ID: 1098712805

View in Genome Browser
Species Human (GRCh38)
Location 12:73787020-73787042
Sequence GGACTACAGAAGCTGAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098712799_1098712805 11 Left 1098712799 12:73786986-73787008 CCTGGGATCCTAATTTCAATATT No data
Right 1098712805 12:73787020-73787042 GGACTACAGAAGCTGAGAAGGGG No data
1098712800_1098712805 3 Left 1098712800 12:73786994-73787016 CCTAATTTCAATATTGTTGTGCT No data
Right 1098712805 12:73787020-73787042 GGACTACAGAAGCTGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098712805 Original CRISPR GGACTACAGAAGCTGAGAAG GGG Intergenic
No off target data available for this crispr