ID: 1098695067

View in Genome Browser
Species Human (GRCh38)
Location 12:73542145-73542167
Sequence TAAGGTATAAAGAAGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098695067_1098695073 6 Left 1098695067 12:73542145-73542167 CCTGACCCCTTCTTTATACCTTA No data
Right 1098695073 12:73542174-73542196 ATAAACTCAAGATAGATTAAGGG No data
1098695067_1098695072 5 Left 1098695067 12:73542145-73542167 CCTGACCCCTTCTTTATACCTTA No data
Right 1098695072 12:73542173-73542195 AATAAACTCAAGATAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098695067 Original CRISPR TAAGGTATAAAGAAGGGGTC AGG (reversed) Intergenic
No off target data available for this crispr