ID: 1098700754

View in Genome Browser
Species Human (GRCh38)
Location 12:73622493-73622515
Sequence TCTGATATCCAGAATCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10319
Summary {0: 3, 1: 53, 2: 1166, 3: 4082, 4: 5015}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098700754_1098700758 24 Left 1098700754 12:73622493-73622515 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1098700758 12:73622540-73622562 AAAATTTTCTCCCATTCTGTAGG 0: 8879
1: 14882
2: 10936
3: 7247
4: 5330
1098700754_1098700756 -8 Left 1098700754 12:73622493-73622515 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1098700756 12:73622508-73622530 ATATCAGACCTTTGTCAGATGGG No data
1098700754_1098700755 -9 Left 1098700754 12:73622493-73622515 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1098700755 12:73622507-73622529 GATATCAGACCTTTGTCAGATGG 0: 29
1: 1203
2: 5577
3: 3321
4: 1595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098700754 Original CRISPR TCTGATATCCAGAATCTGCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr