73479114 CCTCCAGAAGTCCTCTGCTTTGT No data
Right 1098690260 12:73479124-73479146 CCTCTCCCACCAAGCCATCAAGG No data
1098690258_1098690260 -2 Left 1098690258 12:73479103-73479125 CCTCTGCTTTGTTAAAACAAACC No data
Right 1098690260 12:73479124-73479146 CCTCTCCCACCAAGCCATCAAGG No data
1098690257_1098690260 6 Left 1098690257 12:73479095-73479117 CCAGAAGTCCTCTGCTTTGTTAA No data
Right 1098690260 12:73479124-73479146 CCTCTCCCACCAAGCCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098690260 Original CRISPR CCTCTCCCACCAAGCCATCA AGG Intergenic
No off target data available for this crispr