ID: 1098705592

View in Genome Browser
Species Human (GRCh38)
Location 12:73685063-73685085
Sequence GTATTGCTATTGGTTCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098705592_1098705601 2 Left 1098705592 12:73685063-73685085 CCCCAAAGAACCAATAGCAATAC No data
Right 1098705601 12:73685088-73685110 AGGTACTATATCAAGGGCCTTGG No data
1098705592_1098705602 3 Left 1098705592 12:73685063-73685085 CCCCAAAGAACCAATAGCAATAC No data
Right 1098705602 12:73685089-73685111 GGTACTATATCAAGGGCCTTGGG No data
1098705592_1098705597 -5 Left 1098705592 12:73685063-73685085 CCCCAAAGAACCAATAGCAATAC No data
Right 1098705597 12:73685081-73685103 AATACCCAGGTACTATATCAAGG No data
1098705592_1098705598 -4 Left 1098705592 12:73685063-73685085 CCCCAAAGAACCAATAGCAATAC No data
Right 1098705598 12:73685082-73685104 ATACCCAGGTACTATATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098705592 Original CRISPR GTATTGCTATTGGTTCTTTG GGG (reversed) Intergenic
No off target data available for this crispr