ID: 1098711973

View in Genome Browser
Species Human (GRCh38)
Location 12:73774195-73774217
Sequence ATGCCCATCCAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098711973_1098711977 19 Left 1098711973 12:73774195-73774217 CCTTCACTCTTCTGGATGGGCAT No data
Right 1098711977 12:73774237-73774259 TTTATGGTTTGGAATAATTGTGG No data
1098711973_1098711976 8 Left 1098711973 12:73774195-73774217 CCTTCACTCTTCTGGATGGGCAT No data
Right 1098711976 12:73774226-73774248 AGGTCTCTTTCTTTATGGTTTGG No data
1098711973_1098711975 3 Left 1098711973 12:73774195-73774217 CCTTCACTCTTCTGGATGGGCAT No data
Right 1098711975 12:73774221-73774243 TTTTTAGGTCTCTTTCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098711973 Original CRISPR ATGCCCATCCAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr