ID: 1098705595

View in Genome Browser
Species Human (GRCh38)
Location 12:73685068-73685090
Sequence AAGAACCAATAGCAATACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098705588_1098705595 6 Left 1098705588 12:73685039-73685061 CCTGCTCACTGAACAGCCGTTGG No data
Right 1098705595 12:73685068-73685090 AAGAACCAATAGCAATACCCAGG No data
1098705587_1098705595 23 Left 1098705587 12:73685022-73685044 CCTGGCAGCATTTATTACCTGCT No data
Right 1098705595 12:73685068-73685090 AAGAACCAATAGCAATACCCAGG No data
1098705591_1098705595 -10 Left 1098705591 12:73685055-73685077 CCGTTGGGCCCCAAAGAACCAAT No data
Right 1098705595 12:73685068-73685090 AAGAACCAATAGCAATACCCAGG No data
1098705586_1098705595 28 Left 1098705586 12:73685017-73685039 CCAGACCTGGCAGCATTTATTAC No data
Right 1098705595 12:73685068-73685090 AAGAACCAATAGCAATACCCAGG No data
1098705585_1098705595 29 Left 1098705585 12:73685016-73685038 CCCAGACCTGGCAGCATTTATTA No data
Right 1098705595 12:73685068-73685090 AAGAACCAATAGCAATACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098705595 Original CRISPR AAGAACCAATAGCAATACCC AGG Intergenic
No off target data available for this crispr