ID: 1098711977

View in Genome Browser
Species Human (GRCh38)
Location 12:73774237-73774259
Sequence TTTATGGTTTGGAATAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098711969_1098711977 27 Left 1098711969 12:73774187-73774209 CCAGGAGGCCTTCACTCTTCTGG No data
Right 1098711977 12:73774237-73774259 TTTATGGTTTGGAATAATTGTGG No data
1098711973_1098711977 19 Left 1098711973 12:73774195-73774217 CCTTCACTCTTCTGGATGGGCAT No data
Right 1098711977 12:73774237-73774259 TTTATGGTTTGGAATAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098711977 Original CRISPR TTTATGGTTTGGAATAATTG TGG Intergenic
No off target data available for this crispr