ID: 1098705597

View in Genome Browser
Species Human (GRCh38)
Location 12:73685081-73685103
Sequence AATACCCAGGTACTATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098705588_1098705597 19 Left 1098705588 12:73685039-73685061 CCTGCTCACTGAACAGCCGTTGG No data
Right 1098705597 12:73685081-73685103 AATACCCAGGTACTATATCAAGG No data
1098705594_1098705597 -7 Left 1098705594 12:73685065-73685087 CCAAAGAACCAATAGCAATACCC No data
Right 1098705597 12:73685081-73685103 AATACCCAGGTACTATATCAAGG No data
1098705593_1098705597 -6 Left 1098705593 12:73685064-73685086 CCCAAAGAACCAATAGCAATACC No data
Right 1098705597 12:73685081-73685103 AATACCCAGGTACTATATCAAGG No data
1098705592_1098705597 -5 Left 1098705592 12:73685063-73685085 CCCCAAAGAACCAATAGCAATAC No data
Right 1098705597 12:73685081-73685103 AATACCCAGGTACTATATCAAGG No data
1098705591_1098705597 3 Left 1098705591 12:73685055-73685077 CCGTTGGGCCCCAAAGAACCAAT No data
Right 1098705597 12:73685081-73685103 AATACCCAGGTACTATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098705597 Original CRISPR AATACCCAGGTACTATATCA AGG Intergenic
No off target data available for this crispr