ID: 1098708019

View in Genome Browser
Species Human (GRCh38)
Location 12:73715964-73715986
Sequence AACAAAGATGTCCCCAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098708019_1098708021 2 Left 1098708019 12:73715964-73715986 CCTTGTTTGGGGACATCTTTGTT No data
Right 1098708021 12:73715989-73716011 TTAGTTATGGATTTTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098708019 Original CRISPR AACAAAGATGTCCCCAAACA AGG (reversed) Intergenic
No off target data available for this crispr