ID: 1098711134

View in Genome Browser
Species Human (GRCh38)
Location 12:73763808-73763830
Sequence ATCAACAATAGGAGGAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098711134_1098711137 -1 Left 1098711134 12:73763808-73763830 CCAGTATTCCTCCTATTGTTGAT No data
Right 1098711137 12:73763830-73763852 TTTCCAGTTTCATGTCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098711134 Original CRISPR ATCAACAATAGGAGGAATAC TGG (reversed) Intergenic
No off target data available for this crispr