ID: 1098705591

View in Genome Browser
Species Human (GRCh38)
Location 12:73685055-73685077
Sequence ATTGGTTCTTTGGGGCCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098705591_1098705598 4 Left 1098705591 12:73685055-73685077 CCGTTGGGCCCCAAAGAACCAAT No data
Right 1098705598 12:73685082-73685104 ATACCCAGGTACTATATCAAGGG No data
1098705591_1098705595 -10 Left 1098705591 12:73685055-73685077 CCGTTGGGCCCCAAAGAACCAAT No data
Right 1098705595 12:73685068-73685090 AAGAACCAATAGCAATACCCAGG No data
1098705591_1098705597 3 Left 1098705591 12:73685055-73685077 CCGTTGGGCCCCAAAGAACCAAT No data
Right 1098705597 12:73685081-73685103 AATACCCAGGTACTATATCAAGG No data
1098705591_1098705601 10 Left 1098705591 12:73685055-73685077 CCGTTGGGCCCCAAAGAACCAAT No data
Right 1098705601 12:73685088-73685110 AGGTACTATATCAAGGGCCTTGG No data
1098705591_1098705602 11 Left 1098705591 12:73685055-73685077 CCGTTGGGCCCCAAAGAACCAAT No data
Right 1098705602 12:73685089-73685111 GGTACTATATCAAGGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098705591 Original CRISPR ATTGGTTCTTTGGGGCCCAA CGG (reversed) Intergenic
No off target data available for this crispr