ID: 1098701555

View in Genome Browser
Species Human (GRCh38)
Location 12:73634746-73634768
Sequence CTCTATAAATAGAGGCAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098701555_1098701560 23 Left 1098701555 12:73634746-73634768 CCATACTGCCTCTATTTATAGAG No data
Right 1098701560 12:73634792-73634814 AGAGGTTGGAGAGAGAGGAATGG No data
1098701555_1098701557 5 Left 1098701555 12:73634746-73634768 CCATACTGCCTCTATTTATAGAG No data
Right 1098701557 12:73634774-73634796 GAGATGAAAAGAAAGAAGAGAGG No data
1098701555_1098701559 18 Left 1098701555 12:73634746-73634768 CCATACTGCCTCTATTTATAGAG No data
Right 1098701559 12:73634787-73634809 AGAAGAGAGGTTGGAGAGAGAGG No data
1098701555_1098701561 24 Left 1098701555 12:73634746-73634768 CCATACTGCCTCTATTTATAGAG No data
Right 1098701561 12:73634793-73634815 GAGGTTGGAGAGAGAGGAATGGG No data
1098701555_1098701558 9 Left 1098701555 12:73634746-73634768 CCATACTGCCTCTATTTATAGAG No data
Right 1098701558 12:73634778-73634800 TGAAAAGAAAGAAGAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098701555 Original CRISPR CTCTATAAATAGAGGCAGTA TGG (reversed) Intergenic
No off target data available for this crispr