ID: 1098711976 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:73774226-73774248 |
| Sequence | AGGTCTCTTTCTTTATGGTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098711969_1098711976 | 16 | Left | 1098711969 | 12:73774187-73774209 | CCAGGAGGCCTTCACTCTTCTGG | No data | ||
| Right | 1098711976 | 12:73774226-73774248 | AGGTCTCTTTCTTTATGGTTTGG | No data | ||||
| 1098711973_1098711976 | 8 | Left | 1098711973 | 12:73774195-73774217 | CCTTCACTCTTCTGGATGGGCAT | No data | ||
| Right | 1098711976 | 12:73774226-73774248 | AGGTCTCTTTCTTTATGGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098711976 | Original CRISPR | AGGTCTCTTTCTTTATGGTT TGG | Intergenic | ||
| No off target data available for this crispr | |||||